Search Results

Search found 6319 results on 253 pages for 'double buffering'.

Page 12/253 | < Previous Page | 8 9 10 11 12 13 14 15 16 17 18 19  | Next Page >

  • casting doubles to integers in order to gain speed

    - by antirez
    Hello all, in Redis (http://code.google.com/p/redis) there are scores associated to elements, in order to take this elements sorted. This scores are doubles, even if many users actually sort by integers (for instance unix times). When the database is saved we need to write this doubles ok disk. This is what is used currently: snprintf((char*)buf+1,sizeof(buf)-1,"%.17g",val); Additionally infinity and not-a-number conditions are checked in order to also represent this in the final database file. Unfortunately converting a double into the string representation is pretty slow. While we have a function in Redis that converts an integer into a string representation in a much faster way. So my idea was to check if a double could be casted into an integer without lost of data, and then using the function to turn the integer into a string if this is true. For this to provide a good speedup of course the test for integer "equivalence" must be fast. So I used a trick that is probably undefined behavior but that worked very well in practice. Something like that: double x = ... some value ... if (x == (double)((long long)x)) use_the_fast_integer_function((long long)x); else use_the_slow_snprintf(x); In my reasoning the double casting above converts the double into a long, and then back into an integer. If the range fits, and there is no decimal part, the number will survive the conversion and will be exactly the same as the initial number. As I wanted to make sure this will not break things in some system, I joined #c on freenode and I got a lot of insults ;) So I'm now trying here. Is there a standard way to do what I'm trying to do without going outside ANSI C? Otherwise, is the above code supposed to work in all the Posix systems that currently Redis targets? That is, archs where Linux / Mac OS X / *BSD / Solaris are running nowaday? What I can add in order to make the code saner is an explicit check for the range of the double before trying the cast at all. Thank you for any help.

    Read the article

  • Actionscript: NetStream stutters after buffering.

    - by meandmycode
    Using NetStream to stream content from http, I've noticed that esp with certain exported h264's, if the player encounters an empty buffer, it will stop and buffer to the requested length (as expected). However once the buffer is full, the playback doesn't resume, but instead jumps ahead, as such- instantly playing the buffered duration in a brief moment, and thusly triggering an empty buffer again.. this will then continue over and over. Presumably when the netstream pauses to buffer, the playhead position continues, and the player is attempting to snap to that position on resume- however given it could take 5 seconds to build a 2 second buffer- it ends up with a useless buffer again.. (this is an assumption) I've attempted to work around this by listening for an empty buffer netstatus event, pausing the stream, and at the same time setting up a loop to check the current buffer length vs the requested buffer length.. and resuming once the buffer length is greater than or equal to the requested buffer.. however this causes problems when there isn't enough of the video remaining.. for example, a 10 second buffer with only 5 seconds remaining, the loop just sits there waiting for a buffer length of 10 seconds when theres only 5 left... You would think that you could simply check which was smaller, the time left or the requested buffer length.. however the times flash gives are not accurate.. If you add the net streams current time index, plus the buffered time, the total is not the entire duration of the movie (when at the end).. it is close but not the same. This brings me back to the original problem, and if there is another way to fix this, clearly flash knows when the buffer is ready, so how can i get flash pause when it buffers, and resume once the buffer is ready? currently it doesn't.. it pauses and then once the buffer is full- it plays the entire buffered content in about .1 of a second. Thanks in advance, Stephen.

    Read the article

  • EAGLView orientation changes and strange buffering

    - by Drew
    I'm writing an app that offloads some heavy drawing into an EAGLView, and it does some lightweight stuff in UIKit on top. It seems that the GL render during an orientation change is cached somewhere, and I can't figure out how to get access to it. Specifically: After an orientation change, calling glClear(GL_COLOR_BUFFER_BIT) isn't enough to clear the GL display (drawing is cached somewhere?) How can I clear this cache? After an orientation change, glReadPixel() can no longer access pixels drawn before the orientation change. How can I get access to where this is stored?

    Read the article

  • Default input and output buffering for fopen'd files?

    - by Evan Teran
    So a FILE stream can have both input and output buffers. You can adjust the output stream using setvbuf (I am unaware of any method to play with the input buffer size and behavior). Also, by default the buffer is BUFSIZ (not sure if this is a POSIX or C thing). It is very clear what this means for stdin/stdout/stderr, but what are the defaults for newly opened files? Are they buffered for both input and output? Or perhaps just one? If it is buffered, does output default to block or line mode?

    Read the article

  • How to implement buffering with timeout in RX

    - by Gaspar Nagy
    I need to implement an event processing, that is done delayed when there are no new events arriving for a certain period. (I have to queue up a parsing task when the text buffer changed, but I don't want to start the parsing when the user is still typing.) I'm new in RX, but as far as I see, I would need a combination of BufferWithTime and the Timeout methods. I imagine this to be working like this: it buffers the events until they are received regularly within a specified time period between the subsequent events. If there is a gap in the event flow (longer than the timespan) it should return propagate the events buffered so far. Having a look at how Buffer and Timeout is implemented, I could probably implement my BufferWithTimeout method (if everyone have one, please share with me), but I wonder if this can be achieved just by combining the existing methods. Any ideas?

    Read the article

  • SocketAsyncEventArgs and buffering while messages are in parts

    - by Rob
    C# socket server, which has roughly 200 - 500 active connections, each one constantly sending messages to our server. About 70% of the time the messages are handled fine (in the correct order etc), however in the other 30% of cases we have jumbled up messages and things get screwed up. We should note that some clients send data in unicode and others in ASCII, so that's handled as well. Messages sent to the server are a variable length string which end in a char3, it's the char3 that we break on, other than that we keep receiving data. Could anyone shed any light on our ProcessReceive code and see what could possibly be causing us issues and how we can solve this small issue (here's hoping it's a small issue!) Code below:

    Read the article

  • Windows 2008 R2 RDS - Double Login

    - by colo_joe
    Issue: Double logins when connecting to RemoteApps or Remote Desktop Environment: Gateway = 1 server 2008 R2 - Roles = Gateway, Session Broker, Connection Mgr, Session Host Configuration server Session hosts = 2 servers 2008 R2 - Roles = App Manager and Session host configuration Testing: I can get to the url http://RDS.domain.com/rdweb - I get prompted for authentication (1) Pass authentication, get list of remote apps. Click on remoteapps or remote desktop, get prompted for authentication again (2). Pass authentication, I get access to app or RDP. Done so far. On session host Signed rdp files with cert. Added the following to the custom RDP settings: Authenticaton level:i:0 = If server authentication fails, connect to the computer without warning (Connect and don’t warn me). prompt for credentials on client:i:1 = RDC will prompt for credentials when connecting to a server that does not support server authentication. enablecredsspsupport:i:1 = RDP will use CredSSP, if the operating system supports CredSSP. Edited the javascript file as found in http://support.microsoft.com/kb/977507 Added Connection ID, and added Web Access server to TS Web Access Computers group on the Session host servers, and Signed apps as found in hxxp://blogs.msdn.com/b/rds/archive/2009/08/11/introducing-web-single-sign-on-for-remoteapp-and-desktop-connections.aspx Note: This double login happens internally and externally.

    Read the article

  • Create a PDF that defaults to flip on short edge when printed double-sided

    - by user568458
    We're creating a 2-page PDF brochure with a target audience who will print it on their regular office or home printers. If it is printed on a double-sided printer (common in offices), it'll come out correctly if set manually by the user to "Flip on short edge", but will come out with the second page upside down if default settings are used (flip on long edge). Our target audience aren't very tech-literate, and we've found that even within our own office network there is variation in the location of the 'Flip on short edge' setting - so it isn't realistic to give everyone who downloads the PDF instructions on how to change this setting or to expect everyone to find out how to change the setting off their own backs. So, when creating a PDF (ideally using Adobe InDesign or Acrobat, but if other software or hacking is needed that's fine...), is there a way to configure the PDF file itself so that when printed double-sided with default settings, it flips on the short edge? If possible, it'll be useful supplementary info to know how reliable any such methods are across different PDF readers (e.g. Adobe Reader, Acrobat, Mac Preview, inbuilt browser readers (e.g. chrome), FoxIt, etc). If questions about content creation like this aren't a great fit here, feel free to migrate it to the graphic design stackexchange site - this question seems to fall half way between the two sites

    Read the article

  • Force line-buffering of stdout when piping to tee

    - by houbysoft
    Usually, stdout is line-buffered. In other words, as long as your printf argument ends with a newline, you can expect the line to be printed instantly. This does not appear to hold when using a pipe to redirect to tee. I have a C++ program, a, that outputs strings, always \n-terminated, to stdout. When it is run by itself (./a), everything prints correctly and at the right time, as expected. However, if I pipe it to tee (./a | tee output.txt), it doesn't print anything until it quits, which defeats the purpose of using tee. I know that I could fix it by adding a fflush(stdout) after each printing operation in the C++ program. But is there a cleaner, easier way? Is there a command I can run, for example, that would force stdout to be line-buffered, even when using a pipe?

    Read the article

  • CGI Buffering issue

    - by Punit
    I have a server side C based CGI code as: cgiFormFileSize("UPDATEFILE", &size); //UPDATEFILE = file being uploaded cgiFormFileName("UPDATEFILE", file_name, 1024); cgiFormFileContentType("UPDATEFILE", mime_type, 1024); buffer = malloc(sizeof(char) * size); if (cgiFormFileOpen("UPDATEFILE", &file) != cgiFormSuccess) { exit(1); } output = fopen("/tmp/cgi.tar.gz", "w+"); printf("The size of file is: %d bytes", size); inc = size/(1024*100); while (cgiFormFileRead(file, b, sizeof(b), &got_count) == cgiFormSuccess) { fwrite(b,sizeof(char),got_count,output); i++; if(i == inc && j<=100) { ***inc_pb*** = j; i = 0; j++; // j is the progress bar increment value } } cgiFormFileClose(file); retval = system("mkdir /tmp/update-tmp;\ cd /tmp/update-tmp;\ tar -xzf ../cgi.tar.gz;\ bash -c /tmp/update-tmp/update.sh"); However, this doesn't work the way as is seen above. Instead of printing 1,2,...100 to progress_bar.txt one by one it prints at ONE GO, seems it buffers and then writes to the file. fflush() also didn't work. Any clue/suggestion would be really appreciated.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • BufferedReader no longer buffering after a while?

    - by BobTurbo
    Sorry I can't post code but I have a bufferedreader with 50000000 bytes set as the buffer size. It works as you would expect for half an hour, the HDD light flashing every two minutes or so, reading in the big chunk of data, and then going quiet again as the CPU processes it. But after about half an hour (this is a very big file), the HDD starts thrashing as if it is reading one byte at a time. It is still in the same loop and I think I checked free ram to rule out swapping (heap size is default). Probably won't get any helpful answers, but worth a try. OK I have changed heap size to 768mb and still nothing. There is plenty of free memory and java.exe is only using about 300mb. Now I have profiled it and heap stays at about 200MB, well below what is available. CPU stays at 50%. Yet the HDD starts thrashing like crazy. I have.. no idea. I am going to rewrite the whole thing in c#, that is my solution. Here is the code (it is just a throw-away script, not pretty): BufferedReader s = null; HashMap<String, Integer> allWords = new HashMap<String, Integer>(); HashSet<String> pageWords = new HashSet<String>(); long[] pageCount = new long[78592]; long pages = 0; Scanner wordFile = new Scanner(new BufferedReader(new FileReader("allWords.txt"))); while (wordFile.hasNext()) { allWords.put(wordFile.next(), Integer.parseInt(wordFile.next())); } s = new BufferedReader(new FileReader("wikipedia/enwiki-latest-pages-articles.xml"), 50000000); StringBuilder words = new StringBuilder(); String nextLine = null; while ((nextLine = s.readLine()) != null) { if (a.matcher(nextLine).matches()) { continue; } else if (b.matcher(nextLine).matches()) { continue; } else if (c.matcher(nextLine).matches()) { continue; } else if (d.matcher(nextLine).matches()) { nextLine = s.readLine(); if (e.matcher(nextLine).matches()) { if (f.matcher(s.readLine()).matches()) { pageWords.addAll(Arrays.asList(words.toString().toLowerCase().split("[^a-zA-Z]"))); words.setLength(0); pages++; for (String word : pageWords) { if (allWords.containsKey(word)) { pageCount[allWords.get(word)]++; } else if (!word.isEmpty() && allWords.containsKey(word.substring(0, word.length() - 1))) { pageCount[allWords.get(word.substring(0, word.length() - 1))]++; } } pageWords.clear(); } } } else if (g.matcher(nextLine).matches()) { continue; } words.append(nextLine); words.append(" "); }

    Read the article

  • Why isn't my log4net appender buffering?

    - by Eric
    I've created a custom log4net appender. It descends from log4net.Appender.SmtpAppender which descends from log4net.Appender.BufferingAppenderSkeleton. I programatically setup the following parameters in its constructor: this.Lossy = false; //don't drop any messages this.BufferSize = 3; //buffer up to 3 messages this.Threshold = log4net.Core.Level.Error; //append messages of Error or higher this.Evaluator = new log4net.Core.LevelEvaluator(Level.Off); //don't flush the buffer for any message, regardless of level I expect this would buffer 3 events of level Error or higher and deliver those events when the buffer is filled. However, I'm finding that the events are not buffered at all; instead, SendBuffer() is called immediately every time an error is logged. Is there a mistake in my configuration? Thanks

    Read the article

  • What is faster: multiple `send`s or using buffering?

    - by dauerbaustelle
    I'm playing around with sockets in C/Python and I wonder what is the most efficient way to send headers from a Python dictionary to the client socket. My ideas: use a send call for every header. Pros: No memory allocation needed. Cons: many send calls -- probably error prone; error management should be rather complicated use a buffer. Pros: one send call, error checking a lot easier. Cons: Need a buffer :-) malloc/realloc should be rather slow and using a (too) big buffer to avoid realloc calls wastes memory. Any tips for me? Thanks :-)

    Read the article

  • Is there a way to set up a Linux pipe to non-buffering or line-buffering?

    - by ern0
    My program is controlling an external application on Linux, passing in input commands via a pipe to the external applications stdin, and reading output result via a pipe from the external applications stdout. The problem is that writes to pipes are buffered by block, and not by line, and therefore delays occur before my app receives data output by the external application. The external application cannot be altered to add explicit fflush() calls. When I set the external application to /bin/cat -n (it echoes back the input, with line numbers added), it works correctly, it seems, cat flushes after each line. The only way to force the external application to flush, is sending exit command to it; as it receives the command, it flushes, and all the answers appears on the stdout, just before exiting. I'm pretty sure, that Unix pipes are appropiate solution for that kind of interprocess communication (pseudo server-client), but maybe I'm wrong. (I've just copied some text from a similar question: Force another program's standard output to be unbuffered using Python)

    Read the article

  • What about buffering FileInputStream?

    - by Pregzt
    I have a piece of code that reads hell of a lot (hundreds of thousand) of relatively small files (couple of KB) from the local file system in a loop. For each file there is a java.io.FileInputStream created to read the content. The process its very slow and take ages. Do you think that wrapping the FIS into java.io.BufferedInputStream would make a significant difference?

    Read the article

  • Java Applet Buffering images

    - by Dan
    OK so here's my code: http://www.so.pastebin.com/Qca4ERmy I am trying to use buffers so the applet won't flicker upon redraw() but it seems I am having trouble. The applet still flickers.... Help? Thank you.

    Read the article

  • Administrator's shortcut to batch file with double quoted parameters

    - by XXB
    Take an excruciatingly simple batch file: echo hi pause Save that as test.bat. Now, make a shortcut to test.bat. The shortcut runs the batch file, which prints "hi" and then waits for a keypress as expected. Now, add some argument to the target of the shortcut. Now you have a shortcut to: %path%\test.bat some args The shortcut runs the batch file as before. Now, run the shortcut as administrator. (This is on Windows 7 by the way.) You can use either right-click - Run as Administrator, or go to the shortcut's properties and check the box in the advanced section. Tell UAC that it's okay and once again the shortcut runs the batch file as expected. Now, change the arguments in the target of the shortcut to add double quotes: %path%\test.bat "some args" Now try the shortcut as administrator. It doesn't work this time! A command window pops up and and disappears too fast to see any error. I tried adding test.log 2&1 to the shortcut, but no log is created in this case. Try running the same shortcut (with the double quotes) but not as Administrator. It runs the batch file fine. So, it seems the behavior is not because of the double quoted parameters, and it's not because it's run as Administrator. It's some weird combination of the two. I also tried running the same command from an administrator's command window. This ran the batch file as expected without error. Running the shortcut from the command window spawned a new command window which flashed and went away. So apparently the issue is caused by a combination of administrator, the shortcut, and the double quotes. I'm totally stumped, does anyone have any idea what's going on?

    Read the article

  • Listen to double click not click

    - by Mohsen
    I'm just wondering why click event happening when I dbclick an element? I have this code:(JSBIN) HTML <p id="hello">Hello World</p> JavaScript document.getElementById('hello').addEventListener('click', function(e){ e.preventDefault(); this.style.background = 'red'; }, false); document.getElementById('hello').addEventListener('dbclick', function(){ this.style.background = 'yellow'; }, false); It should do different things for click and double click, but it seems when you double click on the p it catch click event in advance and ignore double click. I tried preventDefault the click event too. How can I listen to just dbclick? UPDATE I had a typo in my code. dbclick is wrong. It's dblclick. Anyway the problem still exist. When user double clicks the click event happens. This is updated code that prove it:(JSBin) document.getElementById('hello').addEventListener('click', function(e){ e.preventDefault(); this.style.background = 'red'; this.innerText = "Hello World clicked"; }, false); document.getElementById('hello').addEventListener('dblclick', function(){ this.style.background = 'green'; }, false);

    Read the article

  • Perl regex which grabs ALL double letter occurances in a line

    - by phileas fogg
    Hi all, still plugging away at teaching myself Perl. I'm trying to write some code that will count the lines of a file that contain double letters and then place parentheses around those double letters. Now what I've come up with will find the first ocurrance of double letters, but not any other ones. For instance, if the line is: Amp, James Watt, Bob Transformer, etc. These pioneers conducted many My code will render this: 19 Amp, James Wa(tt), Bob Transformer, etc. These pioneers conducted many The "19" is the count (of lines containing double letters) and it gets the "tt" of "Watt" but misses the "ee" in "pioneers". Below is my code: $file = '/path/to/file/electricity.txt'; open(FH, $file) || die "Cannot open the file\n"; my $counter=0; while (<FH>) { chomp(); if (/(\w)\1/) { $counter += 1; s/$&/\($&\)/g; print "\n\n$counter $_\n\n"; } else { print "$_\n"; } } close(FH); What am I overlooking? TIA!

    Read the article

  • Utility for scanning stacks of double-sided documents

    - by Peter Becich
    I have a simplex scanner with document feeder, and am looking for the best way to scan double-sided notes. It would be useful to be able to scan the same stack twice, once flipped, and have a utility automatically interleave the scanned images. Multi-page PDF export would also be nice. Is there a tool to do this? Otherwise, I'm considering writing it in Python, with the imagescanner module, if it can use the ADF -- http://pypi.python.org/pypi/imagescanner/0.9 Thanks

    Read the article

  • Direct Link to IRC Server with Double ##

    - by bemental
    Trying to create a direct link to an IRC channel with double octothorpes (##). Freenode policy dictates off-topic channels require ## before the channel name. This O'Reilly 'hack' post gives solid instructions for how to link to a channel and open in the default client on a system, but no guidance for channels with doubles. Links to single channels are formatted as "irc://irc-server:port/channel?key"

    Read the article

< Previous Page | 8 9 10 11 12 13 14 15 16 17 18 19  | Next Page >