Search Results

Search found 450 results on 18 pages for 'vincent chan'.

Page 12/18 | < Previous Page | 8 9 10 11 12 13 14 15 16 17 18  | Next Page >

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Pear SOAP and XAMPP on Ubuntu

    - by Vincent
    All, I have installed xampp for linux on ubuntu 9.10. The installation directory is /opt/lampp. The xampp website says PEAR comes with the installation.. I am relatively new to PEAR and want to know the answers for following: Is PEAR installed with xampp or need to be installed separately using synaptic package manager? I browse to /opt/lampp/bin directory and see "pear" there, but when i type it in the command line, it says "The program 'pear' is currently not installed. You can install it by typing: sudo apt-get install php-pear pear: command not found " I want to use PEAR:SOAP package in my PHP code. How to use that? Do I need to set any paths to the pear in my php.ini? Thanks

    Read the article

  • merge() multiple data frames (do.call ?)

    - by Vincent
    Hi everyone, here's my very simple question: merge() only takes two data frames as input. I need to merge a series of data frames from a list, using the same keys for every merge operation. Given a list named "test", I want to do something like: do.call("merge", test). I could write some kind of loop, but I'm wondering if there's a standard or built-in way to do this more efficiently. Any advice is appreciated. Thanks! Here's a subset of the dataset in dput format (note that merging on country is trivial in this case, but that there are more countries in the original data): test <- list(structure(list(country = c("United States", "United States", "United States", "United States", "United States"), NY.GNS.ICTR.GN.ZS = c(13.5054687, 14.7608697, 14.1115876, 13.3389063, 12.9048351), year = c(2007, 2006, 2005, 2004, 2003)), .Names = c("country", "NY.GNS.ICTR.GN.ZS", "year"), row.names = c(NA, 5L), class = "data.frame"), structure(list( country = c("United States", "United States", "United States", "United States", "United States"), NE.TRD.GNFS.ZS = c(29.3459277, 28.352838, 26.9861939, 25.6231246, 23.6615328), year = c(2007, 2006, 2005, 2004, 2003)), .Names = c("country", "NE.TRD.GNFS.ZS", "year"), row.names = c(NA, 5L), class = "data.frame"), structure(list( country = c("United States", "United States", "United States", "United States", "United States"), NY.GDP.MKTP.CD = c(1.37416e+13, 1.31165e+13, 1.23641e+13, 1.16309e+13, 1.0908e+13), year = c(2007, 2006, 2005, 2004, 2003)), .Names = c("country", "NY.GDP.MKTP.CD", "year"), row.names = c(NA, 5L), class = "data.frame"))

    Read the article

  • Hibernate Search Paging + FullTextSearch + Criteria

    - by Roy Chan
    I am trying to do a search with some criteria FullTextQuery fullTextQuery = fullTextSession.createFullTextQuery(finalQuery, KnowledgeBaseSolution.class).setCriteriaQuery(criteria); and then page it //Gives me around 700 results result.setResultCount(fullTextQuery.getResultSize()); //Some pages are empty fullTextQuery.setFirstResult(( (pageNumber - 1) * pageSize )); fullTextQuery.setMaxResults( pageSize ); result.setResults(fullTextQuery.list()); I suspect Lucene return full result of the full text search without taking the criteria into account and then hibernate search applies the criteria after, therefore some page are empty (after filtering by criteria) What is proper way to do fullTextSearch with some criteria, is it possible to apply the criteria before the lucene search? Or do I have to use pure Lucene (if so what's the point of Hibernate Search?) Thanks in advance

    Read the article

  • Launch Apple's Stocks app, with a particular stock selected

    - by Vincent Gable
    I would like to launch Apple's Stocks app to show information for a particular stock, on a non-jailbroken phone. I'm not interesting in how to get a quote or graph a stock myself, just opening Stocks.app. I was hoping that the Stocks app would have a custom URL format, so opening a URL like stocks://AAPL would do the trick. But I haven't found anything documenting such a scheme, and suspect it doesn't exist. Any other ideas, or is it impossible to integrate with the native Stocks app?

    Read the article

  • cfchart ignores my scalefrom value

    - by Monte Chan
    Hi all, I have the following codes in my page. The style variable holds the custom style. <cfchart chartheight="450" chartwidth="550" gridlines="9" yaxistitle="Score" scalefrom="20" scaleto="100" style="#style#" format="png" > <cfchartseries query="variables.chart_query" type="scatter" seriescolor="##000000" itemcolumn="MyItem" valuecolumn="MyScore"/> </cfchart> Before I begin, please go to http://www.monteandjanicechan.com/chart_good.jpg. This is how I want my report to come up. On the x-axis, there will always be three items as long as at least one of them has values. If an item does not have any values (i.e. 2010), there would not be a marker in the chart. The problem occurs only when only one item has value. Please see http://www.monteandjanicechan.com/chart_bad.jpg. As you can see, 2008 and 2010 do not have any values; y-axis is now scaled from 0 to 100. I have tried setting one of the items (ex. 2008) a value of 0 or something off the chart; it would scale according to this off-the-chart value and the 2009 value. In short, I have to have at least two items with values between 20 and 100 in order for cfchart to scale from 20 to 100. My question is, how can I correct the issue so that cfchart would ALWAYS scale from 20 to 100? I am running CF9. Thanks in advance, Monte

    Read the article

  • Updating with Related Entities - Entity Framework v4

    - by Vincent BOUZON
    Hi, I use Entity Framework V4 and i want to update Customer who have Visits. My code : EntityKey key; object originalItem; key = this._modelContainer.CreateEntityKey("Customers", customer); if (this._modelContainer.TryGetObjectByKey(key, out originalItem)) { this._modelContainer.ApplyCurrentValues(key.EntitySetName, customer); } this._modelContainer.SaveChanges(); It works for Scalar Property only. The customers.Visits collection is not updated. Best Regards :)

    Read the article

  • JQuery - Nested AJAX

    - by Vincent
    All, I am trying to perform a nested AJAX call using the following code. The nested call doesn't seem to work. Am I doing anything wrong? $.ajax({ type: 'GET', url: "/public/customcontroller/dosomething", cache: false, dataType: "html", success: function(html_input) { $.ajax({ type: 'GET', url: "/public/customcontroller/getjobstatus", cache: false, dataType: "html", success: function(html_input){ alert(html_input); } }); } }); Thanks

    Read the article

  • How to allow multiple users to manage application running on server?

    - by Mary-Chan
    I'm not sure if the title makes sense. Hard question to ask. I have an application running on a server under my network account, and it's scheduled to run daily. I can remote in with my user credentials and check on the application. What if I want more than one person to be able to remote in and check it? I can create a new account on the server, but it wouldn't have network rights and the application needs access to network folders. What would be the best approach? Thanks! :-) P.S. Feel free to edit the tags. I can't figure out what to pick.

    Read the article

  • how to link a java class to a image button in eclipse?

    - by Isabella Chan
    I am trying to create a application that includes a Imagebutton and by clicking on the imagebutton, the application will start to run another java class that is within the package itself. I try using this method, however the program stopped working immediately? how should i code the codes instead? can anyone help me? Thanks :D package com.fyp.gulliver; import android.app.Activity; import android.content.Intent; import android.os.Bundle; import android.view.View; import android.widget.Button; public class GulliverActivity extends Activity { /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); //---Map button--- Button btnMap = (Button) findViewById(R.id.map); btnMap.setOnClickListener(new View.OnClickListener() { Class ourClass; public void onClick(View v) { // TODO Auto-generated method stub try { ourClass = Class.forName ("com.fyp.gulliver.Maps"); Intent ourIntent = new Intent(GulliverActivity.this, ourClass); startActivity(ourIntent); } catch (ClassNotFoundException e) { // TODO Auto-generated catch block e.printStackTrace(); } } }); } }

    Read the article

  • retrieving information from web service calls

    - by Monte Chan
    Hi all, I am trying to retrieve information from a web service call. The following is what I have so far. In my text view, it is showing Map {item=anyType{key=TestKey; value=2;}; item=anyType{key=TestField; value=adsfasd; };} When I ran that in the debugger, I can see the information above in the variable, tempvar. But the question is, how do I retrieve the information (i.e. the actual values of "key" and "value" in each of the array positions)? Yes, I know there is a lot going on in onCreate and I will fix it later. Thanks in advance, Monte My codes are as follows, import java.util.Vector; import android.app.Activity; import android.os.Bundle; import android.widget.TextView; import org.ksoap2.SoapEnvelope; import org.ksoap2.serialization.SoapObject; import org.ksoap2.serialization.SoapSerializationEnvelope; import org.ksoap2.transport.AndroidHttpTransport; public class ViewHitUpActivity extends Activity { private static final String SOAP_ACTION = "test_function"; private static final String METHOD_NAME = "test_function"; private static final String NAMESPACE = "http://www.monteandjanicechan.com/"; private static final String URL = "http://www.monteandjanicechan.com/ws/test_ws.cfc?wsdl"; // private Object resultRequestSOAP = null; private TextView tv; /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); SoapObject request = new SoapObject(NAMESPACE, METHOD_NAME); tv = (TextView)findViewById(R.id.people_view); //SoapObject request.addProperty("test_item", "1"); SoapSerializationEnvelope envelope = new SoapSerializationEnvelope(SoapEnvelope.VER11); envelope.setOutputSoapObject(request); AndroidHttpTransport androidHttpTransport = new AndroidHttpTransport(URL); try { androidHttpTransport.call(SOAP_ACTION, envelope); /* resultRequestSOAP = envelope.getResponse(); Vector tempResult = (Vector) resultRequestSOAP("test_functionReturn"); */ SoapObject resultsRequestSOAP = (SoapObject) envelope.bodyIn; Vector tempResult = (Vector) resultsRequestSOAP.getProperty("test_functionReturn"); int testsize = tempResult.size(); // SoapObject test = (SoapObject) tempResult.get(0); //String[] results = (String[]) resultRequestSOAP; Object tempvar = tempResult.elementAt(1); tv.setText(tempvar.toString()); } catch (Exception aE) { aE.printStackTrace (); tv.setText(aE.getClass().getName() + ": " + aE.getMessage()); } } }

    Read the article

  • Ruby use method only if condition is true

    - by Vincent
    So I have this code: class Door # ... def info attr = "" return { "width" => @width, "height" => @height, "color" => @color }[attr] if attr != "" end end mydoor = Door.new(100, 100, "red") puts mydoor.info("width") puts mydoor.info The method "info" should return the hash if no argument is provided, otherwise the value of the argument in the hash. How can I achieve that?

    Read the article

  • SQL Server: Check if table exists

    - by Vincent
    I would like this to be the ultimate discussion on how to check if a table exists in SQL Server 2000/2005 using SQL Statement. When you Google for the answer, you get so many different answers. Is there an official/backward & forward compatible way of doing it? Here are two ways to start discussion: IF EXISTS (SELECT 1 FROM INFORMATION_SCHEMA.TABLES WHERE TABLE_TYPE='BASE TABLE' AND TABLE_NAME='mytablename') SELECT 1 AS res ELSE SELECT 0 AS res; IF OBJECT_ID (N'".$table_name."', N'U') IS NOT NULL SELECT 1 AS res ELSE SELECT 0 AS res; MySQL provides a nice SHOW TABLES LIKE '%tablename%'; statement. I am looking for something similar.

    Read the article

  • What to do of exceptions when implementing java.lang.Iterator

    - by Vincent Robert
    The java.lang.Iterator interface has 3 methods: hasNext, next and remove. In order to implement a read-only iterator, you have to provide an implementation for 2 of those: hasNext and next. My problem is that these methods does not declare any exceptions. So if my code inside the iteration process declares exceptions, I must enclose my iteration code inside a try/catch block. My current policy has been to rethrow the exception enclosed in a RuntimeException. But this has issues because the checked exceptions are lost and the client code no longer can catch those exceptions explicitly. How can I work around this limitation in the Iterator class? Here is a sample code for clarity: class MyIterator implements Iterator { @Override public boolean hasNext() { try { return implementation.testForNext(); } catch ( SomethingBadException e ) { throw new RuntimeException(e); } } @Override public boolean next() { try { return implementation.getNext(); } catch ( SomethingBadException e ) { throw new RuntimeException(e); } } ... }

    Read the article

  • Excel 2007 Visual Basic Editor: eats spaces, throws cursor around

    - by Vincent
    I can't resolve this issue, I found a similar question here but: setting the workbook to Manual calculation (alt-m-x-m or alt-t-oformulas) didn't work Setting editor options to disable: Auto syntax check & Background compile didn't work anybody have any idea how to fix this very annoying behaviour, I'm used to quickly pop up VBA (alt-f11), f7 to get into code and write some quick procedures there... and it's hard to get out of that habit, I don't want to write any office extension to just add a single quote to every cell in the range For Each rg In Selection rg = chr(39) & rg.value Next F5, done...

    Read the article

  • Set compression level when generating a ZIP file using RubyZip

    - by Vincent Robert
    Hi, I have a Ruby program that zips a directory tree of XML files using the rubyzip gem. My problem is that the file is starting to be heavy and I would like to increase the compression level, since compression time is not an issue. I could not find in the rubyzip documentation a way to specify the compression level for the created ZIP file. Anyone know how to change this setting?

    Read the article

  • ICalendar parser in PHP that supports timezones

    - by Vincent Robert
    I am looking for a PHP class that can parse an ICalendar (ICS) file and correctly handle timezones. I already created an ICS parser myself but it can only handle timezones known to PHP (like 'Europe/Paris'). Unfortunately, ICS file generated by Evolution (default calendar software of Ubuntu) does not use default timezone IDs. It exports events with its a specific timezone ID exporting also the full definition of the timezone: daylight saving dates, recurrence rule and all the hard stuff to understand about timezones. This is too much for me. Since it was only a small utility for my girlfriend, I won't have time to investigate further the ICalendar specification and create a full blown ICalendar parser myself. So is there any known implementation in PHP of ICalendar file format that can parse timezones definitions?

    Read the article

  • Is AutoMapper able to auto resolve types base on existing maps

    - by Chi Chan
    I have the following code: [SetUp] public void SetMeUp() { Mapper.CreateMap<SourceObject, DestinationObject>(); } [Test] public void Testing() { var source = new SourceObject {Id = 123}; var destination1 = Mapper.Map<SourceObject, DestinationObject>(source); var destination2 = Mapper.Map<ObjectBase, ObjectBase>(source); //Works Assert.That(destination1.Id == source.Id); //Fails, gives the same object back Assert.That(destination2 is DestinationObject); } public class ObjectBase { public int Id { get; set; } } public class SourceObject : ObjectBase { } public class DestinationObject : ObjectBase { } So basically, I want AutoMapper to automatically resolve the destination type to "DestinationObject" based on the existing Maps set up in AutoMapper. Is there a way to achieve this?

    Read the article

  • Custom Date Format with jax-rs in apache cxf?

    - by Oscar Chan
    Hi, I have been googling to figure out how I can customize the Date format when I use jax-rs on apache CXF. I looked at the codes, and it seems that it only support primitives, enum and a special hack that assume the type associated with @ForumParam has a constructor with a single string parameter. This force me to use String instead of Date if I want to use ForumParam. it is kind of ugly. Is there a better way to do it? @POST @Path("/xxx") public String addPackage(@FormParam("startDate") Date startDate) { ... } Thanks

    Read the article

  • Hibernate constraint ConstraintViolationException. Is there an easy way to ignore duplicate entries?

    - by vincent
    Basically I've got the below schema and I'm inserting records if they don't exists. However when it comes to inserting a duplicate it throws and error as I would expect. My question is whether there is an easy way to make Hibernate to just ignore inserts which would in effect insert duplicates? CREATE TABLE IF NOT EXISTS `method` ( `id` bigint(20) NOT NULL AUTO_INCREMENT, `name` varchar(10) DEFAULT NULL, PRIMARY KEY (`id`), UNIQUE KEY `name` (`name`) ) ENGINE=MyISAM DEFAULT CHARSET=latin1 AUTO_INCREMENT=2 ; SEVERE: Duplicate entry 'GET' for key 'name' Exception in thread "pool-11-thread-4" org.hibernate.exception.ConstraintViolationException: could not insert:

    Read the article

  • set a default saving data in a selection box in HABTM model

    - by vincent low
    here is my problem which in my system. my system allow user to add event, which include date, time, places. In the other hand, user are allow to choose the "Event sharing to" some of other user. So i successful to created and share to other user, when the user login which are being choose to share with the event, he is able to view for that particular event. But the problem is, when user add the event, he must choose for his own name also in the select box. If not he will be unable to read the event that he had created. So i need to save a default data to my model, which is whenever the user got choose the sharing event or not, it also will save the data to his user id. here is my code for select box, what can i edit and do to let it set a default saving value which is always save with the user own data?? input('User',array( 'label' = 'Select Related Potential', 'options' = $users, //'id'='user', 'style'='width:250px;height:100px', //'selected' = $ownUserId )); ? i try to solve by adding 1 more row to the add.ctp, but the permission just set to the own user who created it, the other user i choose is unable to read. $form-input('User',array( 'label' = 'Select Related Potential', 'options' = $users, //'id'='user', 'style'='width:250px;height:100px', 'selected' = $ownUserId )); $form-input('User',array('type'='hidden','value'=$ownUserId));

    Read the article

< Previous Page | 8 9 10 11 12 13 14 15 16 17 18  | Next Page >