Search Results

Search found 36981 results on 1480 pages for 'string formatting'.

Page 125/1480 | < Previous Page | 121 122 123 124 125 126 127 128 129 130 131 132  | Next Page >

  • Issue with getting 2 chars from string using indexer

    - by Learner
    I am facing an issue in reading char values. See my program below. I want to evaluate an infix expression. As you can see I want to read '10' , '*', '20' and then use them...but if I use string indexer s[0] will be '1' and not '10' and hence I am not able to get the expected result. Can you guys suggest me something? Code is in c# class Program { static void Main(string[] args) { string infix = "10*2+20-20+3"; float result = EvaluateInfix(infix); Console.WriteLine(result); Console.ReadKey(); } public static float EvaluateInfix(string s) { Stack<float> operand = new Stack<float>(); Stack<char> operator1 = new Stack<char>(); int len = s.Length; for (int i = 0; i < len; i++) { if (isOperator(s[i])) // I am having an issue here as s[i] gives each character and I want the number 10 operator1.Push(s[i]); else { operand.Push(s[i]); if (operand.Count == 2) Compute(operand, operator1); } } return operand.Pop(); } public static void Compute(Stack<float> operand, Stack<char> operator1) { float operand1 = operand.Pop(); float operand2 = operand.Pop(); char op = operator1.Pop(); if (op == '+') operand.Push(operand1 + operand2); else if(op=='-') operand.Push(operand1 - operand2); else if(op=='*') operand.Push(operand1 * operand2); else if(op=='/') operand.Push(operand1 / operand2); } public static bool isOperator(char c) { bool result = false; if (c == '+' || c == '-' || c == '*' || c == '/') result = true; return result; } } }

    Read the article

  • Strange \n in base64 encoded string in Ruby

    - by intellidiot
    The inbuilt Base64 library in Ruby is adding some '\n's. I'm unable to find out the reason. For this special example: irb(main):001:0> require 'rubygems' => true irb(main):002:0> require 'base64' => true irb(main):003:0> str = "1110--ad6ca0b06e1fbeb7e6518a0418a73a6e04a67054" => "1110--ad6ca0b06e1fbeb7e6518a0418a73a6e04a67054" irb(main):004:0> Base64.encode64(str) => "MTExMC0tYWQ2Y2EwYjA2ZTFmYmViN2U2NTE4YTA0MThhNzNhNmUwNGE2NzA1\nNA==\n" The \n's are at the last and 6th position from end. The decoder (Base64.decode64) returns back the old string perfectly. Strange thing is, these \n's don't add any value to the encoded string. When I remove the newlines from the output string, the decoder decodes it again perfectly. irb(main):005:0> Base64.decode64(Base64.encode64(str).gsub("\n", '')) == str => true More of this, I used an another JS library to produce the base64 encoded output of the same input string, the output comes without the \n's. Is this a bug or anything else? Has anybody faced this issue before? FYI, $ ruby -v ruby 1.8.7 (2008-08-11 patchlevel 72) [i486-linux]

    Read the article

  • Matlab and .net problem with character string function input

    - by Peter
    I have a MATLAB function that I've compiled into a .net library. The function is a simple one that takes a character array as an input and a numeric array as output: function insert = money(dateLimit) .. insert = [1 2]; The function works fine when no function arguments are specified (a default argument is provided inside the function) Dim sf As New SpreadFinder.SpreadFinder Dim output = sf.money() As soon as an argument is specified .net complains. I'm thinking this should be easy and has been done before but searching through MATLAB documentation doesn't offer much help. Here's what I've tried. The sf.money() overload for the function with arguments is (numArgsOut as Integer, argsOut as MWArray, argsIn as MWArray) and hence that's what I've tried. What am I missing? Dim sf As New SpreadFinder.SpreadFinder Dim inputArgs(1) As Arrays.MWCharArray Dim dateLimitString As String = "some string" inputArgs(0) = New Arrays.MWCharArray(dateLimitString) Dim outputArgs(1) As Arrays.MWNumericArray outputArgs(0) = New Arrays.MWNumericArray() sf.money(1, outputArgs, inputArgs) Gives System.NullReferenceException : Object reference not set to an instance of an object. at MathWorks.MATLAB.NET.Utility.MWMCR.EvaluateFunction(String functionName, Int32 numArgsOut, Int32 numArgsIn, MWArray[] argsIn) at MathWorks.MATLAB.NET.Utility.MWMCR.EvaluateFunction(String functionName, Int32 numArgsOut, MWArray[]& argsOut, MWArray[] argsIn) at SpreadFinder.SpreadFinder.money(Int32 numArgsOut, MWArray[]& argsOut, MWArray[] argsIn)

    Read the article

  • Grouping Collection seperating numeric 5 from String "5"

    - by invertedSpear
    BackGround: I have an advanced data grid. The data provider for this ADG is an ArrayCollection. There is a grouping collection on an ID field of this AC. Example of a couple items within this AC the AC var name is "arcTemplates": (mx.collections::ArrayCollection)#0 filterFunction = (null) length = 69 list = (mx.collections::ArrayList)#1 length = 69 source = (Array)#2 [0] (Object)#3 abbreviation = "sore-throat" insertDate = "11/16/2009" name = "sore throat" templateID = 234 templateType = "New Problem" templateTypeID = 1 [32] (Object)#35 abbreviation = 123 insertDate = "03/08/2010" name = 123 templateID = 297 templateType = "New Problem" templateTypeID = 1 [55] (Object)#58 abbreviation = 1234 insertDate = "11/16/2009" name = 1234 templateID = 227 templateType = "Exam" templateTypeID = 5 [56] (Object)#59 abbreviation = "breast only" insertDate = "03/15/2005" name = "breast exam" templateID = 195 templateType = "Exam" templateTypeID = 5 Example of Flex code leading to the Grouping: <mx:AdvancedDataGrid displayItemsExpanded="true" id="gridTemplates"> <mx:dataProvider> <mx:GroupingCollection id="gc" source="{arcTemplates}"> <mx:Grouping > <mx:GroupingField name="templateTypeID" compareFunction="gcSort"> GC sort function: public function gcSort(a:Object, b:Object):int{ return ObjectUtil.stringCompare(String(a.templateTypeID + a.name).toLowerCase(), String(b.templateTypeID + b.name).toLowerCase()); } Problem: In my AC example there are a few items, items 0, 32 and 56 properly sort and group to their templateTypeID, but item 55 does something weird. It seems to sort/group on the numeric 5 instead of the string "5". Gets stranger. If I change the name property to contain text (so 1234x) it then correctly sorts/groups to the string "5" Question: What is going on here and how do I fix it?

    Read the article

  • ASP.NET application using old connection string.

    - by Doug S.
    I am trying to publish a website using ASP.NET MVC3 EF and CODEFIRST with a SQL Server 2008 backend. On my local machine I was using a sql express db for development, but now that I am pushing live, I want to use my hosted production database. The problem is that when I try to run the application, it is still using my local db connection string. I have completely removed the old connection string from my web.config file and am using the <clear /> tag before creating the new connection string. I have also cleaned the solution and rebuilt, but somehow it is still connecting to the old db. What am I missing? This is the new connection string: <connectionStrings> <clear /> <add name="CellularAutomataDBContext" connectionString=" Server=XXX; Database=CellularAutomata; User ID=XXX; Password=XXX; Trusted_Connection=False" providerName="System.Data.SqlClient" /> </connectionStrings>

    Read the article

  • how to push a string address to stack with assembly, machine code

    - by Yigit
    Hi all, I am changing minesweeper.exe in order to have an understanding of how code injection works. Simply, I want the minesweeper to show a message box before starting. So, I find a "cave" in the executable and then define the string to show in messagebox and call the messagebox. Additionally of course, I have to change the value at module entry point of the executable and first direct it to my additional code, then continue its own code. So at the cave what I do; "hello starbuck",0 push 0 //arg4 of MessageBoxW function push the address of my string //arg3, must be title push the address of my string //arg2, must be the message push 0 //arg1 call MessageBoxW ... Now since the memory addresses of codes in the executable change everytime it is loaded in the memory, for calling the MessageBoxW function, I give the offset of the address where MessageBoxW is defined in Import Address Table. For instance, if MessageBoxW is defined at address1 in the IAT and the instruction just after call MessageBoxW is at address2 instead of writing call MessageBoxW, I write call address2 - address1. So my question is, how do I do it for pushing the string's address to the stack? For example, if I do these changes via ollydbg, I give the immediate address of "hello starbuck" for pushing and it works. But after reloading the executable or starting it outside of ollydbg, it naturally fails, since the immediate addresses change. Thanks in advance, Yigit.

    Read the article

  • How to decode a html string using xslt

    - by John ClearZ
    I am trying to style an rss feed using xslt. I want to display an image that is stored in the tag on the feed. The problem is it is encoded to display as text on the page instead of being rendered. The following is an example of part of the string. 1). <description>&lt;img src="http&amp;#58;&amp;#47;&amp;#47;buavhw.blu.livefilestore.com&amp;#47;y1ppCokLxFJSG2cmyPdvg... I had to add extra coding to the string above to get it to appear properly here. The string below is how it appears when I paste it directly into the text box. 2). <description><img src="http&#58;&#47;&#47;buavhw.blu.livefilestore.com&#47;y1ppCokLxFJSG2cmyPdvg... If I copy and paste it again from the preview window it only then becomes the following string. 3). <description><img src="http://buavhw.blu.livefilestore.com/y1ppCokLxFJSG2cmyPdvg...

    Read the article

  • Literal ampersands in System.Uri query string

    - by Nathan Baulch
    I'm working on a client app that uses a restful service to look up companies by name. It's important that I'm able to include literal ampersands in my queries since this character is quite common in company names. However whenever I pass %26 (the URI escaped ampersand character) to System.Uri, it converts it back to a regular ampersand character! On closer inspection, the only two characters that aren't converted back are hash (%23) and percent (%25). Lets say I want to search for a company named "Pierce & Pierce": var endPoint = "http://localhost/companies?where=Name eq '{0}'"; var name = "Pierce & Pierce"; Console.WriteLine(new Uri(string.Format(endPoint, name))); Console.WriteLine(new Uri(string.Format(endPoint, Uri.EscapeUriString(name)))); Console.WriteLine(new Uri(string.Format(endPoint, Uri.EscapeDataString(name)))); All three of the above combinations return: http://localhost/companies?where=Name eq 'Pierce & Pierce' This causes errors on the server side since the ampersand is (correctly) interpreted as a query arg delimiter. What I really need it to return is the original string: http://localhost/companies?where=Name eq 'Pierce %26 Pierce' How can I work around this behavior without discarding System.Uri entirely? I can't replace all ampersands with %26 at the last moment because there will usually be multiple query args involved and I don't want to destroy their delimiters. Note: A similar problem was discussed in this question but I'm specifically referring to System.Uri.

    Read the article

  • JSF/Facelets: set `action` attribute to a dynamically evaluated string

    - by harto
    In my JSF/Facelets application, I want to dynamically generate a breadcrumb trail from a list of page IDs using a custom tag: <foo:breadcrumbs trail="foo,bar,baz"/> This should generate something like: <h:commandLink action="foo" ... /> <h:commandLink action="bar" ... /> <!-- (etc.) --> My code looks something like this: <ui:repeat value="#{fn:split(trail, ',')}" var="key"> <h:commandLink action="#{key}" ... /> </ui:repeat> The problem with this code is that #{key} is interpreted as a method binding. However, I just want the string value of #{key} to be returned as the navigation outcome. How can I achieve this? The only thing I could think of was creating a dummy managed-bean that has an outcome field and an action handler, and invoke it like so: <h:commandLink action="#{dummy.click}" ...> <f:setPropertyActionListener target="#{dummy.outcome}" value="#{key}" /> </h:commandLink> with the dummy class defined like so: public class Dummy { private String outcome; public String click() { return outcome; } public void setOutcome(String outcome) { this.outcome = outcome; } public void getOutcome() { return outcome; } } That seems ugly though, and I don't know if it would work.

    Read the article

  • Covert uiiamge into string

    - by Warrior
    I am new iphone development.Is there any possibility to covert the uiimage into string and then once again back to image. - (void)imagePickerController:(UIImagePickerController *)picker didFinishPickingImage:(UIImage *)img1 editingInfo:(NSDictionary *)editInfo { [[picker parentViewController] dismissModalViewControllerAnimated:YES]; NSData *data = UIImagePNGRepresentation(img1); NSString *str1; str1 = [[NSString alloc] initWithData:data encoding:NSASCIIStringEncoding]; MyAppAppDelegate *appDelegate = (MyAppAppDelegate *) [[UIApplication sharedApplication] delegate]; [appDelegate setCurrentLink:str1]; EmailPictureViewController *email = [[EmailPictureViewController alloc] initWithNibName:@"EmailPictureViewController" bundle:nil]; [self.navigationController pushViewController:email animated:YES]; } so i can use delegate methods to tranfer the image from one view to another view. so i should convert the string once again to image and display it in another view. In Another view - (void)viewDidLoad { MyAppAppDelegate *appDelegate =(MyAppAppDelegate *) [[UIApplication sharedApplication] delegate]; str1 = [appDelegate getCurrentLink]; NSLog(@"The String %@",str1); NSData *aData; aData = [str1 dataUsingEncoding: NSASCIIStringEncoding]; NSLog(@"The String Data %@",aData); NSLog(@"Inside Didload3"); [imgview setImage:[UIImage imageWithData:aData]]; } But this doesn't work for me.Where do i go wrong.Is there any way to solve it?.Please help me out.Thanks.

    Read the article

  • C# custom control to get internal text as string

    - by Ed Woodcock
    ok, I'm working on a custom control that can contain some javascript, and read this out of the page into a string field. This is a workaround for dynamic javascript inside an updatepanel. At the moment, I've got it working, but if I try to put a server tag inside the block: <custom:control ID="Custom" runat="server"> <%= ControlName.ClientID %> </custom:control> The compiler does not like it. I know these are generated at runtime, and so might not be compatible with what I'm doing, but does anyone have any idea how I can get that working? EDIT Error message is: Code blocks are not supported in this context EDIT 2 The control: [DataBindingHandler("System.Web.UI.Design.TextDataBindingHandler, System.Design, Version=2.0.0.0, Culture=neutral, PublicKeyToken=b03f5f7f11d50a3a"), ControlValueProperty("Text"), DefaultProperty("Text"), ParseChildren(true, "Text"), AspNetHostingPermission(SecurityAction.LinkDemand, Level = AspNetHostingPermissionLevel.Minimal), AspNetHostingPermission(SecurityAction.InheritanceDemand, Level = AspNetHostingPermissionLevel.Minimal)] public class CustomControl : Control, ITextControl { [DefaultValue(""), Bindable(true), Localizable(true)] public string Text { get { return (string)(ViewState["Text"] ?? string.Empty); } set { ViewState["Text"] = value; } } }

    Read the article

  • Serializing and deserializing a map with key as string

    - by Grace K
    Hi! I am intending to serialize and deserialize a hashmap whose key is a string. From Josh Bloch's Effective Java, I understand the following. P.222 "For example, consider the case of a harsh table. The physical representation is a sequence of hash buckets containing key-value entries. Which bucket an entry is placed in is a function of the hash code of the key, which is not, in general guaranteed to be the same from JVM implementation to JVM implementation. In fact, it isn't even guranteed to be the same from run to run on the same JVM implementation. Therefore accepting the default serialized form for a hash table would constitute a serious bug. Serializing and deserializing the hash table could yield an object whose invariants were seriously corrupt." My questions are: 1) In general, would overriding the equals and hashcode of the key class of the map resolve this issue and the map can be correctly restored? 2) If my key is a String and the String class is already overriding the hashCode() method, would I still have problem described above. (I am seeing a bug which makes me think this is probably still a problem even though the key is String with overriding hashCode.) 3)Previously, I get around this issue by serializing an array of entries (key, value) and when deserializing I would reconstruct the map. I am wondering if there is a better approach. 4) If the answers to question 1 and 2 are that I still can't be guaranteed. Could someone explain why? If the hashCodes are the same would they go to the same buckets across JVMs? Thanks, Grace

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Setting String as Image Source in C#

    - by Dan
    UPDATE: Okay I've changed my code to this: if (appSettings.Contains("image")) { Uri uri = new Uri( (string)appSettings["image"] + ".jpg", UriKind.Absolute); ImageSource imgSource = new BitmapImage(uri); myImage.Source = imgSource; } else { Uri uriDefault = new Uri("default.jpg", UriKind.Absolute); ImageSource imgSourceDefault = new BitmapImage(uriDefault); myImage.Source = imgSourceDefault; } But now I get "Invalid URI: The format of the URI could not be determined". Well I've looked up several methods to fix this in my Windows Phone 7 app but I can't seem to find anything that works. What confuses me is that I've done something just like this before with no problem, so I'm not sure why it's not working. The code causing me the problem is this: if (appSettings.Contains("image")) { myImage.Source = (string)appSettings["image"]; } else { myImage.Source = "default.jpg"; } The error I get is this "Cannot implicitly convert type 'string' to 'System.Windows.Media.ImageSource". The reason this confuses me is because I did this Twitter app tutorial: http://weblogs.asp.net/scottgu/archive/2010/03/18/building-a-windows-phone-7-twitter-application-using-silverlight.aspx , in which you bind the image source directly to a string. So what can I do to remedy this?

    Read the article

  • Cross-platform iteration of Unicode string

    - by kizzx2
    I want to iterate each character of a Unicode string, treating each surrogate pair and combining character sequence as a single unit (one grapheme). Example The text "??????" is comprised of the code points: U+0928, U+092E, U+0938, U+094D, U+0924, U+0947, of which, U+0938 and U+0947 are combining marks. static void Main(string[] args) { const string s = "??????"; Console.WriteLine(s.Length); // Ouptuts "6" var l = 0; var e = System.Globalization.StringInfo.GetTextElementEnumerator(s); while(e.MoveNext()) l++; Console.WriteLine(l); // Outputs "4" } So there we have it in .NET. We also have Win32's CharNextW() #include <Windows.h> #include <iostream> #include <string> int main() { const wchar_t * s = L"??????"; std::cout << std::wstring(s).length() << std::endl; // Gives "6" int l = 0; while(CharNextW(s) != s) { s = CharNextW(s); ++l; } std::cout << l << std::endl; // Gives "4" return 0; } Question Both ways I know of are specific to Microsoft. Are there portable ways to do it? I heard about ICU but I couldn't find something related quickly (UnicodeString(s).length() still gives 6). Would be an acceptable answer to point to the related function/module in ICU. C++ doesn't have a notion of Unicode, so a lightweight cross-platform library for dealing with these issues would make an acceptable answer.

    Read the article

  • Setting Nullable Integer to String Containing Nothing yields 0

    - by Brian MacKay
    I've been pulling my hair out over some unexpected behavior from nullable integers. If I set an Integer to Nothing, it becomes Nothing as expected. If I set an Integer? to a String that is Nothing, it becomes 0! Of course I get this whether I explicitly cast the String to Integer? or not. I realize I could work around this pretty easily but I want to know what I'm missing. Dim NullString As String = Nothing Dim NullableInt As Integer? = CType(NullString, Integer?) 'Expected NullableInt to be Nothing, but it's 0! NullableInt = Nothing 'This works -- NullableInt now contains Nothing. How is this EDIT: Previously I had my code up here so without the explicit conversion to 'Integer?' and everyone seemed to be fixated on that. I want to be clear that this is not an issue that would have been caught by Option Strict On -- check out the accepted answer. This is a quirk of the string-to-integer conversion rules which predate nullable types, but still impact them.

    Read the article

  • Instrumenting a string

    - by George Polevoy
    Somewhere in C++ era i have crafted a library, which enabled string representation of the computation history. Having a math expression like: TScalar Compute(TScalar a, TScalar b, TScalar c) { return ( a + b ) * c; } I could render it's string representation: r = Compute(VerbalScalar("a", 1), VerbalScalar("b", 2), VerbalScalar("c", 3)); Assert.AreEqual(9, r.Value); Assert.AreEqual("(a+b)*c==(1+2)*3", r.History ); C++ operator overloading allowed for substitution of a simple type with a complex self-tracking entity with an internal tree representation of everything happening with the objects. Now i would like to have the same possibility for NET strings, only instead of variable names i would like to see a stack traces of all the places in code which affected a string. And i want it to work with existing code, and existing compiled assemblies. Also i want all this to hook into visual studio debugger, so i could set a breakpoint, and see everything that happened with a string. Which technology would allow this kind of things? I know it sound like an utopia, but I think visual studio code coverage tools actually do the same kind of job while instrumenting the assemblies.

    Read the article

  • "Function object is unsubscriptable" in basic integer to string mapping function

    - by IanWhalen
    I'm trying to write a function to return the word string of any number less than 1000. Everytime I run my code at the interactive prompt it appears to work without issue but when I try to import wordify and run it with a test number higher than 20 it fails as "TypeError: 'function' object is unsubscriptable". Based on the error message, it seems the issue is when it tries to index numString (for example trying to extract the number 4 out of the test case of n = 24) and the compiler thinks numString is a function instead of a string. since the first line of the function is me defining numString as a string of the variable n, I'm not really sure why that is. Any help in getting around this error, or even just help in explaining why I'm seeing it, would be awesome. def wordify(n): # Convert n to a string to parse out ones, tens and hundreds later. numString = str(n) # N less than 20 is hard-coded. if n < 21: return numToWordMap(n) # N between 21 and 99 parses ones and tens then concatenates. elif n < 100: onesNum = numString[-1] ones = numToWordMap(int(onesNum)) tensNum = numString[-2] tens = numToWordMap(int(tensNum)*10) return tens+ones else: # TODO pass def numToWordMap(num): mapping = { 0:"", 1:"one", 2:"two", 3:"three", 4:"four", 5:"five", 6:"six", 7:"seven", 8:"eight", 9:"nine", 10:"ten", 11:"eleven", 12:"twelve", 13:"thirteen", 14:"fourteen", 15:"fifteen", 16:"sixteen", 17:"seventeen", 18:"eighteen", 19:"nineteen", 20:"twenty", 30:"thirty", 40:"fourty", 50:"fifty", 60:"sixty", 70:"seventy", 80:"eighty", 90:"ninety", 100:"onehundred", 200:"twohundred", 300:"threehundred", 400:"fourhundred", 500:"fivehundred", 600:"sixhundred", 700:"sevenhundred", 800:"eighthundred", 900:"ninehundred", } return mapping[num] if __name__ == '__main__': pass

    Read the article

  • Java - Counting how many characters show up in another string

    - by Vu Châu
    I am comparing two strings, in Java, to see how many characters from the first string show up in the second string. The following is some expectations: matchingChars("AC", "BA") ? 1 matchingChars("ABBA", "B") ? 2 matchingChars("B", "ABBA") ? 1 My approach is as follows: public int matchingChars(String str1, String str2) { int count = 0; for (int a = 0; a < str1.length(); a++) { for (int b = 0; b < str2.length(); b++) { char str1Char = str1.charAt(a); char str2Char = str2.charAt(b); if (str1Char == str2Char) { count++; str1 = str1.replace(str1Char, '0'); } } } return count; } I know my approach is not the best, but I think it should do it. However, for matchingChars("ABBA", "B") ? 2 My code yields "1" instead of "2". Does anyone have any suggestion or advice? Thank you very much.

    Read the article

  • Getting the full-name of the current user, returns an empty string (C#/C++)

    - by Nir
    I try to get the full-name of the current log-in user (Fullname, not username). The following code C#, C++ works fine but on XP computers not connected to the Net, I get empty string as result if I run it ~20 minutes after login (It runs OK whithin the first ~20 minutes after login) A Win32 API (GetUserNameEx) is used rather that PrincipalContext since it PrincipalContext may takes up to 15 seconds when working offline. Any Help why am I getting an empty string as result though a user full name is specified??? - C# Code public static string CurrentUserFullName { get { const int EXTENDED_NAME_FORMAT_NAME_DISPLAY = 3; StringBuilder userName = new StringBuilder(256); uint length = (uint) userName.Capacity; string ret; if (GetUserNameEx(EXTENDED_NAME_FORMAT_NAME_DISPLAY, userName, ref length)) { ret = userName.ToString(); } else { int errorCode = Marshal.GetLastWin32Error(); throw new Win32Exception("GetUserNameEx Failed. Error code - " + errorCode); } return ret; } } [DllImport("Secur32.dll", CharSet = CharSet.Auto, SetLastError = true)] private static extern bool GetUserNameEx(int nameFormat, StringBuilder lpNameBuffer, ref uint lpnSize); - Code in C++ #include "stdafx.h" #include <windows.h> #define SECURITY_WIN32 #include <Security.h> #pragma comment( lib, "Secur32.lib" ) int _tmain(int argc, _TCHAR* argv[]) { char szName[100]; ULONG nChars = sizeof( szName ); if ( GetUserNameEx( NameDisplay, szName, &nChars ) ) { printf( "Name: %s\n", szName); } else { printf( "Failed to GetUserNameEx\n" ); printf( "%d\n", GetLastError() ); } return 0; }

    Read the article

  • How to update a string property of an sqlite database item

    - by Thomas Joos
    hi all, I'm trying to write an application that checks if there is an active internet connection. If so it reads an xml and checks every 'lastupdated' item ( php generated string ). It compares it to the database items and if there is a new value, this particular item needs to be updated. My code seems to work ( compiles, no error messages, no failures, .. ) but I notice that the particular property does not change, it becomese (null). When I output the binded string value it returns the correct string value I want to update into the db.. Any idea what I'm doing wrong? const char *sql = "update myTable Set last_updated=? Where node_id =?"; sqlite3_stmt *statement; // Preparing a statement compiles the SQL query into a byte-code program in the SQLite library. // The third parameter is either the length of the SQL string or -1 to read up to the first null terminator. if (sqlite3_prepare_v2(database, sql, -1, &statement, NULL) == SQLITE_OK){ NSLog(@"last updated item: %@", [d lastupdated]); sqlite3_bind_text(statement, 1, [d lastupdated],-1,SQLITE_TRANSIENT); sqlite3_bind_int (statement, 2, [d node_id]); }else { NSLog(@"SQLite statement error!"); } if(SQLITE_DONE != sqlite3_step(statement)){ NSAssert1(0, @"Error while updating. '%s'", sqlite3_errmsg(database)); }else { NSLog(@"SQLite Update done!"); }

    Read the article

  • SQL Server 2008 Prior String Extract

    - by Saidur Rahman
    I have strings like the ones below in a SQL column. I want to extract them as a Gigabyte amount in aggregate. Example: Original Column ---------> Expected Output from a TSQL function ------------------------------------------- $15 / 1GB 24m + Intern 120MB ----------> 1.12 GB $19.95 / 500MB + $49.95 / 9GB Blackberry -----> 9.5GB $174.95 Blackberry 24GB + $10 / 1GB Datapack ----> 25GB $79 / 6GB --> 6GB Null --> Null $20 Plan --> 0GB Note: for our purpose, 1000MB = 1 GB (not 1024). The pattern is numbers followed by GB/MB, usually they are combined like 1GB (without any space but may sometimes may contain a space, it is not particularly important if hard to implement for this exception). Sometimes there are up to three or four instances of GB/MB occurring in the same string which are usually separated by a + sign (see row 2 and 3 of my example above). I have seen how we extract the dollar values in one of the answers where numbers were followed by $ or extract all integers in a string but I don't want to extract the dollar values or all the integers in a string. I just want the sum of GB/MB in the string.

    Read the article

  • Fast find object by string property

    - by Andrew Kalashnikov
    Hello, colleagues. I've got task to fast find object by its string property. Object: class DicDomain { public virtual string Id{ get; set; } public virtual string Name { get; set; } } For storing my object I use List[T] dictionary where T is DicDomain for now . I've got 5-10 such lists, which contain about 500-20000 at each one. Task is find objects by its Name. I use next code now: List<T> entities = dictionary.FindAll(s => s.Name.Equals(word, StringComparison.OrdinalIgnoreCase)); I've got some questions: Is my search speed optimal. I think now. Data structure. It List good for this task. What about hashtable,sorted... Method Find. May be i should use string intern?? I haven't much exp at these tasks. Can u give me good advice for increase perfomance. Thanks

    Read the article

  • Passing.getText() String to another class

    - by DanMc
    I'm currently working on a first year university project and I have a problem, although I doubt it's a very complicated one, but I've been searching and I just can't find a suitable answer to it. The problem concerns two classes. A gui class (class1) and another class (class2). I have a JTextField in class1 and am trying to pass through the .getText() value to class2 and store it in a String type variable. The current code I'm trying to achieve this with is the following: (Class1) private JTextField textField = new JTextField("Something"); ... public String getTextFieldString() { return textField.getText(); } (Class2) private c1 Class1 = new Class1(); private String s = new String(); ... s = c1.getTextFieldString(); I'm pretty new to coding, I've read that maybe I need to pass through an argument somewhere and I assume that's because textField is not static in itself, it changes when somebody enters a new value. (sorry for stating the obvious there.) Anyway, help is appreciated. Thanks a lot!

    Read the article

  • String Index Out Of Bound Exception error

    - by Fd Fehfhd
    Im not really sure why a am getting this error. But here is my code it is meant to test palindromes disregarding punctuation. So here is my code import java.util.Scanner; public class PalindromeTester { public static void main(String [] args) { Scanner kb = new Scanner(System.in); String txt = ""; int left; int right; int cntr = 0; do { System.out.println("Enter a word, phrase, or sentence (blank line to stop):"); txt = kb.nextLine(); txt = txt.toLowerCase(); char yP; String noP = ""; for (int i = 0; i < txt.length(); i++) { yP = txt.charAt(i); if (Character.isLetterOrDigit(txt.charAt(yP))) { noP += yP; } } txt = noP; left = 0; right = txt.length() -1; while (txt.charAt(left) == txt.charAt(right) && right > left) { left++; right--; } if (left > right) { System.out.println("Palindrome"); cntr++; } else { System.out.println("Not a palindrome"); } } while (!txt.equals("")); System.out.println("You found " + cntr + " palindromes. Thank you for using palindromeTester."); } } And if i test it and then i put enter so it will tell me how many palindromes you found the error i am getting is javav.lang.StringIndexOutOfBoundException : String index out of range 0 at PalindromeTester.main(PalindromeTester.java:38) and line 28 is while (txt.charAt(left) == txt.charAt(right) && right > left) Thanks for the help in advance

    Read the article

< Previous Page | 121 122 123 124 125 126 127 128 129 130 131 132  | Next Page >