Search Results

Search found 34826 results on 1394 pages for 'valid html'.

Page 1214/1394 | < Previous Page | 1210 1211 1212 1213 1214 1215 1216 1217 1218 1219 1220 1221  | Next Page >

  • check if directory exists c#

    - by Ant
    I am trying to see if a directory exists based on an input field from the user. When the user types in the path, I want to check if the path actually exists. I have some c# code already. It returns 1 for any local path, but always returns 0 when I am checking a network path. static string checkValidPath(string path) { //Insert your code that runs under the security context of the authenticating user here. using (ImpersonateUser user = new ImpersonateUser(user, "", password)) { //DirectoryInfo d = new DirectoryInfo(quotelessPath); bool doesExist = Directory.Exists(path); //if (d.Exists) if(doesExist) { user.Dispose(); return "1"; } else { user.Dispose(); return "0"; } } } public class ImpersonateUser : IDisposable { [DllImport("advapi32.dll", SetLastError = true)] private static extern bool LogonUser(string lpszUsername, string lpszDomain, string lpszPassword, int dwLogonType, int dwLogonProvider, out IntPtr phToken); [DllImport("kernel32", SetLastError = true)] private static extern bool CloseHandle(IntPtr hObject); private IntPtr userHandle = IntPtr.Zero; private WindowsImpersonationContext impersonationContext; public ImpersonateUser(string user, string domain, string password) { if (!string.IsNullOrEmpty(user)) { // Call LogonUser to get a token for the user bool loggedOn = LogonUser(user, domain, password, 9 /*(int)LogonType.LOGON32_LOGON_NEW_CREDENTIALS*/, 3 /*(int)LogonProvider.LOGON32_PROVIDER_WINNT50*/, out userHandle); if (!loggedOn) throw new Win32Exception(Marshal.GetLastWin32Error()); // Begin impersonating the user impersonationContext = WindowsIdentity.Impersonate(userHandle); } } public void Dispose() { if (userHandle != IntPtr.Zero) CloseHandle(userHandle); if (impersonationContext != null) impersonationContext.Undo(); } } Any help is appreciated. Thanks! EDIT 3: updated code to use BrokenGlass's impersonation functions. However, I need to initialize "password" to something... EDIT 2: I updated the code to try and use impersonation as suggested below. It still fails everytime. I assume I am using impersonation improperly... EDIT: As requested by ChrisF, here is the function that calls the checkValidPath function. Frontend aspx file... $.get('processor.ashx', { a: '7', path: x }, function(o) { alert(o); if (o=="0") { $("#outputPathDivValid").dialog({ title: 'Output Path is not valid! Please enter a path that exists!', width: 500, modal: true, resizable: false, buttons: { 'Close': function() { $(this).dialog('close'); } } }); } }); Backend ashx file... public void ProcessRequest (HttpContext context) { context.Response.Cache.SetExpires(DateTime.Now); string sSid = context.Request["sid"]; switch (context.Request["a"]) {//a bunch of case statements here... case "7": context.Response.Write(checkValidPath(context.Request["path"].ToString())); break;

    Read the article

  • Copy all childNodes to an other element. In javascript native way.

    - by kroko
    Hello I have to change "unknown" contents of XML. The structure and content itself is valid. Original <blabla foo="bar"> <aa>asas</aa> <ff> <cc> <dd /> </cc> </ff> <gg attr2="2"> </gg> ... ... </blabla> becomes <blabla foo="bar"> <magic> <aa>asas</aa> <ff> <cc> <dd /> </cc> </ff> <gg attr2="2"> </gg> ... ... </magic> </blabla> thus, adding a child straight under document root node (document.documentElement) and "pushing" the "original" children under that. Here it has to be done in plain javascript (ecmascript). The idea now is to // Get the root node RootNode = mymagicdoc.documentElement; // Create new magic element (that will contain contents of original root node) var magicContainer = mymagicdoc.createElement("magic"); // Copy all root node children (and their sub tree - deep copy) to magic node /* ????? here RootNodeClone = RootNode.cloneNode(true); RootNodeClone.childNodes...... */ // Remove all children from root node while(RootNode.hasChildNodes()) RootNode.removeChild(RootNode.firstChild); // Now when root node is empty add the magicContainer // node in it that contains all the children of original root node RootNode.appendChild(magicContainer); How to do that /* */ step? Or maybe someone has a much better solution in general for achieving the desirable result? Thank you in advance!

    Read the article

  • Jquery $.post and PHP - Prevent the ability to use script outside of main website.

    - by Tim
    I have a PHP script setup using Jquery $.post which would return a response or do an action within the targeted .php file within $.post. Eg. My page has a form where you type in your Name. Once you hit the submit form button, $.post is called and sends the entered Name field value into "mywebsite.xyz/folder/ajaxscript.php" If a user was to visit "mywebsite.xyz/folder/ajaxscript.php" directly and somehow POST the data to the script, the script would return a response / do an action, based on the submitted POST data. The problem is, I don't want others to be able to periodically "call" an action or request a response from my website without using the website directly. Theoretically, right now you could determine what Name values my website allows without even visiting it, or you could call an action without going through the website, by simply visiting "mywebsite.xyz/folder/ajaxscript.php" So, what measures can I take to prevent this from happening? So far my idea is to ensure that it is a $_POST and not a $_GET - so they cannot manually enter it into the browser, but they could still post data to the script... Another measure is to apply a session key that expires, and is only valid for X amount of visits until they revisit the website. ~ Or, just have a daily "code" that changes and they'd need to grab this code from the website each day to keep their direct access to the script working (eg. I pass the daily "code" into each post request. I then check that code matches in the ajax php script.) However, even with these meaures, they will STILL have access to the scripts so long as they know how to POST the data, and also get the new code each day. Also, having a daily code requirement will cause issues when visiting the site at midnight (12:00am) as the code will change and the script will break for someone who is on the website trying to call the script, with the invalid code being passed still. I have attempted using .htaccess however using: order allow,deny deny from all Prevents legitimate access, and I'd have to add an exception so the website's IP is allowed to access it.. which is a hassle to update I think. Although, if it's the only legitimate solution I guess I'll have to. If I need to be more clear please let me know.

    Read the article

  • Android Bluetooth Fails to Pair

    - by CaseyB
    I am having a problem getting my devices to pair in Android. If I go into the settings and pair them manually I can get them to connect using the following code: Server // Make sure the device it discoverable mServerSocket = mAdapter.listenUsingRfcommWithServiceRecord("Moo Productions Bluetooth Server", mUUID); mState = State.ACCEPTING; BluetoothSocket socket = mServerSocket.accept(); mServerSocket.close(); connected(socket); Client Set<BluetoothDevice> pairedDevices = mAdapter.getBondedDevices(); BluetoothSocket socket = null; // Search the list of paired devices for the right one for(BluetoothDevice device : pairedDevices) { try { mState = State.SEARCHING; socket = device.createRfcommSocketToServiceRecord(mUUID); mState = State.CONNECTING; socket.connect(); connected(socket); break; } catch (IOException e) { socket = null; continue; } } But if the devices hadn't already been paired it gets out of the foreach without connecting to a valid socket. In that case I start discovering. // If that didn't work, discover if(socket == null) { mState = State.SEARCHING; mReceiver = new SocketReceiver(); mContext.registerReceiver(mReceiver, new IntentFilter(BluetoothDevice.ACTION_FOUND)); mAdapter.startDiscovery(); } // ... Later ... private class SocketReceiver extends BroadcastReceiver { @Override public void onReceive(Context context, Intent intent) { if(BluetoothDevice.ACTION_FOUND.equals(intent.getAction())) { try { // Get the device and try to open a socket BluetoothDevice device = intent.getParcelableExtra(BluetoothDevice.EXTRA_DEVICE); BluetoothSocket socket = device.createRfcommSocketToServiceRecord(mUUID); mState = State.CONNECTING; socket.connect(); // This is our boy, so stop looking mAdapter.cancelDiscovery(); mContext.unregisterReceiver(mReceiver); connected(socket); } catch (IOException ioe) { ioe.printStackTrace(); } } } } But it will never find the other device. I never get a pairing dialog and when I step through I see that it discovers the correct device, but it fails to connect with this exception java.io.IOException: Service discovery failed. Any ideas as to what I'm missing?

    Read the article

  • What is fastest way to convert bool to byte?

    - by Amir Rezaei
    What is fastest way to convert bool to byte? I want this mapping: False=0, True=1 Note: I don't want to use any if statement. Update: I don't want to use conditional statement. I don't want the CPU to halt or guess next statement. I want to optimize this code: private static string ByteArrayToHex(byte[] barray) { char[] c = new char[barray.Length * 2]; byte k; for (int i = 0; i < barray.Length; ++i) { k = ((byte)(barray[i] >> 4)); c[i * 2] = (char)(k > 9 ? k + 0x37 : k + 0x30); k = ((byte)(barray[i] & 0xF)); c[i * 2 + 1] = (char)(k > 9 ? k + 0x37 : k + 0x30); } return new string(c); } Update: The length of the array is very large, it's in terabyte order! Therefore I need to do optimization if possible. I shouldn't need to explain my self. The question is still valid. Update: I'm working on a project and looking at others code. That's why I didn't provide with the function at first place. I didn't want to spend time on explaining for people when they have opinion about the code. I shouldn’y need to provide in my question the background of my work, and a function that is not written by me. I have started to optimize it part by part. If I needed help with the whole function I would asked that in another question. That is why I asked this very simple at the beginning. Unfortunately people couldn’t keep themselves to the question. So please if you want to help answer the question. Update: For dose who want to see the point of this question. This example shows how two if statement are reduced from the code. byte A = k > 9 ; //If it was possible (k>9) == 0 || 1 c[i * 2] = A * (k + 0x30) - (A - 1) * (k + 0x30);

    Read the article

  • Losing session after Login - Java

    - by Patrick Villela
    I'm building an application that needs to login to a certain page and make a navigation. I can login, provided that the response contains a string that identifies it. But, when I navigate to the second page, I can't see the page as a logged user, only as anonymous. I'll provide my code. import java.net.*; import java.security.*; import java.security.cert.*; import javax.net.ssl.*; import java.io.*; import java.util.*; public class PostTest { static HttpsURLConnection conn = null; private static class DefaultTrustManager implements X509TrustManager { @Override public void checkClientTrusted(X509Certificate[] arg0, String arg1) throws CertificateException {} @Override public void checkServerTrusted(X509Certificate[] arg0, String arg1) throws CertificateException {} @Override public X509Certificate[] getAcceptedIssuers() { return null; } } public static void main(String[] args) { try { SSLContext ctx = SSLContext.getInstance("TLS"); ctx.init(new KeyManager[0], new TrustManager[] {new DefaultTrustManager()}, new SecureRandom()); SSLContext.setDefault(ctx); String data = URLEncoder.encode("txtUserName", "UTF-8") + "=" + URLEncoder.encode(/*username*/, "UTF-8"); data += "&" + URLEncoder.encode("txtPassword", "UTF-8") + "=" + URLEncoder.encode(/*password*/", "UTF-8"); data += "&" + URLEncoder.encode("envia", "UTF-8") + "=" + URLEncoder.encode("1", "UTF-8"); connectToSSL(/*login url*/); conn.setDoOutput(true); OutputStreamWriter wr = new OutputStreamWriter(conn.getOutputStream()); wr.write(data); wr.flush(); BufferedReader rd = new BufferedReader(new InputStreamReader(conn.getInputStream())); String line; String resposta = ""; while((line = rd.readLine()) != null) { resposta += line + "\n"; } System.out.println("valid login -> " + resposta.contains(/*string that assures me I'm looged in*/)); connectToSSL(/*first navigation page*/); rd = new BufferedReader(new InputStreamReader(conn.getInputStream())); while((line = rd.readLine()) != null) { System.out.println(line); } } catch(Exception e) { e.printStackTrace(); } } private static void connectToSSL(String address) { try { URL url = new URL(address); conn = (HttpsURLConnection) url.openConnection(); conn.setHostnameVerifier(new HostnameVerifier() { @Override public boolean verify(String arg0, SSLSession arg1) { return true; } }); } catch(Exception ex) { ex.printStackTrace(); } } } Any further information, just ask. Thanks in advance.

    Read the article

  • Design patterns and interview question

    - by user160758
    When I was learning to code, I read up on the design patterns like a good boy. Long after this, I started to actually understand them. Design discussions such as those on this site constantly try to make the rules more and more general, which is good. But there is a line, over which it becomes over-analysis starts to feed off itself and as such I think begins to obfuscate the original point - for example the "What's Alternative to Singleton" post and the links contained therein. http://stackoverflow.com/questions/1300655/whats-alternative-to-singleton I say this having been asked in both interviews I’ve had over the last 2 weeks what a singleton is and what criticisms I have of it. I have used it a few times for items such as user data (simple key-value eg. last file opened by this user) and logging (very common i'm sure). I've never ever used it just to have what is essentially global application data, as this is clearly stupid. In the first interview, I reply that I have no criticisms of it. He seemed disappointed by this but as the job wasn’t really for me, I forgot about it. In the next one, I was asked again and, as I wanted this job, I thought about it on the spot and made some objections, similar to those contained in the post linked to above (I suggested use of a factory or dependency injection instead). He seemed happy with this. But my problem is that I have used the singleton without ever using it in this kind of stupid way, which I had to describe on the spot. Using it for global data and the like isn’t something I did then realised was stupid, or read was stupid so didn’t do, it was just something I knew was stupid from the start. Essentially I’m supposed to be able to think of ways of how to misuse a pattern in the interview? Which class of programmers can best answer this question? The best ones? The medium ones? I'm not sure.... And these were both bright guys. I read more than enough to get better at my job but had never actually bothered to seek out criticisms of the most simple of the design patterns like this one. Do people think such questions are valid and that I ought to know the objections off by heart? Or that it is reasonable to be able to work out what other people who are missing the point would do on the fly? Or do you think I’m at least partially right that the question is too unsubtle and that the questions ought to be better thought out in order to make sure only good candidates can answer. PS. Please don’t think I’m saying that I’m just so clever that I know everything automatically - I’ve learnt the hard way like everyone else. But avoiding global data is hardly revolutionary.

    Read the article

  • Looking for an Open Source Project in need of help

    - by hvidgaard
    Hi StackOverflow! I'm a CS student on well on my way to graduate. I have had a difficult time of finding relevant student jobs (they seems to be taken merely hours after the notice gets on the board) , so instead I'm looking for an open source project in need of help. I'm aware that I should choose one that I use, but I'm not aware of any OS-project that I use that needs help. That's why I'm asking you. I don't have any deep experience, but I here are some of my biggest projects so far: BitTorrent-ish client in Python (a subset of BitTorrent) HTTP 1.1 webserver in Java Compiler from a subset of Java to run on JRE Flash-framework project to model an iPad look and feel (not to run actual iPad programs) complete with an API for programs. Complete MySQL database for a booking system, with departure and arrival times, so you could only book valid tickets (with a Java frontend). I know, Java and languages like AS3 and C# feels natural per se, Python, and have done a fair bit of hacking around in C, but I don't feel very comfortable with it. Mostly I'm afraid to make a fuckup because I have such a high degree of control. I would like to think I'm well aware of good software design practices, but in reality what I do is ask myself "would I like to use/maintain this?", and I love to refactor my code because I see optimizations. I love algorithms and to make them run in the best possible time. I don't have any preferred domain to work in, but I wouldn't mind it to be graphics or math heavy. Ideally I'm looking for a project in C++ to learn the in's and out's of it, but I'm well aware that I don't know that language very well. I would like to have a mentor-like figure until I'm confident enough to stand on my own, not one to review all my code (I'm sure someone will to start with anyway), but to ask questions about the project and language in question. I do have a wife and two children, so don't expect me to put in 10+ hours every week. In return I can work on my own, I strive to program modular and maintainable code. Know how to read an API, use Google, StackOverflow and online resources in general. If you have any questions, shoot. I'm looking forward to your suggestions.

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • How to get a physics engine like Nape working?

    - by Glacius
    Introduction: I think Nape is a relatively new engine so some of you may not know it. It's supposedly faster than box2d and I like that there is decent documentation. Here's the site: http://code.google.com/p/nape/ I'm relatively new to programming. I am decent at AS3's basic functionality, but every time I try to implement some kind of engine or framework I can't even seem to get it to work. With Nape I feel I got a little further than before but I still got stuck. My problem: I'm using Adobe CS5, I managed to import the SWC file like described here. Next I tried to copy the source of one of the demo's like this one and get it to work but I keep getting errors. I made a new class file, copied the demo source to it, and tried to add it to the stage. My stage code basically looks like this: import flash.Boot; // these 2 lines are as described in the tutorial new Boot(); var demo = new Main(); // these 2 are me guessing what I'm supposed to do addChild(demo); Well, it seems the source code is not even being recognized by flash as a valid class file. I tried editing it, but even if I get it recognized (give a package name and add curly brackets) but I still get a bunch of errors. Is it psuedo code or something? What is going on? My goal: I can imagine I'm going about this the wrong way. So let me explain what I'm trying to achieve. I basically want to learn how to use the engine by starting from a simple basic example that I can edit and mess around with. If I can't even get a working example then I'm unable to learn anything. Preferably I don't want to start using something like FlashDevelop (as I'd have to learn how to use the program) but if it can't be helped then I can give it a try. Thank you.

    Read the article

  • DB Design Pattern - Many to many classification / categorised tagging.

    - by Robin Day
    I have an existing database design that stores Job Vacancies. The "Vacancy" table has a number of fixed fields across all clients, such as "Title", "Description", "Salary range". There is an EAV design for "Custom" fields that the Clients can setup themselves, such as, "Manager Name", "Working Hours". The field names are stored in a "ClientText" table and the data stored in a "VacancyClientText" table with VacancyId, ClientTextId and Value. Lastly there is a many to many EAV design for custom tagging / categorising the vacancies with things such as Locations/Offices the vacancy is in, a list of skills required. This is stored as a "ClientCategory" table listing the types of tag, "Locations, Skills", a "ClientCategoryItem" table listing the valid values for each Category, e.g., "London,Paris,New York,Rome", "C#,VB,PHP,Python". Finally there is a "VacancyClientCategoryItem" table with VacancyId and ClientCategoryItemId for each of the selected items for the vacancy. There are no limits to the number of custom fields or custom categories that the client can add. I am now designing a new system that is very similar to the existing system, however, I have the ability to restrict the number of custom fields a Client can have and it's being built from scratch so I have no legacy issues to deal with. For the Custom Fields my solution is simple, I have 5 additional columns on the Vacancy Table called CustomField1-5. This removes one of the EAV designs. It is with the tagging / categorising design that I am struggling. If I limit a client to having 5 categories / types of tag. Should I create 5 tables listing the possible values "CustomCategoryItems1-5" and then an additional 5 many to many tables "VacancyCustomCategoryItem1-5" This would result in 10 tables performing the same storage as the three tables in the existing system. Also, should (heaven forbid) the requirements change in that I need 6 custom categories rather than 5 then this will result in a lot of code change. Therefore, can anyone suggest any DB Design Patterns that would be more suitable to storing such data. I'm happy to stick with the EAV approach, however, the existing system has come across all the usual performance issues and complex queries associated with such a design. Any advice / suggestions are much appreciated. The DBMS system used is SQL Server 2005, however, 2008 is an option if required for any particular pattern.

    Read the article

  • dynamic module creation

    - by intuited
    I'd like to dynamically create a module from a dictionary, and I'm wondering if adding an element to sys.modules is really the best way to do this. EG context = { a: 1, b: 2 } import types test_context_module = types.ModuleType('TestContext', 'Module created to provide a context for tests') test_context_module.__dict__.update(context) import sys sys.modules['TestContext'] = test_context_module My immediate goal in this regard is to be able to provide a context for timing test execution: import timeit timeit.Timer('a + b', 'from TestContext import *') It seems that there are other ways to do this, since the Timer constructor takes objects as well as strings. I'm still interested in learning how to do this though, since a) it has other potential applications; and b) I'm not sure exactly how to use objects with the Timer constructor; doing so may prove to be less appropriate than this approach in some circumstances. EDITS/REVELATIONS/PHOOEYS/EUREKAE: I've realized that the example code relating to running timing tests won't actually work, because import * only works at the module level, and the context in which that statement is executed is that of a function in the testit module. In other words, the globals dictionary used when executing that code is that of main, since that's where I was when I wrote the code in the interactive shell. So that rationale for figuring this out is a bit botched, but it's still a valid question. I've discovered that the code run in the first set of examples has the undesirable effect that the namespace in which the newly created module's code executes is that of the module in which it was declared, not its own module. This is like way weird, and could lead to all sorts of unexpected rattlesnakeic sketchiness. So I'm pretty sure that this is not how this sort of thing is meant to be done, if it is in fact something that the Guido doth shine upon. The similar-but-subtly-different case of dynamically loading a module from a file that is not in python's include path is quite easily accomplished using imp.load_source('NewModuleName', 'path/to/module/module_to_load.py'). This does load the module into sys.modules. However this doesn't really answer my question, because really, what if you're running python on an embedded platform with no filesystem? I'm battling a considerable case of information overload at the moment, so I could be mistaken, but there doesn't seem to be anything in the imp module that's capable of this. But the question, essentially, at this point is how to set the global (ie module) context for an object. Maybe I should ask that more specifically? And at a larger scope, how to get Python to do this while shoehorning objects into a given module?

    Read the article

  • Paypal IPN: how get the POSTs from this class?

    - by sineverba
    I'm using this Class <?php class paypalIPN { //sandbox: private $paypal_url = 'https://www.sandbox.paypal.com/cgi-bin/webscr'; //live site: //private $paypal_url = 'https://www.paypal.com/cgi-bin/webscr'; private $data = null; public function __construct() { $this->data = new stdClass; } public function isa_dispute() { //is it some sort of dispute. return $this->data->txn_type == "new_case"; } public function validate() { // parse the paypal URL $response = ""; $url_parsed = parse_url($this->paypal_url); // generate the post string from the _POST vars aswell as load the // _POST vars into an arry so we can play with them from the calling // script. $post_string = ''; foreach ($_POST as $field=>$value) { $this->data->$field = $value; $post_string .= $field.'='.urlencode(stripslashes($value)).'&'; } $post_string.="cmd=_notify-validate"; // append ipn command $ch = curl_init(); curl_setopt($ch, CURLOPT_URL, $this->paypal_url); //curl_setopt($ch, CURLOPT_VERBOSE, 1); //keep the peer and server verification on, recommended //(can switch off if getting errors, turn to false) curl_setopt($ch, CURLOPT_SSL_VERIFYPEER, FALSE); curl_setopt($ch, CURLOPT_SSL_VERIFYHOST, FALSE); curl_setopt($ch, CURLOPT_RETURNTRANSFER,1); curl_setopt($ch, CURLOPT_POST, 1); curl_setopt($ch, CURLOPT_POSTFIELDS, $post_string); $response = curl_exec($ch); if (curl_errno($ch)) { die("Curl Error: " . curl_errno($ch) . ": " . curl_error($ch)); } curl_close($ch); return $response; if (preg_match("/VERIFIED/", $response)) { // Valid IPN transaction. return $this->data; } else { return false; } } } ANd i recall in this mode: public function get_ipn() { $ipn = new paypalIPN(); $result = $ipn->validate(); $logger = new Log('/error.log'); $logger->write(print_r($result)); } But I obtain only "VERIFIED" or "1" (whitout or with the print_r function). I just tried also to return directly the raw curl response with return $response; or return $this->response; or also return $this->parse_string; but everytime I receive only "1" or "VERIFIED"....... Thank you very much

    Read the article

  • Extend argparse to write set names in the help text for optional argument choices and define those sets once at the end

    - by Kent
    Example of the problem If I have a list of valid option strings which is shared between several arguments, the list is written in multiple places in the help string. Making it harder to read: def main(): elements = ['a', 'b', 'c', 'd', 'e', 'f'] parser = argparse.ArgumentParser() parser.add_argument( '-i', nargs='*', choices=elements, default=elements, help='Space separated list of case sensitive element names.') parser.add_argument( '-e', nargs='*', choices=elements, default=[], help='Space separated list of case sensitive element names to ' 'exclude from processing') parser.parse_args() When running the above function with the command line argument --help it shows: usage: arguments.py [-h] [-i [{a,b,c,d,e,f} [{a,b,c,d,e,f} ...]]] [-e [{a,b,c,d,e,f} [{a,b,c,d,e,f} ...]]] optional arguments: -h, --help show this help message and exit -i [{a,b,c,d,e,f} [{a,b,c,d,e,f} ...]] Space separated list of case sensitive element names. -e [{a,b,c,d,e,f} [{a,b,c,d,e,f} ...]] Space separated list of case sensitive element names to exclude from processing What would be nice It would be nice if one could define an option list name, and in the help output write the option list name in multiple places and define it last of all. In theory it would work like this: def main_optionlist(): elements = ['a', 'b', 'c', 'd', 'e', 'f'] # Two instances of OptionList are equal if and only if they # have the same name (ALFA in this case) ol = OptionList('ALFA', elements) parser = argparse.ArgumentParser() parser.add_argument( '-i', nargs='*', choices=ol, default=ol, help='Space separated list of case sensitive element names.') parser.add_argument( '-e', nargs='*', choices=ol, default=[], help='Space separated list of case sensitive element names to ' 'exclude from processing') parser.parse_args() And when running the above function with the command line argument --help it would show something similar to: usage: arguments.py [-h] [-i [ALFA [ALFA ...]]] [-e [ALFA [ALFA ...]]] optional arguments: -h, --help show this help message and exit -i [ALFA [ALFA ...]] Space separated list of case sensitive element names. -e [ALFA [ALFA ...]] Space separated list of case sensitive element names to exclude from processing sets in optional arguments: ALFA {a,b,c,d,e,f} Question I need to: Replace the {'l', 'i', 's', 't', 's'} shown with the option name, in the optional arguments. At the end of the help text show a section explaining which elements each option name consists of. So I ask: Is this possible using argparse? Which classes would I have to inherit from and which methods would I need to override? I have tried looking at the source for argparse, but as this modification feels pretty advanced I don´t know how to get going.

    Read the article

  • Exception showing a erroneous web page in a WPF frame

    - by H4mm3rHead
    I have a small application where i need to navigate to an url, I use this method to get the Frame: public override System.Windows.UIElement GetPage(System.Windows.UIElement container) { XmlDocument doc = new XmlDocument(); doc.Load(Location); string webSiteUrl = doc.SelectSingleNode("website").InnerText; Frame newFrame = new Frame(); if (!webSiteUrl.StartsWith("http://")) { webSiteUrl = "http://" + webSiteUrl; } newFrame.Source = new Uri(webSiteUrl); return newFrame; } My problem is now that the page im trying to show generates a error (or so i think), when i load the page in a browser it never fully loads, keeps saying "loading1 element" in the load bar and the green progress line (IE 8) keeps showing. When i attach my debugger i get this error: System.ArgumentException was unhandled Message="Parameter and value pair is not valid. Expected form is parameter=value." Source="WindowsBase" StackTrace: at MS.Internal.ContentType.ParseParameterAndValue(String parameterAndValue) at MS.Internal.ContentType..ctor(String contentType) at MS.Internal.WpfWebRequestHelper.GetContentType(WebResponse response) at System.Windows.Navigation.NavigationService.GetObjectFromResponse(WebRequest request, WebResponse response, Uri destinationUri, Object navState) at System.Windows.Navigation.NavigationService.HandleWebResponse(IAsyncResult ar) at System.Windows.Navigation.NavigationService.<>c__DisplayClassc.<HandleWebResponseOnRightDispatcher>b__8(Object unused) at System.Windows.Threading.ExceptionWrapper.InternalRealCall(Delegate callback, Object args, Boolean isSingleParameter) at System.Windows.Threading.ExceptionWrapper.TryCatchWhen(Object source, Delegate callback, Object args, Boolean isSingleParameter, Delegate catchHandler) at System.Windows.Threading.DispatcherOperation.InvokeImpl() at System.Threading.ExecutionContext.runTryCode(Object userData) at System.Runtime.CompilerServices.RuntimeHelpers.ExecuteCodeWithGuaranteedCleanup(TryCode code, CleanupCode backoutCode, Object userData) at System.Threading.ExecutionContext.Run(ExecutionContext executionContext, ContextCallback callback, Object state) at System.Windows.Threading.DispatcherOperation.Invoke() at System.Windows.Threading.Dispatcher.ProcessQueue() at System.Windows.Threading.Dispatcher.WndProcHook(IntPtr hwnd, Int32 msg, IntPtr wParam, IntPtr lParam, Boolean& handled) at MS.Win32.HwndWrapper.WndProc(IntPtr hwnd, Int32 msg, IntPtr wParam, IntPtr lParam, Boolean& handled) at MS.Win32.HwndSubclass.DispatcherCallbackOperation(Object o) at System.Windows.Threading.ExceptionWrapper.InternalRealCall(Delegate callback, Object args, Boolean isSingleParameter) at System.Windows.Threading.ExceptionWrapper.TryCatchWhen(Object source, Delegate callback, Object args, Boolean isSingleParameter, Delegate catchHandler) ved System.Windows.Threading.Dispatcher.InvokeImpl(DispatcherPriority priority, TimeSpan timeout, Delegate method, Object args, Boolean isSingleParameter) at MS.Win32.HwndSubclass.SubclassWndProc(IntPtr hwnd, Int32 msg, IntPtr wParam, IntPtr lParam) at MS.Win32.UnsafeNativeMethods.DispatchMessage(MSG& msg) at System.Windows.Threading.Dispatcher.TranslateAndDispatchMessage(MSG& msg) at System.Windows.Threading.Dispatcher.PushFrameImpl(DispatcherFrame frame) at System.Windows.Application.RunInternal(Window window) at GreenWebPlayerWPF.App.Main() i C:\Development\Hvarregaard\GWDS\GreenWeb\GreenWebPlayerWPF\obj\Debug\App.g.cs:linje 0 at System.AppDomain._nExecuteAssembly(Assembly assembly, String[] args) at Microsoft.VisualStudio.HostingProcess.HostProc.RunUsersAssembly() at System.Threading.ExecutionContext.Run(ExecutionContext executionContext, ContextCallback callback, Object state) at System.Threading.ThreadHelper.ThreadStart() InnerException: Anyone? Or any way to capture it and respond to it, tried a try/catch around my code, but its not caught - seems something deep inside the guts of the CLR is failing.

    Read the article

  • disable dates using jquery inside gridview control

    - by bladerunner
    Hi there, I have a gridview which contains a textbox control. I need to show the calendar for the user to pick the date and certain dates are to be disabled using jquery. I found a post on stackoverflow that talked about how to disable certain dates. I am done with that part, except not sure how to pass the textbox control to this jquery function. Here is the code. <script type="text/javascript" language="javascript"> function pageLoad(sender, args) { var enabledDays = ['09/21/2011', '10/05/2011', '10/19/2011', '11/02/2011', '11/16/2011']; /* utility functions */ function editDays(date) { for (var i = 0; i < enabledDays.length; i++) { if (new Date(enabledDays[i]).toString() == date.toString()) { return [true]; } } return [false]; } /* create datepicker */ $(document).ready(function() { $('#<%= txtInHomeDate.ClientID %>').datepicker({ beforeShow: springDate, beforeShowDay: editDays, dateFormat: 'mm/dd/yy', buttonImage: 'images/cal.gif', buttonText: 'Choose date', firstDay: 1, buttonImageOnly: true, showOn: 'both', showAnim: 'fadeIn', onSelect: function() { $(this).trigger("onchange", null); } }); function springDate() { var defaultMin = new Date(); var defaultMax = new Date(); var Min = defaultMin; var Max = defaultMax; // make valid date from hiddenfied value format is MM/dd/yyyy dateMin = $('#<%= hfStDate.ClientID %>').val(); dateMin = new Date(dateMin); dateMax = $('#<%= hfEndDate.ClientID %>').val(); dateMax = new Date(dateMax); if (dateMin && dateMax) { Min = new Date(dateMin.getFullYear(), dateMin.getMonth(), dateMin.getDate()); Max = new Date(dateMax.getFullYear(), dateMax.getMonth(), dateMax.getDate()); } return { minDate: Min, maxDate: Max }; } }); } <.... <asp:TemplateField HeaderText="In-Home Date"> <ItemStyle HorizontalAlign="Center" /> <ItemTemplate> <asp:HiddenField ID="hfStDate" runat="server" Value="09/01/2011" /> <asp:HiddenField ID="hfEndDate" runat="server" Value="11/30/2011" /> <asp:TextBox ID="txtInHomeDate" runat="server" /> </ItemTemplate> </asp:TemplateField> Currently, it errors out since the jquery function won't find the txtInHomeDate. Could I get some help as I am pretty close to get this done? Thanks!!

    Read the article

  • git: setting a single tracking remote from a public repo.

    - by Gauthier
    I am confused with remote branches. My local repo: (local) ---A---B---C-master My remote repo (called int): (int) ---A---B---C---D---E-master What I want to do is to setup the local repo's master branch to follow that of int. Local repo: (local) ---A---B---C---D---E-master-remotes/int/master So that when int changes to: (int) ---A---B---C---D---E---F-master I can run git pull from the local repo's master and get (local) ---A---B---C---D---E---F-master-remotes/int/master Here's what I have tried: git fetch int gets me all the branches of int into remote branches. This can get messy since int might have hundreds of branches. git fetch int master gets me the commits, but no ref to it, only FETCH_HEAD. No remote branch either. git fetch int master:new_master works but I don't want a new name every time I update, and no remote branch is setup. git pull int master does what I want, but there is still no remote branch setup. I feel that it is ok to do so (that's the best I have now), but I read here and there that with the remote setup it is enough with git pull. git branch --track new_master int/master, as per http://www.gitready.com/beginner/2009/03/09/remote-tracking-branches.html . I get "not a valid object name: int/master". git remote -v does show me that int is defined and points at the correct location (1. worked). What I miss is the int/master branch, which is precisely what I want to get. git fetch in master:int/master. Well, int/master is created, but is no remote. So to summarize, I've tried some stuff with no luck. I would expect 2 to give me the remote branch to master in the repo int. The solution I use now is option 3. I read somewhere that you could change some config file by hand, but isn't that a bit cumbersome? The "cumbersome" way of editting the config file did work: [branch "master"] remote = int merge = master It can be done from command line: $ git config branch.master.remote int $ git config branch.master.merge master Any reason why option 2 above wouldn't do that automatically? Even in that case, git pull fetches all branches from the remote.

    Read the article

  • Help with IF THEN breaking when comparing results from MYSQL query.

    - by roydukkey
    I'm have a problem with an invite system. The if statement seems to break. It shows the message "Fail" but the UPDATE statement still executes. Why do both the THEN and the ELSE excute? $dbConn = new dbConn(); // Check if POST user_username and user_hash are matching and valid; both are hidden for fields $sql = "SELECT user_username " . "FROM table_users " . "WHERE user_id=".mysql_real_escape_string($_POST["user_id"])." " . "AND user_hash='".mysql_real_escape_string($_POST["user_hash"])."' " . "AND user_enabled=0;"; $objUser = $dbConn->query($sql); // If result contains 1 or more rows if( mysql_num_rows($objUser) != NULL ){ $objUser = mysql_fetch_assoc($objUser); $ssnUser->login( $objUser["user_username"] ); $sql = "UPDATE table_users SET " . "user_enabled=1, " . "user_first_name='".mysql_real_escape_string($_POST["user_first_name"])."', " . "user_last_name='".mysql_real_escape_string($_POST["user_last_name"])."', " . "user_password='".mysql_real_escape_string( md5($_POST["user_password"]) )."' " . "WHERE user_id=".mysql_real_escape_string($_POST["user_id"]).";"; $dbConn->query($sql); echo "Success"; header( "Refresh: 5; url=/account/?action=domains" ); } else { echo "Fail"; } This dbConn Class is as follows: class dbConn{ var $username = "xxxx_admin"; var $password = "xxxxxxxx"; var $server = "localhost"; var $database = "xxxx"; var $objConn; function __construct(){ $conn = mysql_connect( $this->server, $this->username, $this->password, true ); if( !$conn ){ die("Could not connect: ".mysql_error() ); } else { $this->objConn = $conn; } unset($conn); } function __destruct(){ mysql_close( $this->objConn ); unset( $this ); } function query( $query, $db = false ){ mysql_select_db( $db != false ? $db : $this->database, $this->objConn ); $result = mysql_query( $query ); unset($query,$db); return $result; } }

    Read the article

  • Invalid Cross-Thread Operations from BackgroundWorker2_RunWorkerCompleted in C#

    - by Jim Fell
    Hello. I'm getting an error that does not make sense. Cross-thread operation not valid: Control 'buttonOpenFile' accessed from a thread other than the thread it was created on. In my application, the UI thread fires off backgroundWorker1, which when almost complete fires off backgroundWorker2 and waits for it to complete. backgroundWorker1 waits for backgroundWorker2 to complete, before it completes. AutoResetEvent variables are used to flag when each of the workers complete. In backgroundWorker2_RunWorkerComplete a function is called that resets the form controls. It is in this ResetFormControls() function where the exception is thrown. I thought it was safe to modify form controls in the RunWorkerCompleted function. Both background workers are instantiated from the UI thread. Here is a greatly summarized version of what I am doing: AutoResetEvent evtProgrammingComplete_c = new AutoResetEvent(false); AutoResetEvent evtResetComplete_c = new AutoResetEvent(false); private void ResetFormControls() { toolStripProgressBar1.Enabled = false; toolStripProgressBar1.RightToLeftLayout = false; toolStripProgressBar1.Value = 0; buttonInit.Enabled = true; buttonOpenFile.Enabled = true; // Error occurs here. buttonProgram.Enabled = true; buttonAbort.Enabled = false; buttonReset.Enabled = true; checkBoxPeripheryModule.Enabled = true; checkBoxVerbose.Enabled = true; comboBoxComPort.Enabled = true; groupBoxToolSettings.Enabled = true; groupBoxNodeSettings.Enabled = true; } private void buttonProgram_Click(object sender, EventArgs e) { while (backgroundWorkerProgram.IsBusy) backgroundWorkerProgram.CancelAsync(); backgroundWorkerProgram.RunWorkerAsync(); } private void backgroundWorkerProgram_DoWork(object sender, DoWorkEventArgs e) { // Does a bunch of stuff... if (tProgramStat_c == eProgramStat_t.DONE) { tProgramStat_c = eProgramStat_t.RESETTING; while (backgroundWorkerReset.IsBusy) backgroundWorkerReset.CancelAsync(); backgroundWorkerReset.RunWorkerAsync(); evtResetComplete_c.WaitOne(LONG_ACK_WAIT * 2); if (tResetStat_c == eResetStat_t.COMPLETED) tProgramStat_c = eProgramStat_t.DONE; } } private void backgroundWorkerProgram_RunWorkerCompleted(object sender, RunWorkerCompletedEventArgs e) { // Updates form to report complete. No problems here. evtProgrammingComplete_c.Set(); backgroundWorkerProgram.Dispose(); } private void backgroundWorkerReset_DoWork(object sender, DoWorkEventArgs e) { // Does a bunch of stuff... if (tResetStat_c == eResetStat_t.COMPLETED) if (tProgramStat_c == eProgramStat_t.RESETTING) evtProgrammingComplete_c.WaitOne(); } private void backgroundWorkerReset_RunWorkerCompleted(object sender, RunWorkerCompletedEventArgs e) { CloseAllComms(); ResetFormControls(); evtResetComplete_c.Set(); backgroundWorkerReset.Dispose(); } Any thoughts or suggestions you may have would be appreciated. I am using Microsoft Visual C# 2008 Express Edition. Thanks.

    Read the article

  • Project Euler #18 - how to brute force all possible paths in tree-like structure using Python?

    - by euler user
    Am trying to learn Python the Atlantic way and am stuck on Project Euler #18. All of the stuff I can find on the web (and there's a LOT more googling that happened beyond that) is some variation on 'well you COULD brute force it, but here's a more elegant solution'... I get it, I totally do. There are really neat solutions out there, and I look forward to the day where the phrase 'acyclic graph' conjures up something more than a hazy, 1 megapixel resolution in my head. But I need to walk before I run here, see the state, and toy around with the brute force answer. So, question: how do I generate (enumerate?) all valid paths for the triangle in Project Euler #18 and store them in an appropriate python data structure? (A list of lists is my initial inclination?). I don't want the answer - I want to know how to brute force all the paths and store them into a data structure. Here's what I've got. I'm definitely looping over the data set wrong. The desired behavior would be to go 'depth first(?)' rather than just looping over each row ineffectually.. I read ch. 3 of Norvig's book but couldn't translate the psuedo-code. Tried reading over the AIMA python library for ch. 3 but it makes too many leaps. triangle = [ [75], [95, 64], [17, 47, 82], [18, 35, 87, 10], [20, 4, 82, 47, 65], [19, 1, 23, 75, 3, 34], [88, 2, 77, 73, 7, 63, 67], [99, 65, 4, 28, 6, 16, 70, 92], [41, 41, 26, 56, 83, 40, 80, 70, 33], [41, 48, 72, 33, 47, 32, 37, 16, 94, 29], [53, 71, 44, 65, 25, 43, 91, 52, 97, 51, 14], [70, 11, 33, 28, 77, 73, 17, 78, 39, 68, 17, 57], [91, 71, 52, 38, 17, 14, 91, 43, 58, 50, 27, 29, 48], [63, 66, 4, 68, 89, 53, 67, 30, 73, 16, 69, 87, 40, 31], [04, 62, 98, 27, 23, 9, 70, 98, 73, 93, 38, 53, 60, 4, 23], ] def expand_node(r, c): return [[r+1,c+0],[r+1,c+1]] all_paths = [] my_path = [] for i in xrange(0, len(triangle)): for j in xrange(0, len(triangle[i])): print 'row ', i, ' and col ', j, ' value is ', triangle[i][j] ??my_path = somehow chain these together??? if my_path not in all_paths all_paths.append(my_path) Answers that avoid external libraries (like itertools) preferred.

    Read the article

  • using a Singleton to pass credentials in a multi-tenant application a code smell?

    - by Hans Gruber
    Currently working on a multi-tenant application that employs Shared DB/Shared Schema approach. IOW, we enforce tenant data segregation by defining a TenantID column on all tables. By convention, all SQL reads/writes must include a Where TenantID = '?' clause. Not an ideal solution, but hindsight is 20/20. Anyway, since virtually every page/workflow in our app must display tenant specific data, I made the (poor) decision at the project's outset to employ a Singleton to encapsulate the current user credentials (i.e. TenantID and UserID). My thinking at the time was that I didn't want to add a TenantID parameter to each and every method signature in my Data layer. Here's what the basic pseudo-code looks like: public class UserIdentity { public UserIdentity(int tenantID, int userID) { TenantID = tenantID; UserID = userID; } public int TenantID { get; private set; } public int UserID { get; private set; } } public class AuthenticationModule : IHttpModule { public void Init(HttpApplication context) { context.AuthenticateRequest += new EventHandler(context_AuthenticateRequest); } private void context_AuthenticateRequest(object sender, EventArgs e) { var userIdentity = _authenticationService.AuthenticateUser(sender); if (userIdentity == null) { //authentication failed, so redirect to login page, etc } else { //put the userIdentity into the HttpContext object so that //its only valid for the lifetime of a single request HttpContext.Current.Items["UserIdentity"] = userIdentity; } } } public static class CurrentUser { public static UserIdentity Instance { get { return HttpContext.Current.Items["UserIdentity"]; } } } public class WidgetRepository: IWidgetRepository{ public IEnumerable<Widget> ListWidgets(){ var tenantId = CurrentUser.Instance.TenantID; //call sproc with tenantId parameter } } As you can see, there are several code smells here. This is a singleton, so it's already not unit test friendly. On top of that you have a very tight-coupling between CurrentUser and the HttpContext object. By extension, this also means that I have a reference to System.Web in my Data layer (shudder). I want to pay down some technical debt this sprint by getting rid of this singleton for the reasons mentioned above. I have a few thoughts on what an better implementation might be, but if anyone has any guidance or lessons learned they could share, I would be much obliged.

    Read the article

  • Remove never-run call to templated function, get allocation error on run-time

    - by Narfanator
    First off, I'm a bit at a loss as to how to ask this question. So I'm going to try throwing lots of information at the problem. Ok, so, I went to completely redesign my test project for my experimental core library thingy. I use a lot of template shenanigans in the library. When I removed the "user" code, the tests gave me a memory allocation error. After quite a bit of experimenting, I narrowed it down to this bit of code (out of a couple hundred lines): void VOODOO(components::switchBoard &board){ board.addComponent<using_allegro::keyInputs<'w'> >(); } Fundementally, what's weirding me out is that it appears that the act of compiling this function (and the template function it then uses, and the template functions those then use...), makes this bug not appear. This code is not being run. Similar code (the same, but for different key vals) occurs elsewhere, but is within Boost TDD code. I realize I certainly haven't given enough information for you to solve it for me; I tried, but it more-or-less spirals into most of the code base. I think I'm most looking for "here's what the problem could be", "here's where to look", etc. There's something that's happening during compile because of this line, but I don't know enough about that step to begin looking. Sooo, how can a (presumably) compilied, but never actually run, bit of templated code, when removed, cause another part of code to fail? Error: Unhandled exceptionat 0x6fe731ea (msvcr90d.dll) in Switchboard.exe: 0xC0000005: Access violation reading location 0xcdcdcdc1. Callstack: operator delete(void * pUser Data) allocator< class name related to key inputs callbacks ::deallocate vector< same class ::_Insert_n(...) vector< " " ::insert(...) vector<" "::push_back(...) It looks like maybe the vector isn't valid, because _MyFirst and similar data members are showing values of 0xcdcdcdcd in the debugger. But the vector is a member variable...

    Read the article

  • C++ segmentation error when first parameter is null in comparison operator overload

    - by user1774515
    I am writing a class called Word, that handles a c string and overloads the <, , <=, = operators. word.h: friend bool operator<(const Word &a, const Word &b); word.cc: bool operator<(const Word &a, const Word &b) { if(a == NULL && b == NULL) return false; if(a == NULL) return true; if(b == NULL) return false; return a.wd < b.wd; //wd is a valid c string } main: char* temp = NULL; //EDIT: i was mistaken, temp is a char pointer Word a("blah"); //a.wd = [b,l,a,h] cout << (temp<a); i get a segmentation error before the first line of the operator< method after the last line in the main. I can correct the problem by writing cout << (a>temp); where the operator> is similarly defined and i get no errors. but my assignment requires (temp < a) to work so this is where i ask for help. EDIT: i made a mistake the first time and i said temp was of type Word, but it is actually of type char*. so i assume that the compiler converts temp to a Word using one of my constructors. i dont know which one it would use and why this would work since the first parameter is not Word. here is the constructor i think is being used to make the Word using temp: Word::Word(char* c, char* delimeters=NULL) { char *temporary = "\0"; if(c == NULL) c = temporary; check(stoppers!=NULL, "(Word(char*,char*))NULL pointer"); //exits the program if the expression is false if(strlen(c) == 0) size = DEFAULT_SIZE; //10 else size = strlen(c) + 1 + DEFAULT_SIZE; wd = new char[size]; check(wd!=NULL, "Word(char*,char*))heap overflow"); delimiters = new char[strlen(stoppers) + 1]; //EDIT: changed to [] check(delimiters!=NULL,"Word(char*,char*))heap overflow"); strcpy(wd,c); strcpy(delimiters,stoppers); count = strlen(wd); } wd is of type char* thanks for looking at this big question and trying to help. let me know if you need more code to look at

    Read the article

  • IPhone Development Profile Expired

    - by theiphoneguy
    I really combed this site and others. I read and re-read the related links here and the Apple docs. I'm sorry, but either I am obviously missing something right under my nose, or this Apple profile/certificate stuff is a bit convoluted. Here it is: I have a product in the App Store. I have updated it several times and users like it. My development profile recently expired just when I was improving the app for its next release. I can run the app in the simulator. I can compile and put the distribution build on my iPhone just fine. I went to the Apple portal and renewed the development profile. I downloaded it and installed it in Xcode. I see it in the Organize window. I see it on my iPhone. I CANNOT put the debug build on my iPhone to debug or run with Instruments. The message is that either there is not a valid signed profile or it is untrusted. I subsequently tried to download and install the certificate to my Mac's keychain. Still no success. I checked the code signing section of Project settings and also for the target and the root. All appears to indicate that it is using the expected development profile for debug. Yes, I had deleted the old profile from my iPhone, from the Organizer. I cleaned the Xcode cache and all targets. I have done all of this several times and in varying sequences to try to cover every possibility. I am ready to do anything to be able to debug with Instruments in order to check for leaks or high memory usage. Even though the distribution compile runs fine on my iPhone and plays well with other running processes, I will not release anything without a leaks/memory test. Any ideas will be appreciated. If I missed something obvious, please forgive me - it was not due to just posting a question without searching for similar postings. Thanks!

    Read the article

  • Unable to decode hex values in javascript tooltip

    - by staudk27
    Hi all, I have quite the process that we go through in order to display some e-mail communications in our application. Trying to keep it as general as possible... -We make a request to a service via XML -Get the XML reply string, send the string to a method to encode any invalid characters as follows: public static String convertUTF8(String value) { char[] chars = value.toCharArray(); StringBuffer retVal = new StringBuffer(chars.length); for (int i = 0; i < chars.length; i++) { char c = chars[i]; int chVal = (int)c; if (chVal > Byte.MAX_VALUE) { retVal.append("&#x").append(Integer.toHexString(chVal)).append(";"); } else { retVal.append(c); } } return retVal.toString(); } We then send that result of a string to another method to remove any other invalid characters: public static String removeInvalidCharacters(String inString) { if (inString == null){ return null; } StringBuffer newString = new StringBuffer(); char ch; char c[] = inString.toCharArray(); for (int i = 0; i < c.length; i++) { ch = c[i]; // remove any characters outside the valid UTF-8 range as well as all control characters // except tabs and new lines if ((ch < 0x00FD && ch > 0x001F) || ch == '\t' || ch == '\n' || ch == '\r') { newString.append(ch); } } return newString.toString(); } This string is then "unmarshal'ed" via the SaxParser The object is then sent back to our Display action which generated the response to the calling jsp/javascript to create the page. The issue is some text can contain characters which can't be processed correctly. The following is eventually rendered on the JSP just fine: <PrvwCommTxt>This is a new test. Have a*&amp;#xc7;&amp;#xb4;)&amp;#xa1;.&amp;#xf1;&amp;#xc7;&amp;#xa1;.&amp;#xf1;*&amp;#xc7;&amp;#xb4;)...</PrvwCommTxt> Which shows up as "This is a new test. Have a*Ç´)¡.ñÇ¡." in the browser. -The following shows up in a tooltip while hovering over the above text: <CommDetails>This is a new test. Have a*Ç´)¡.ñÇ¡.ñ*Ç´)¡.ñ*´)(¡.ñÇ(¡.ñÇ* Wonderful Day!</CommDetails> This then shows up incorrectly when rendered in the tooltip javascript with all the HEX values and not being rendered correctly. Any suggestions on how to make the unknown characters show correctly in javascript?

    Read the article

< Previous Page | 1210 1211 1212 1213 1214 1215 1216 1217 1218 1219 1220 1221  | Next Page >