Search Results

Search found 47692 results on 1908 pages for 'system io'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 121/1908 | < Previous Page | 117 118 119 120 121 122 123 124 125 126 127 128  | Next Page >

  • What file format can I use to output a formatted text file straight from a program without having the markup be too complicated?

    - by Matt
    Premise: I am parsing a file that is quite nearly XML, but not quite. From this file I would like to extract data and output in a file that a user could open up in some program and read. To make the data reasonable, I would almost certainly need to format the text. In case it matters, I will probably be using Java to write the program. Problem: I cannot find a file format that supports formatting without having terribly complex rules and encoding problems. Attempts: I looked into a basic .txt extension first, but it does not have enough formatting advantage. I then tried a .rtf extension, but the rules for outputting text seem to be terribly complicated. It was then suggested that I used XML, but I do not understand how this file would be viewed. This appears to be probably the best solution, but I don't understand much about it. Perhaps somebody could shed some light here. In Other Words: Could somebody suggest and easy to use file format and/or shed some light on how to use XML for text formatting and viewing?

    Read the article

  • Why does DataInputStream not support integers?

    - by Jason
    I need to read in a list of numbers from a file, none of which are larger than 32767. Originally I was going to use the Scanner class to pull in the data, then I read about DataInputStream. This would work well for me, except that according to the API, it supports all primitive variables EXCEPT ints! Listed are longs, shorts, bytes, chars, booleans, ect, but no ints. I have no need for double precision from the incoming data. Is this a deliberate or unintentional oversight?

    Read the article

  • How to open files in Java Swing without JFileChooser

    - by ron
    I'm using Java Swing (GUI) and I want to add a button to my project for opening files . I don't like the JFileChooser since it opens a small window for browsing through the files of the directories . Can I use something else , instead of the JFileChooser under Java Swing ? I've tried to use elements of SWT but it didn't work , meaning is the use of the button object and then use it inside the Jframe , but that failed , so I guess SWT and Swing don't mix together? Here is the example of Java Swing with JFileChooser and I'm looking for something like this to put in my JFrame.

    Read the article

  • fprintf() within a subprogram

    - by sergio
    Im stuck when trying to write to my file within my subprogram. void new_page(float *a, float *b, float *c, int *d){ fprintf(results,"\nPage Totals: %f\t%f\t%f\t%d", *a,*b,*c,*d); } I get a warning saying "Warning: incompatible implicit declaration of built-in function 'fprinf' [enabled by default]" "error: 'results' undeclared (first use in this function)" in main fprintf works fine, its just when it comes to the subprogram/function it wont work. from my understanding it thinks that results is undeclared, so do i have to pass the name or location of the file to make it work?

    Read the article

  • Most efficient way to write over file after reading

    - by Ryan McClure
    I'm reading in some data from a file, manipulating it, and then overwriting it to the same file. Until now, I've been doing it like so: open (my $inFile, $file) or die "Could not open $file: $!"; $retString .= join ('', <$inFile>); ... close ($inFile); open (my $outFile, $file) or die "Could not open $file: $!"; print $outFile, $retString; close ($inFile); However I realized I can just use the truncate function and open the file for read/write: open (my $inFile, '+<', $file) or die "Could not open $file: $!"; $retString .= join ('', <$inFile>); ... truncate $inFile, 0; print $inFile $retString; close ($inFile); I don't see any examples of this anywhere. It seems to work well, but am I doing it correctly? Is there a better way to do this?

    Read the article

  • best way to output a full precision double into a text file

    - by flevine100
    Hi, I need to use an existing text file to store some very precise values. When read back in, the numbers essentially need to be exactly equivalent to the ones that were originally written. Now, a normal person would use a binary file... for a number of reasons, that's not possible in this case. So... do any of you have a good way of encoding a double as a string of characters (aside from increasing the precision). My first thought was to cast the double to a char[] and write out the chars. I don't think that's going to work because some of the characters are not visible, produce sounds, and even terminate strings ('\0'... I'm talkin to you!) Thoughts?

    Read the article

  • Why does C's "fopen" take a "const char *" as its second argument?

    - by Chris Cooper
    It has always struck me as strange that the C function "fopen" takes a "const char *" as the second argument. I would think it would be easier to both read your code and implement the library's code if there were bit masks defined in stdio.h, like "IO_READ" and such, so you could do things like: FILE* myFile = fopen("file.txt", IO_READ & IO_WRITE); Is there a programmatic reason for the way it actually is, or is it just historic? (i.e. "That's just the way it is.")

    Read the article

  • create a sparse BufferedImage in java

    - by elgcom
    I have to create an image with very large resolution, but the image is relatively "sparse", only some areas in the image need to draw. For example with following code /* this take 5GB memory */ final BufferedImage img = new BufferedImage( 36000, 36000, BufferedImage.TYPE_INT_ARGB); /* draw something */ Graphics g = img.getGraphics(); g.drawImage(....); /* output as PNG */ final File out = new File("out.png"); ImageIO.write(img, "png", out); The PNG image on the end I created is ONLY about 200~300 MB. The question is how can I avoid creating a 5GB BufferedImage at the beginning? I do need an image with large dimension, but with very sparse color information. Is there any Stream for BufferedImage so that it will not take so much memory?

    Read the article

  • Add HTML Id's to tags in .aspx file

    - by slandau
    So I'm writing an app that lets the user select a folder, it gets all the .aspx files in that folder, and lets the users check off which ones they want to add HTML ID's to. Then they click start, and this runs private void btnStart_Click(object sender, EventArgs e) { for (int i = 0; i < listFiles.CheckedItems.Count; i++) { } } It loops through all the selected file names. How do I open each of these .aspx files in the background, and go through them and add the id="thisItemId" attribute to each tag that's like a , , , , , etc....

    Read the article

  • fortran error I/O

    - by jpcgandre
    I get this error when compiling: forrtl: severe (256): unformatted I/O to unit open for formatted transfers, unit 27, file C:\Abaqus_JOBS\w.txt The error occurs in the beginning of the analysis. At the start, the file w.txt is created but is empty. The error may be related to the fact that I want to read from an empty file. My code is: OPEN(27, FILE = "C:/Abaqus_JOBS/w.txt", status = "UNKNOWN") READ(27, *, iostat=stat) w IF (stat .NE. 0) CALL del_file(27, stat) SUBROUTINE del_file(uFile, stat) IMPLICIT NONE INTEGER uFile, stat C If the unit is not open, stat will be non-zero CLOSE(unit=uFile, status='delete', iostat=stat) END SUBROUTINE Ref: Close multiple files If you agree with my opion about the cause of the error, is there a way to solve it? Thanks

    Read the article

  • Read whole ASCII file into C++ std::string

    - by Arrieta
    Hello, I need to read a whole file into memory and place it in a C++ std::string. If I were to read it into a char, the answer would be very simple: std::ifstream t; int lenght; t.open("file.txt", "r"); // open input file t.seekg(0, std::ios::end); // go to the end length = t.tellg(); // report location (this is the lenght) t.seekg(0, std::ios::beg); // go back to the beginning buffer = new char[length]; // allocate memory for a buffer of appropriate dimension t.read(buffer, length); // read the whole file into the buffer t.close(); // close file handle // ... do stuff with buffer here ... Now, I want to do the exact same thing, but using a std::string instead of a char. I want to avoid loops, i. e., I don't want to: std::ifstream t; t.open("file.txt", "r"); std::string buffer; std::string line; while(t){ std::getline(t, line); // ... append line to buffer and go on } t.close() any ideas?

    Read the article

  • How to delete duplicate/aggregate rows faster in a file using Java (no DB)

    - by S. Singh
    I have a 2GB big text file, it has 5 columns delimited by tab. A row will be called duplicate only if 4 out of 5 columns matches. Right now, I am doing dduping by first loading each coloumn in separate List , then iterating through lists, deleting the duplicate rows as it encountered and aggregating. The problem: it is taking more than 20 hours to process one file. I have 25 such files to process. Can anyone please share their experience, how they would go about doing such dduping? This dduping will be a throw away code. So, I was looking for some quick/dirty solution, to get job done as soon as possible. Here is my pseudo code (roughly) Iterate over the rows i=current_row_no. Iterate over the row no. i+1 to last_row if(col1 matches //find duplicate && col2 matches && col3 matches && col4 matches) { col5List.set(i,get col5); //aggregate } Duplicate example A and B will be duplicate A=(1,1,1,1,1), B=(1,1,1,1,2), C=(2,1,1,1,1) and output would be A=(1,1,1,1,1+2) C=(2,1,1,1,1) [notice that B has been kicked out]

    Read the article

  • implementing a Intelligent File Transfer Software in java over TCP/IP

    - by whyjava
    Hello I am working on a proposal where we have to implement a software which can move files between one source to destination.The overall goal of this project is to create intelligent file transfer.This software will have three components :- 1) Broker : Broker is the module that communicates with other brokers, monitors files, moves files, retrieves configurations from the Configuration Manager, supplies process information for the monitor, archives files, writes all process data to log files and escalates issues if necessary 2) Configuration Manager :Configuration Manager is a web-based application used to configure and deploy the configuration to all brokers. 3) Monitor : Monitor is a web-based application used to monitor each Broker in the environment. This project has to be built up in java and protocol for file transfer in tcp/ip. Client does not want to use FTP. File Transfer seems very easy, until there are several processes who are waiting to pick the file up automatically. Several problems arise: How can we guarantee the file is received at the destination? If a file isn’t received the first time, we should try it again (even after a restart or power breakdown) ? How does the receiver knows the file that is received is complete? How can we transfer multiple files synchronously? How can we protect the bandwidth, so file transfer isn’t blocking other processes? How does one interoperate between multiple OS platforms? What about authentication? How can we monitor het workflow? Auditing / logging Archiving Can you please provide answer to some of these? Thanks

    Read the article

  • Unable to open a file for writing

    - by asdasdas
    I am trying to write to a file. I do a file_exists check on it before I do fopen and it returns true (the file does exist). However, the file fails this code and gives me the error every time: $handle = fopen($filename, 'w'); if($handle) { flock($handle, LOCK_EX); fwrite($handle, $contents); } else { echo 'ERROR: Unable to open the file for writing.',PHP_EOL; exit(); } flock($handle, LOCK_UN); fclose($handle); Is there a way I can get more specific error details as to why this file does not let me open it for writing? I know that the filename is legit, but for some reason it just wont let me write to it. I do have write permissions, I was able to write and write over another file.

    Read the article

  • c++ File input/output

    - by Myx
    Hi: I am trying to read from a file using fgets and sscanf. In my file, I have characters on each line of the while which I wish to put into a vector. So far, I have the following: FILE *fp; fp = fopen(filename, "r"); if(!fp) { fprintf(stderr, "Unable to open file %s\n", filename); return 0; } // Read file int line_count = 0; char buffer[1024]; while(fgets(buffer, 1023, fp)) { // Increment line counter line_count++; char *bufferp = buffer; ... while(*bufferp != '\n') { char *tmp; if(sscanf(bufferp, "%c", tmp) != 1) { fprintf(stderr, "Syntax error reading axiom on " "line %d in file %s\n", line_count, filename); return 0; } axiom.push_back(tmp); printf("put %s in axiom vector\n", axiom[axiom.size()-1]); // increment buffer pointer bufferp++; } } my axiom vector is defined as vector<char *> axiom;. When I run my program, I get a seg fault. It happens when I do the sscanf. Any suggestions on what I'm doing wrong?

    Read the article

  • Do we need seperate file path for window and linux in java

    - by Kishor Sharma
    I have a file on linux ubuntu server hosted with path name /home/kishor/project/detail/. When I made a web app in window to upload and download file from specified location i used path "c:\kishor\projects\detail\" for saving in window. For my surprise when i used window file path name in my server i am still able to get files and upload them, i.e, "c:\kishor\projects\detail\". Can anyone explain why it is working (as window and linux both use different file path pattern).

    Read the article

  • Spring Integration 1.0 RC2: Streaming file content?

    - by gdm
    I've been trying to find information on this, but due to the immaturity of the Spring Integration framework I haven't had much luck. Here is my desired work flow: New files are placed in an 'Incoming' directory Files are picked up using a file:inbound-channel-adapter The file content is streamed, N lines at a time, to a 'Stage 1' channel, which parses the line into an intermediary (shared) representation. This parsed line is routed to multiple 'Stage 2' channels. Each 'Stage 2' channel does its own processing on the N available lines to convert them to a final representation. This channel must have a queue which ensures no Stage 2 channel is overwhelmed in the event that one channel processes significantly slower than the others. The final representation of the N lines is written to a file. There will be as many output files as there were routing destinations in step 4. *'N' above stands for any reasonable number of lines to read at a time, from [1, whatever I can fit into memory reasonably], but is guaranteed to always be less than the number of lines in the full file. How can I accomplish streaming (steps 3, 4, 5) in Spring Integration? It's fairly easy to do without streaming the files, but my files are large enough that I cannot read the entire file into memory. As a side note, I have a working implementation of this work flow without Spring Integration, but since we're using Spring Integration in other places in our project, I'd like to try it here to see how it performs and how the resulting code compares for length and clarity.

    Read the article

  • Extract some data from a lot of xml files

    - by LifeH2O
    I have cricket player profiles saved in the form of .xml files in a folder. each file has these tags in it <playerid>547</playerid> <majorteam>England</majorteam> <playername>Don</playername> the playerid is same as in .xml (each file is of different size,1kb to 5kb). These are about 500 files. What i need is to extract the playername, majorteam, and playerid from all these files to a list. I will convert that list to XML later. If you know how can i do it directly to XML i will be very thankful.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 117 118 119 120 121 122 123 124 125 126 127 128  | Next Page >