Search Results

Search found 22839 results on 914 pages for 'decimal point'.

Page 123/914 | < Previous Page | 119 120 121 122 123 124 125 126 127 128 129 130  | Next Page >

  • Systems design question: DB connection management in load-balanced n-tier

    - by aoven
    I'm wondering about the best approach to designing a DB connection manager for a load-balanced n-tier system. Classic n-tier looks like this: Client -> BusinessServer -> DBServer A load-balancing solution as I see it would then look like this: +--> ... +--+ +--> BusinessServer +--+--> SessionServer --+ Client -> Gateway --+--> BusinessServer +--| +--> DBServer +--> BusinessServer +--+--------------------+ +--> ... +--+ As pictured, the business server component is being load-balanced via multiple instances, and a hardware gateway is distributing the load among them. Session server probably needs to be situated outside the load-balancing array, because it manages state, which mustn't be duplicated. Barring any major errors in design so far, what is the best way to implement DB connection management? I've come up with a couple of options, but there may be others I'm not aware of: Introduce a new Broker component between the DBServer and the other components and let it handle the DB connections. The upside is that all the connections can be managed from a single point, which is very convenient. The downside is that now there is an additional "single point of failure" in the system. Other components must go through it for every request that involves DB in some way, which also makes this a bottleneck. Move the DB connection management into BusinessServer and SessionServer components and let each handle its own DB connections. The upside is that there is no additional "single point of failure" or bottleneck components. The downside is that there is also no control over possible conflicts and deadlocks apart from what DBServer itself can provide. What else can be done? FWIW: Technology is .NET, but none of the vendor-specific stacks are used (e.g. no WCF, MSMQ or the like).

    Read the article

  • Float addition promoted to double?

    - by Andreas Brinck
    I had a small WTF moment this morning. Ths WTF can be summarized with this: float x = 0.2f; float y = 0.1f; float z = x + y; assert(z == x + y); //This assert is triggered! (Atleast with visual studio 2008) The reason seems to be that the expression x + y is promoted to double and compared with the truncated version in z. (If i change z to double the assert isn't triggered). I can see that for precision reasons it would make sense to perform all floating point arithmetics in double precision before converting the result to single precision. I found the following paragraph in the standard (which I guess I sort of already knew, but not in this context): 4.6.1. "An rvalue of type float can be converted to an rvalue of type double. The value is unchanged" My question is, is x + y guaranteed to be promoted to double or is at the compiler's discretion? UPDATE: Since many people has claimed that one shouldn't use == for floating point, I just wanted to state that in the specific case I'm working with, an exact comparison is justified. Floating point comparision is tricky, here's an interesting link on the subject which I think hasn't been mentioned.

    Read the article

  • Auto-implemented getters and setters vs. public fields

    - by tclem
    I see a lot of example code for C# classes that does this: public class Point { public int x { get; set; } public int y { get; set; } } Or, in older code, the same with an explicit private backing value and without the new auto-implemented properties: public class Point { private int _x; private int _y; public int x { get { return _x; } set { _x = value; } } public int y { get { return _y; } set { _y = value; } } } My question is why. Is there any functional difference between doing the above and just making these members public fields, like below? public class Point { public int x; public int y; } To be clear, I understand the value of getters and setters when you need to do some translation of the underlying data. But in cases where you're just passing the values through, it seems needlessly verbose.

    Read the article

  • Values of generated column not appearing in table

    - by msh210
    I'm using mysql version 5.1.41-3ubuntu12.10 (Ubuntu). mysql> show create table tt\G *************************** 1. row *************************** Table: tt Create Table: CREATE TABLE `tt` ( `pz` int(8) DEFAULT NULL, `os` varchar(8) DEFAULT NULL, `uz` int(11) NOT NULL, `p` bigint(21) NOT NULL DEFAULT '0', `c` decimal(23,0) DEFAULT NULL, KEY `pz` (`pz`), KEY `uz` (`uz`), KEY `os` (`os`), KEY `pz_2` (`pz`,`uz`) ) ENGINE=MyISAM DEFAULT CHARSET=latin1 1 row in set (0.00 sec) mysql> select pz,uz,pz*uz, -> if(pz*uz,1,.5), -> left(pz,2) pl,left(lpad(uz,5,0),2) ul, -> p from tt limit 10; +-------+----+-------+----------------+--------+----+--------+ | pz | uz | pz*uz | if(pz*uz,1,.5) | pl | ul | p | +-------+----+-------+----------------+--------+----+--------+ | NULL | 0 | NULL | 0.5 | NULL | 00 | 4080 | | NULL | 0 | NULL | 0.5 | NULL | 00 | 323754 | | 89101 | 0 | 0 | 0.5 | 89 | 00 | 6880 | | 0 | 0 | 0 | 0.5 | 0 | 00 | 11591 | | 89110 | 0 | 0 | 0.5 | 89 | 00 | 72 | | 78247 | 0 | 0 | 0.5 | 78 | 00 | 27 | | 90062 | 0 | 0 | 0.5 | 90 | 00 | 5 | | 63107 | 0 | 0 | 0.5 | 63 | 00 | 4 | | NULL | 0 | NULL | 0.5 | NULL | 00 | 54561 | | 94102 | 0 | 0 | 0.5 | 94 | 00 | 12499 | +-------+----+-------+----------------+--------+----+--------+ So far so good. As you see, 0.5 appears as a value of if(pz*uz,1,.5). The problem is: mysql> select os, -> if(pz*uz,left(pz,2)<=>left(lpad(uz,5,0),2),.5) uptwo, -> if(pz*uz,left(pz,3)<=>left(lpad(uz,5,0),3),.5) upthree, -> sum(p) p,sum(c) c -> from tt t -> group by os,uptwo,upthree order by null; +----+-------+---------+---------+-------+ | os | uptwo | upthree | p | c | +----+-------+---------+---------+-------+ | u | 1 | 1 | 52852 | 318 | | i | 1 | 1 | 7046563 | 21716 | | m | 1 | 1 | 1252166 | 7337 | | i | 0 | 0 | 1830284 | 4033 | | m | 0 | 0 | 294612 | 1714 | | i | 1 | 0 | 911486 | 3560 | | m | 1 | 0 | 145182 | 1136 | | u | 0 | 0 | 12144 | 23 | | u | 1 | 0 | 1571 | 8 | +----+-------+---------+---------+-------+ Although I group by uptwo, 0.5 doesn't appear in that column. What happened to the 0.5 values? Edit: As noted in the comments to Todd Gibson's answer, I also tried it with if(pz*uz,cast(left(pz,2)<=>left(lpad(uz,5,0),2) as decimal),.5) instead of if(pz*uz,left(pz,2)<=>left(lpad(uz,5,0),2),.5), but it, too, didn't work.

    Read the article

  • Google Maps API v3 not working

    - by user1496322
    I've been banging my head on the wall after going through the documentation on this several times! I can't seem to get past the API error to get the map to appear on my site. I am getting the following error message from the web page where I want the map to be displayed: ~~~~~~~~~~~ Google has disabled use of the Maps API for this application. The provided key is not a valid Google API Key, or it is not authorized for the Google Maps Javascript API v3 on this site. If you are the owner of this application, you can learn about obtaining a valid key here: https://developers.google.com/maps/documentation/javascript/tutorial#Obtaining_Key ~~~~~~~~~~~ I have (several times now) gone into my account and 1) enabled the Maps v3 API service. 2) Generated a new API key. and 3) added my allowed referrers to the key. (both www.domain.com and domain.com URLs) I have the following added to the head of the web page: < script src="http://maps.googleapis.com/maps/api/js?sensor=false&key=MY_API_KEY_HERE" type="text/JavaScript" language="JavaScript" And... I have the following javascript function that executes when a link is clicked on the page: alert("viewMap()"); var map = new GMap3(document.getElementById("map_canvas")); var geocoder = new GClientGeocoder(); var address = "1600 Amphitheatre Parkway, Mountain View"; alert("Calling getLatLng ..."); geocoder.getLatLng(address, function(point) { var latitude = point.y; var longitude = point.x; // do something with the lat lng alert("Lat:"+latitude+" - Lng:"+longitude); }); The initial 'viewMap' alert is displayed and then is followed by the 'Google has disbled use...' error message. The error console is also showing 'GMap3 is not defined'. Can anyone please assist with showing me the errors of my ways?!?!? Thank you in advance for any help you can provide. -Dennis

    Read the article

  • Cannot call DLL import entry in C# from C++ project. EntryPointNotFoundException

    - by kriau
    I'm trying to call from C# a function in a custom DLL written in C++. However I'm getting the warning during code analysis and the error at runtime: Warning: CA1400 : Microsoft.Interoperability : Correct the declaration of 'SafeNativeMethods.SetHook()' so that it correctly points to an existing entry point in 'wi.dll'. The unmanaged entry point name currently linked to is SetHook. Error: System.EntryPointNotFoundException was unhandled. Unable to find an entry point named 'SetHook' in DLL 'wi.dll'. Both projects wi.dll and C# exe has been compiled in to the same DEBUG folder, both files reside here. There is only one file with the name wi.dll in the whole file system. C++ function definition looks like: #define WI_API __declspec(dllexport) bool WI_API SetHook(); I can see exported function using Dependency Walker: as decorated: bool SetHook(void) as undecorated: ?SetHook@@YA_NXZ C# DLL import looks like (I've defined these lines using CLRInsideOut from MSDN magazine): [DllImport("wi.dll", EntryPoint = "SetHook", CallingConvention = CallingConvention.Cdecl)] [return: MarshalAsAttribute(UnmanagedType.I1)] internal static extern bool SetHook(); I've tried without EntryPoint and CallingConvention definitions as well. Both projects are 32-bits, I'm using W7 64 bits, VS 2010 RC. I believe that I simply have overlooked something.... Thanks in advance.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Shell loops using non-integers?

    - by mary
    I wrote a .sh file to compile and run a few programs for a homework assignment. I have a "for" loop in the script, but it won't work unless I use only integers: #!/bin/bash for (( i=10; i<=100000; i+=100)) do ./hw3_2_2 $i done The variable $i is an input for the program hw3_2_2, and I have non-integer values I'd like to use. How could I loop through running the code with a list of decimal numbers?

    Read the article

  • Can't get Sum() working in Northwind example

    - by Vince
    Hi, The following code is generating a runtime error and I have no idea why. from o in Orders group o by o.Employee into employeeOrders select new { employeeOrders.Key.EmployeeID, employeeOrders.Key.FirstName, Orders = from eord in employeeOrders orderby eord.OrderID select new { eord.OrderID, eord.OrderDate, OrderTotal=eord.OrderDetails.Sum (od => od.UnitPrice) } } The error is Member access 'System.Decimal UnitPrice' of 'LINQPad.User.OrderDetails' not legal on type 'LINQPad.User.Orders I've also tried this in VS2010 with a standard drag and drop data context and same thing. Thanks in advance

    Read the article

  • Why doesn't this data binding work?

    - by Qwertie
    I have a ViewModel class that contains a list of points, and I am trying to bind it to a Polyline. The Polyline picks up the initial list of points, but does not notice when additional points are added even though I implement INotifyPropertyChanged. What's wrong? <StackPanel> <Button Click="Button_Click">Add!</Button> <Polyline x:Name="_line" Points="{Binding Pts}" Stroke="Black" StrokeThickness="5"/> </StackPanel> C# side: // code-behind _line.DataContext = new ViewModel(); private void Button_Click(object sender, RoutedEventArgs e) { // The problem is here: NOTHING HAPPENS ON-SCREEN! ((ViewModel)_line.DataContext).AddPoint(); } // ViewModel class public class ViewModel : INotifyPropertyChanged { public event PropertyChangedEventHandler PropertyChanged; public PointCollection Pts { get; set; } public ViewModel() { Pts = new PointCollection(); Pts.Add(new Point(1, 1)); Pts.Add(new Point(11, 11)); } public void AddPoint() { Pts.Add(new Point(25, 13)); if (PropertyChanged != null) PropertyChanged(this, new PropertyChangedEventArgs("Pts")); } }

    Read the article

  • how to add text in a created table in a richtextbox?

    - by francops henri
    I created a table in richtextbox like this : //Since too much string appending go for string builder StringBuilder tableRtf = new StringBuilder(); //beginning of rich text format,dont customize this begining line tableRtf.Append(@"{\rtf1 "); //create 5 rows with 3 cells each for (int i = 0; i < 5; i++) { tableRtf.Append(@"\trowd"); //A cell with width 1000. tableRtf.Append(@"\cellx1000"); //Another cell with width 2000.end point is 3000 (which is 1000+2000). tableRtf.Append(@"\cellx2000"); //Another cell with width 1000.end point is 4000 (which is 3000+1000) tableRtf.Append(@"\cellx3000"); //Another cell with width 1000.end point is 4000 (which is 3000+1000) tableRtf.Append(@"\cellx4000"); tableRtf.Append(@"\intbl \cell \row"); //create row } tableRtf.Append(@"\pard"); tableRtf.Append(@"}"); this.misc_tb.Rtf = tableRtf.ToString(); Now I want to know how I can put text in headers and in each cells. Do you have an idea? Thanks

    Read the article

  • Castle Dynamic Proxy is it possible to intercept value types?

    - by JS Future Software
    Hi, I have a problem and can not find answer and any tip if it is possible to intercept value types in C# by Castle dynamic proxy? I want to intercept IDictionary with INotifyChanged interface. I need this to update view when presenter is changing model. Boxing decimal in object only for making interface is not good idea... maybe somebody have idea how to intrcept value types? Thanks to all answers

    Read the article

  • When is ¦ not equal to ¦?

    - by Trey Jackson
    Background. I'm working with netlists, and in general, people specify different hierarchies by using /. However, it's not illegal to actually use a / as a part of an instance name. For example, X1/X2/X3/X4 might refer to instance X4 inside another instance named X1/X2/X3. Or it might refer an instance named X3/X4 inside an instance named X2 inside an instance named X1. Got it? There's really no "regular" character that cannot be used as a part of an instance name, so you resort to a non-printable one, or ... perhaps one outside of the standard 0..127 ASCII chars. I thought I'd try (decimal) 166, because for me it shows up as the pipe: ¦. So... I've got some C++ code which constructs the path name using ¦ as the hierarchical separator, so the path above looks like X1¦X2/X3¦X4. Now the GUI is written in Tcl/Tk, and to properly translate this into human readable terms I need to do something like the following: set path [getPathFromC++] ;# returns X1¦X2/X3¦X4 set humanreadable [join [split $path ¦] /] Basically, replace the ¦ with / (I could also accomplish this with [string map]). Now, the problem is, the ¦ in the string I get from C++ doesn't match the ¦ I can create in Tcl. i.e. This fails: set path [getPathFromC++] ;# returns X1¦X2/X3¦X4 string match $path [format X1%cX2/X3%cX4 166 166] Visually, the two strings look identical, but string match fails. I even tried using scan to see if I'd mixed up the bit values. But set path [getPathFromC++] ;# returns X1¦X2/X3¦X4 set path2 [format X1%cX2/X3%cX4 166 166] for {set i 0} {$i < [string length $path]} {incr i} { set p [string range $path $i $i] set p2 [string range $path2 $i $i] scan %c $p c scan %c $p2 c2 puts [list $p $c :::: $p2 $c2 equal? [string equal $c $c2]] } Produces output which looks like everything should match, except the [string equal] fails for the ¦ characters with a print line: ¦ 166 :::: ¦ 166 equal? 0 For what it's worth, the character in C++ is defined as: const char SEPARATOR = 166; Any ideas why a character outside the regular ASCII range would fail like this? When I changed the separator to (decimal) 28 (^\), things worked fine. I just don't want to get bit by a similar problem on a different platform. (I'm currently using Redhat Linux).

    Read the article

  • Is anyone familiar with SDPT.clsSDPT?

    - by David Stratton
    Normally I wouldn't ask this kind of question here, but I'm desperate at this point. I'm attempting to support a classic ASP app written by a predecessor who is no longer available. Keeping it short, several applications use a dll to perform encryption of sensitive data. This dll is named SDPT.dll, and the line of code used to create an object is set objSDPT = server.CreateObject("SDPT.clsSDPT") At this point, I am getting errors in a critical app on one of my servers, and I've actually hit a dead end. The error is a standard "Server.CreateObject Failed" message, which I know how to troubleshoot in most cases. However, in this case, all of my normal tries, plus several hours of Google searches are coming up with nothing that works. At this point, I'm not so much looking for help in troubleshooting the issue as I am in finding any sort of reference on this third party component. Even finding that is proving to be difficult, so I'm resorting to asking any of the seasoned developers that hang out here if they are familiar with this product, who it was developed by, and if any documentation on it exists anywhere.

    Read the article

  • dynamical binding or switch/case?

    - by kingkai
    A scene like this: I've different of objects do the similar operation as respective func() implements. There're 2 kinds of solution for func_manager() to call func() according to different objects Solution 1: Use virtual function character specified in c++. func_manager works differently accroding to different object point pass in. class Object{ virtual void func() = 0; } class Object_A : public Object{ void func() {}; } class Object_B : public Object{ void func() {}; } void func_manager(Object* a) { a->func(); } Solution 2: Use plain switch/case. func_manager works differently accroding to different type pass in typedef _type_t { TYPE_A, TYPE_B }type_t; void func_by_a() { // do as func() in Object_A } void func_by_b() { // do as func() in Object_A } void func_manager(type_t type) { switch(type){ case TYPE_A: func_by_a(); break; case TYPE_B: func_by_b(); default: break; } } My Question are 2: 1. at the view point of DESIGN PATTERN, which one is better? 2. at the view point of RUNTIME EFFCIENCE, which one is better? Especailly as the kinds of Object increases, may be up to 10-15 total, which one's overhead oversteps the other? I don't know how switch/case implements innerly, just a bunch of if/else? Thanks very much!

    Read the article

  • MSSQL 2005 FOR XML

    - by Lima
    Hi, I am wanting to export data from a table to a specifically formated XML file. I am fairly new to XML files, so what I am after may be quite obvious but I just cant find what I am looking for on the net. The format of the XML results I need are: <data> <event start="May 28 2006 09:00:00 GMT" end="Jun 15 2006 09:00:00 GMT" isDuration="true" title="Writing Timeline documentation" image="http://simile.mit.edu/images/csail-logo.gif"> A few days to write some documentation </event> </data> My table structure is: name VARCHAR(50), description VARCHAR(255), startDate DATETIME, endDate DATETIME (I am not too interested in the XML fields image or isDuration at this point in time). I have tried: SELECT [name] ,[description] ,[startDate] ,[endTime] FROM [testing].[dbo].[time_timeline] FOR XML RAW('event'), ROOT('data'), type Which gives me: <data> <event name="Test1" description="Test 1 Description...." startDate="1900-01-01T00:00:00" endTime="1900-01-01T00:00:00" /> <event name="Test2" description="Test 2 Description...." startDate="1900-01-01T00:00:00" endTime="1900-01-01T00:00:00" /> </data> What I am missing, is the description needs to be outside of the event attributes, and there needs to be a tag. Is anyone able to point me in the correct direction, or point me to a tutorial or similar on how to accomplish this? Thanks, Matt

    Read the article

  • Formatting numbers with significant figures in C#

    - by Chris Farmer
    I have some decimal data that I am pushing into a SharePoint list where it is to be viewed. I'd like to restrict the number of significant figures displayed in the result data based on my knowledge of the specific calculation. Sometimes it'll be 3, so 12345 will become 12300 and 0.012345 will become 0.0123. Occasionally it will be 4 or 5. Is there any convenient way to handle this?

    Read the article

  • Turn image in google maps V3?

    - by Ilrodri
    Hi, I need help with JavaScript in google map v3 I have an image and I need to be able to turn it. That works, but the real problem it's that I cant afect an marker cause I don't know how to call it and modify this marker. I show you a part of the code: Marker: sURL = 'http://www.sl2o.com/tc/picture/Fleche.PNG'; iWidth = 97; iHeight = 100; mImage = new google.maps.MarkerImage(sURL, new google.maps.Size(iWidth,iHeight), new google.maps.Point(0,0), new google.maps.Point(Math.round(iWidth/2),Math.round(iHeight/2))); var oMarker = new google.maps.Marker({ 'position': new google.maps.LatLng(iStartLat,iStartLon), 'map': map, 'title': 'mon point', 'icon': mImage }); Then I have this : onload=function(){ rotate.call(document.getElementById('im'),50); } </script> <img id="im" src="http://www.sl2o.com/tc/picture/Fleche.PNG" width="97" height="100" /> So here is it. As you can see, I'm afecting this image and I in fact I need to afect the marker. How can I do it ? Please I need this I'been working in it since hours and hours. Thank you !!

    Read the article

  • Ruby on Rails: How do you add add zeros in front of a number if it's under 10?

    - by sjsc
    I'm looking to convert single digit numbers to two-digit numbers like so: 9 ==> 09 5 ==> 05 12 == 12 4 ==> 04 I figure I could put a bunch of if-else statements (if number is under 10, then do a gsub) but figure that's horrible coding. I know Rails has number_with_precision but I see that it only applies to decimal numbers. Any ideas on how to convert single-digits to two-digits?

    Read the article

  • Filter list as a parameter in a compiled query

    - by JK
    I have the following compiled query that I want to return a list of "groups" that don't have a "GroupID" that's contained in a filtered list: CompiledQuery.Compile(ConfigEntities contexty, List list) = from c in context.Groups where (!csList.Contains(c.GroupID)) select c).ToList() However I'm getting the following run-time error: The specified parameter 'categories' of type 'System.Collections.Generic.List`1[[System.Int32, mscorlib, Version=2.0.0.0, Culture=neutral, PublicKeyToken=b77a5c261364e126]]' is not valid. Only scalar parameters (such as Int32, Decimal, and Guid) are supported. Any ideas?

    Read the article

  • Determine if a Range contains a value

    - by Brad Dwyer
    I'm trying to figure out a way to determine if a value falls within a Range in Swift. Basically what I'm trying to do is adapt one of the examples switch statement examples to do something like this: let point = (1, -1) switch point { case let (x, y) where (0..5).contains(x): println("(\(x), \(y)) has an x val between 0 and 5.") default: println("This point has an x val outside 0 and 5.") } As far as I can tell, there isn't any built in way to do what my imaginary .contains method above does. So I tried to extend the Range class. I ended up running into issues with generics though. I can't extend Range<Int> so I had to try to extend Range itself. The closest I got was this but it doesn't work since >= and <= aren't defined for ForwardIndex extension Range { func contains(val:ForwardIndex) -> Bool { return val >= self.startIndex && val <= self.endIndex } } How would I go about adding a .contains method to Range? Or is there a better way to determine whether a value falls within a range? Edit2: This seems to work to extend Range extension Range { func contains(val:T) -> Bool { for x in self { if(x == val) { return true } } return false } } var a = 0..5 a.contains(3) // true a.contains(6) // false a.contains(-5) // false I am very interested in the ~= operator mentioned below though; looking into that now.

    Read the article

  • controlling the class names generated by JAXB for xsd:attributeGroup?

    - by Stephen Winnall
    I am using JAXB to bind XML to Java for an application that I am writing. I have an element called measure which contains two amount elements called amount and maxAmount, with which I want to model a lower and an upper limiting value. amount and maxAmount are otherwise identical and I would like them to be implemented with the same class when unmarshalled into Java. The following is an extract from the XML schema which I feed to JAXB: <xsd:attributeGroup name="AmountAttributes"> <xsd:attribute name="quantity" type="xsd:decimal"/> <xsd:attribute name="numerator" type="xsd:nonNegativeInteger"/> <xsd:attribute name="denominator" type="xsd:positiveInteger"/> </xsd:attributeGroup> <xsd:element name="measure"> <xsd:complexType> <xsd:sequence> <xsd:element minOccurs="0" name="amount"> <xsd:complexType> <xsd:attributeGroup ref="mpr:AmountAttributes"/> </xsd:complexType> </xsd:element> <xsd:element minOccurs="0" name="maxAmount"> <xsd:complexType> <xsd:attributeGroup ref="mpr:AmountAttributes"/> </xsd:complexType> </xsd:element> </xsd:sequence> </xsd:complexType> </xsd:element> JAXB creates from this a more elaborate version of the following: public class Measure { protected Measure.Amount amount; protected Measure.MaxAmount maxAmount; public static class Measure.Amount {} public static class Measure.MaxAmount {} } Measure.Amount and Measure.MaxAmount are identical except for their names, but - of course - as far as Java is concerned they have little to do with each other. Is there a way of making JAXB use the same class for both amount and maxAmount? Just to come completely clean ;-) I should mention that I generate the XML schema from RNC using Trang. If the answer to the question is "change the XML schema", I have the supplementary question "how do I change the RNC to produce that XML schema?". My RNC looks like this: AmountAttributes = QuantityAttribute? & attribute numerator { xsd:nonNegativeInteger }? & attribute denominator { xsd:positiveInteger }? QuantityAttribute = attribute quantity { xsd:decimal } Measure = element measure { element amount { AmountAttributes }?, element maxAmount { AmountAttributes }? }+ I use RNC because I find it simpler to understand, but if the solution to my problem means just using XML Schema, so be it. Steve

    Read the article

  • Undefined javascript function?

    - by user74283
    Working on a google maps project and stuck on what seems to be a minor issue. When i call displayMarkers function firebug returns: ReferenceError: displayMarkers is not defined [Break On This Error] displayMarkers(1); <script type="text/javascript"> function initialize() { var center = new google.maps.LatLng(25.7889689, -80.2264393); var map = new google.maps.Map(document.getElementById('map'), { zoom: 10, center: center, mapTypeId: google.maps.MapTypeId.ROADMAP }); //var data = [[25.924292, -80.124314], [26.140795, -80.3204049], [25.7662857, -80.194692]] var data = {"crs": {"type": "link", "properties": {"href": "http://spatialreference.org/ref/epsg/4326/", "type": "proj4"}}, "type": "FeatureCollection", "features": [{"geometry": {"type": "Point", "coordinates": [25.924292, -80.124314]}, "type": "Feature", "properties": {"industry": [2], "description": "hosp", "title": "shaytac hosp2"}, "id": 35}, {"geometry": {"type": "Point", "coordinates": [26.140795, -80.3204049]}, "type": "Feature", "properties": {"industry": [1, 2], "description": "retail", "title": "shaytac retail"}, "id": 48}, {"geometry": {"type": "Point", "coordinates": [25.7662857, -80.194692]}, "type": "Feature", "properties": {"industry": [2], "description": "hosp2", "title": "shaytac hosp3"}, "id": 36}]} var markers = []; for (var i = 0; i < data.features.length; i++) { var latLng = new google.maps.LatLng(data.features[i].geometry.coordinates[0], data.features[i].geometry.coordinates[1]); var marker = new google.maps.Marker({ position: latLng, title: console.log(data.features[i].properties.industry[0]), map: map }); marker.category = data.features[i].properties.industry[0]; marker.setVisible(true); markers.push(marker); } function displayMarkers(category) { var i; for (i = 0; i < markers.length; i++) { if (markers[i].category === category) { markers[i].setVisible(true); } else { markers[i].setVisible(false); } } } } google.maps.event.addDomListener(window, 'load', initialize); </script> <div id="map-container"> <div id="map"></div> </div> <input type="button" value="Retail" onclick="displayMarkers(1);">

    Read the article

< Previous Page | 119 120 121 122 123 124 125 126 127 128 129 130  | Next Page >