Search Results

Search found 42745 results on 1710 pages for 'what is the difference between string and string in c'.

Page 125/1710 | < Previous Page | 121 122 123 124 125 126 127 128 129 130 131 132  | Next Page >

  • Serializing and deserializing a map with key as string

    - by Grace K
    Hi! I am intending to serialize and deserialize a hashmap whose key is a string. From Josh Bloch's Effective Java, I understand the following. P.222 "For example, consider the case of a harsh table. The physical representation is a sequence of hash buckets containing key-value entries. Which bucket an entry is placed in is a function of the hash code of the key, which is not, in general guaranteed to be the same from JVM implementation to JVM implementation. In fact, it isn't even guranteed to be the same from run to run on the same JVM implementation. Therefore accepting the default serialized form for a hash table would constitute a serious bug. Serializing and deserializing the hash table could yield an object whose invariants were seriously corrupt." My questions are: 1) In general, would overriding the equals and hashcode of the key class of the map resolve this issue and the map can be correctly restored? 2) If my key is a String and the String class is already overriding the hashCode() method, would I still have problem described above. (I am seeing a bug which makes me think this is probably still a problem even though the key is String with overriding hashCode.) 3)Previously, I get around this issue by serializing an array of entries (key, value) and when deserializing I would reconstruct the map. I am wondering if there is a better approach. 4) If the answers to question 1 and 2 are that I still can't be guaranteed. Could someone explain why? If the hashCodes are the same would they go to the same buckets across JVMs? Thanks, Grace

    Read the article

  • C# custom control to get internal text as string

    - by Ed Woodcock
    ok, I'm working on a custom control that can contain some javascript, and read this out of the page into a string field. This is a workaround for dynamic javascript inside an updatepanel. At the moment, I've got it working, but if I try to put a server tag inside the block: <custom:control ID="Custom" runat="server"> <%= ControlName.ClientID %> </custom:control> The compiler does not like it. I know these are generated at runtime, and so might not be compatible with what I'm doing, but does anyone have any idea how I can get that working? EDIT Error message is: Code blocks are not supported in this context EDIT 2 The control: [DataBindingHandler("System.Web.UI.Design.TextDataBindingHandler, System.Design, Version=2.0.0.0, Culture=neutral, PublicKeyToken=b03f5f7f11d50a3a"), ControlValueProperty("Text"), DefaultProperty("Text"), ParseChildren(true, "Text"), AspNetHostingPermission(SecurityAction.LinkDemand, Level = AspNetHostingPermissionLevel.Minimal), AspNetHostingPermission(SecurityAction.InheritanceDemand, Level = AspNetHostingPermissionLevel.Minimal)] public class CustomControl : Control, ITextControl { [DefaultValue(""), Bindable(true), Localizable(true)] public string Text { get { return (string)(ViewState["Text"] ?? string.Empty); } set { ViewState["Text"] = value; } } }

    Read the article

  • PHP: visual difference between 2 arrays

    - by Paulo Freitas
    I've these arrays: <?php // New $array1 = array( array( 'g_id' => '1', 'g_title' => 'Root Admin', 'g_perm_id' => '1', 'g_bitoptions' => '0' ), array( 'g_id' => '2', 'g_title' => 'Member', 'g_perm_id' => '2', 'g_bitoptions' => '32' ), array( 'g_id' => '3', 'g_title' => 'Banned', 'g_perm_id' => '3', 'g_bitoptions' => '0' ) ); // Old $array2 = array( array( 'g_id' => '1', 'g_title' => 'Admin', 'g_perm_id' => '1', 'g_bitoptions' => '0' ), array( 'g_id' => '2', 'g_title' => 'User', 'g_perm_id' => '2', 'g_bitoptions' => '0' ), array( 'g_id' => '4', 'g_title' => 'Validating', 'g_perm_id' => '4', 'g_bitoptions' => '0' ) ); What I'm want is an HTML visual difference between them, like this picture: http://img519.imageshack.us/i/diffe.png/ Anyone here knows any 3rd party class that do this? I've been looking at some but none of them had it. =/ Thank you in advance.

    Read the article

  • Performance difference in for loop condition?

    - by CSharperWithJava
    Hello all, I have a simple question that I am posing mostly for my curiousity. What are the differences between these two lines of code? (in C++) for(int i = 0; i < N, N > 0; i++) for(int i = 0; i < N && N > 0; i++) The selection of the conditions is completely arbitrary, I'm just interested in the differences between , and &&. I'm not a beginner to coding by any means, but I've never bothered with the comma operator. Are there performance/behavior differences or is it purely aesthetic? One last note, I know there are bigger performance fish to fry than a conditional operator, but I'm just curious. Indulge me. Edit Thanks for your answers. It turns out the code that prompted this question had misused the comma operator in the way I've described. I wondered what the difference was and why it wasn't a && operator, but it was just written incorrectly. I didn't think anything was wrong with it because it worked just fine. Thanks for straightening me out.

    Read the article

  • Setting String as Image Source in C#

    - by Dan
    UPDATE: Okay I've changed my code to this: if (appSettings.Contains("image")) { Uri uri = new Uri( (string)appSettings["image"] + ".jpg", UriKind.Absolute); ImageSource imgSource = new BitmapImage(uri); myImage.Source = imgSource; } else { Uri uriDefault = new Uri("default.jpg", UriKind.Absolute); ImageSource imgSourceDefault = new BitmapImage(uriDefault); myImage.Source = imgSourceDefault; } But now I get "Invalid URI: The format of the URI could not be determined". Well I've looked up several methods to fix this in my Windows Phone 7 app but I can't seem to find anything that works. What confuses me is that I've done something just like this before with no problem, so I'm not sure why it's not working. The code causing me the problem is this: if (appSettings.Contains("image")) { myImage.Source = (string)appSettings["image"]; } else { myImage.Source = "default.jpg"; } The error I get is this "Cannot implicitly convert type 'string' to 'System.Windows.Media.ImageSource". The reason this confuses me is because I did this Twitter app tutorial: http://weblogs.asp.net/scottgu/archive/2010/03/18/building-a-windows-phone-7-twitter-application-using-silverlight.aspx , in which you bind the image source directly to a string. So what can I do to remedy this?

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Cross-platform iteration of Unicode string

    - by kizzx2
    I want to iterate each character of a Unicode string, treating each surrogate pair and combining character sequence as a single unit (one grapheme). Example The text "??????" is comprised of the code points: U+0928, U+092E, U+0938, U+094D, U+0924, U+0947, of which, U+0938 and U+0947 are combining marks. static void Main(string[] args) { const string s = "??????"; Console.WriteLine(s.Length); // Ouptuts "6" var l = 0; var e = System.Globalization.StringInfo.GetTextElementEnumerator(s); while(e.MoveNext()) l++; Console.WriteLine(l); // Outputs "4" } So there we have it in .NET. We also have Win32's CharNextW() #include <Windows.h> #include <iostream> #include <string> int main() { const wchar_t * s = L"??????"; std::cout << std::wstring(s).length() << std::endl; // Gives "6" int l = 0; while(CharNextW(s) != s) { s = CharNextW(s); ++l; } std::cout << l << std::endl; // Gives "4" return 0; } Question Both ways I know of are specific to Microsoft. Are there portable ways to do it? I heard about ICU but I couldn't find something related quickly (UnicodeString(s).length() still gives 6). Would be an acceptable answer to point to the related function/module in ICU. C++ doesn't have a notion of Unicode, so a lightweight cross-platform library for dealing with these issues would make an acceptable answer.

    Read the article

  • Setting Nullable Integer to String Containing Nothing yields 0

    - by Brian MacKay
    I've been pulling my hair out over some unexpected behavior from nullable integers. If I set an Integer to Nothing, it becomes Nothing as expected. If I set an Integer? to a String that is Nothing, it becomes 0! Of course I get this whether I explicitly cast the String to Integer? or not. I realize I could work around this pretty easily but I want to know what I'm missing. Dim NullString As String = Nothing Dim NullableInt As Integer? = CType(NullString, Integer?) 'Expected NullableInt to be Nothing, but it's 0! NullableInt = Nothing 'This works -- NullableInt now contains Nothing. How is this EDIT: Previously I had my code up here so without the explicit conversion to 'Integer?' and everyone seemed to be fixated on that. I want to be clear that this is not an issue that would have been caught by Option Strict On -- check out the accepted answer. This is a quirk of the string-to-integer conversion rules which predate nullable types, but still impact them.

    Read the article

  • RegEx: difference between "(?:...) and normal parentheses

    - by N0thing
    >>> re.findall(r"(?:do|re|mi)+", "mimi") ['mimi'] >>> re.findall(r"(do|re|mi)+", "mimi") ['mi'] According to my understanding of the definitions, it should produce the same answer. The only difference between (...) and (?:...) should be whether or not we can use back-references later. Am I missing something? (...) Matches whatever regular expression is inside the parentheses, and indicates the start and end of a group; the contents of a group can be retrieved after a match has been performed, and can be matched later in the string with the \number special sequence, described below. To match the literals '(' or ')', use ( or ), or enclose them inside a character class: [(] [)]. (?:...) A non-capturing version of regular parentheses. Matches whatever regular expression is inside the parentheses, but the substring matched by the group cannot be retrieved after performing a match or referenced later in the pattern.

    Read the article

  • Instrumenting a string

    - by George Polevoy
    Somewhere in C++ era i have crafted a library, which enabled string representation of the computation history. Having a math expression like: TScalar Compute(TScalar a, TScalar b, TScalar c) { return ( a + b ) * c; } I could render it's string representation: r = Compute(VerbalScalar("a", 1), VerbalScalar("b", 2), VerbalScalar("c", 3)); Assert.AreEqual(9, r.Value); Assert.AreEqual("(a+b)*c==(1+2)*3", r.History ); C++ operator overloading allowed for substitution of a simple type with a complex self-tracking entity with an internal tree representation of everything happening with the objects. Now i would like to have the same possibility for NET strings, only instead of variable names i would like to see a stack traces of all the places in code which affected a string. And i want it to work with existing code, and existing compiled assemblies. Also i want all this to hook into visual studio debugger, so i could set a breakpoint, and see everything that happened with a string. Which technology would allow this kind of things? I know it sound like an utopia, but I think visual studio code coverage tools actually do the same kind of job while instrumenting the assemblies.

    Read the article

  • what's the performance difference between int and varchar for primary keys

    - by user568576
    I need to create a primary key scheme for a system that will need peer to peer replication. So I'm planning to combine a unique system ID and a sequential number in some way to come up with unique ID's. I want to make sure I'll never run out of ID's, so I'm thinking about using a varchar field, since I could always add another character if I start running out. But I've read that integers are better optimized for this. So I have some questions... 1) Are integers really better optimized? And if they are, how much of a performance difference is there between varchars and integers? I'm going to use firebird for now. But I may switch later. Or possibly support multiple db's. So I'm looking for generalizations, if that's possible. 2) If integers are significantly better optimized, why is that? And is it likely that varchars will catch up in the future, so eventually it won't matter anyway? My varchar keys won't have any meaning, except for the unique system ID part. But I may want to obscure that somehow. Also, I plan to efficiently use all the bits of each character. I don't, for example, plan to code the integer 123 as the character string "123". So I don't think varchars will require more space than integers.

    Read the article

  • Difference between MVC FilterAttribute and Filter

    - by zaaaaphod
    I'm trying to write my own custom AuthorizationAttribute that uses DI. I'm using the MUNQ IoC provider for it's speed and have decided to use constructor injection on all my classes as opposed to post instatiation property binding (because I prefer it). I'm trying to write a custom IFilterProvider that will use my IoC container to return requests for filters (so that I can map concrete classes using the container). I've come up with the following. public class FilterProvider : IFilterProvider { private readonly IocContainer _container; public FilterProvider(IocContainer container) { _container = container; } public IEnumerable<Filter> GetFilters(ControllerContext controllerContext, ActionDescriptor actionDescriptor) { var x = Enumerable.Union<Object>(_container.ResolveAll<IActionFilter>(), _container.ResolveAll<IAuthorizationFilter>()); foreach (Filter actionFilter in x) yield return new Filter(actionFilter, FilterScope.First, null); } } The above code will fail during the foreach because my objects that implement IAuthorizationFilter are based on FilterAttribute and not Filter My question is, what is the difference between Filter and FilterAttribute? I would have thought that there would have been a common link between them, unless I'm missing something. Another deeper question is, how come there is no IFilterAttributeProvider that would support IEnumerable GetFilters(...) Is there some other way that I should be using to resolve IAuthorizationFilter via my IoC container? Thank you very much for your help. Z

    Read the article

  • "Function object is unsubscriptable" in basic integer to string mapping function

    - by IanWhalen
    I'm trying to write a function to return the word string of any number less than 1000. Everytime I run my code at the interactive prompt it appears to work without issue but when I try to import wordify and run it with a test number higher than 20 it fails as "TypeError: 'function' object is unsubscriptable". Based on the error message, it seems the issue is when it tries to index numString (for example trying to extract the number 4 out of the test case of n = 24) and the compiler thinks numString is a function instead of a string. since the first line of the function is me defining numString as a string of the variable n, I'm not really sure why that is. Any help in getting around this error, or even just help in explaining why I'm seeing it, would be awesome. def wordify(n): # Convert n to a string to parse out ones, tens and hundreds later. numString = str(n) # N less than 20 is hard-coded. if n < 21: return numToWordMap(n) # N between 21 and 99 parses ones and tens then concatenates. elif n < 100: onesNum = numString[-1] ones = numToWordMap(int(onesNum)) tensNum = numString[-2] tens = numToWordMap(int(tensNum)*10) return tens+ones else: # TODO pass def numToWordMap(num): mapping = { 0:"", 1:"one", 2:"two", 3:"three", 4:"four", 5:"five", 6:"six", 7:"seven", 8:"eight", 9:"nine", 10:"ten", 11:"eleven", 12:"twelve", 13:"thirteen", 14:"fourteen", 15:"fifteen", 16:"sixteen", 17:"seventeen", 18:"eighteen", 19:"nineteen", 20:"twenty", 30:"thirty", 40:"fourty", 50:"fifty", 60:"sixty", 70:"seventy", 80:"eighty", 90:"ninety", 100:"onehundred", 200:"twohundred", 300:"threehundred", 400:"fourhundred", 500:"fivehundred", 600:"sixhundred", 700:"sevenhundred", 800:"eighthundred", 900:"ninehundred", } return mapping[num] if __name__ == '__main__': pass

    Read the article

  • Problem finding the difference in days between two dates

    - by James
    I have been using a tidy little routine that I found here to calculate the difference in days between two dates in AS3. I am getting some strange results and I am wondering if any of you inter-codal-mega-lords can shed some light? Why is Q1 of 2010 coming up one day short, when in all other cases the routine is performing fine? Many thanks in advance to anyone who can help! function countDays( startDate:Date, endDate:Date ):int { var oneDay:int = 24*60*60*1000; // hours*minutes*seconds*milliseconds var diffDays:int = Math.abs((startDate.getTime() - endDate.getTime())/(oneDay)); return diffDays; } countDays( new Date( 2010, 00, 01 ), new Date( 2011, 00, 01 ) ); // returns 365, which is correct countDays( new Date( 2010, 00, 01 ), new Date( 2010, 03, 01 ) ); // returns 89, which is 1 day short countDays( new Date( 2010, 03, 01 ), new Date( 2010, 06, 01 ) ); // returns 91, which is correct countDays( new Date( 2010, 06, 01 ), new Date( 2010, 09, 01 ) ); // returns 92, which is correct countDays( new Date( 2010, 09, 01 ), new Date( 2011, 00, 01 ) ); // returns 92, which is correct

    Read the article

  • Getting the full-name of the current user, returns an empty string (C#/C++)

    - by Nir
    I try to get the full-name of the current log-in user (Fullname, not username). The following code C#, C++ works fine but on XP computers not connected to the Net, I get empty string as result if I run it ~20 minutes after login (It runs OK whithin the first ~20 minutes after login) A Win32 API (GetUserNameEx) is used rather that PrincipalContext since it PrincipalContext may takes up to 15 seconds when working offline. Any Help why am I getting an empty string as result though a user full name is specified??? - C# Code public static string CurrentUserFullName { get { const int EXTENDED_NAME_FORMAT_NAME_DISPLAY = 3; StringBuilder userName = new StringBuilder(256); uint length = (uint) userName.Capacity; string ret; if (GetUserNameEx(EXTENDED_NAME_FORMAT_NAME_DISPLAY, userName, ref length)) { ret = userName.ToString(); } else { int errorCode = Marshal.GetLastWin32Error(); throw new Win32Exception("GetUserNameEx Failed. Error code - " + errorCode); } return ret; } } [DllImport("Secur32.dll", CharSet = CharSet.Auto, SetLastError = true)] private static extern bool GetUserNameEx(int nameFormat, StringBuilder lpNameBuffer, ref uint lpnSize); - Code in C++ #include "stdafx.h" #include <windows.h> #define SECURITY_WIN32 #include <Security.h> #pragma comment( lib, "Secur32.lib" ) int _tmain(int argc, _TCHAR* argv[]) { char szName[100]; ULONG nChars = sizeof( szName ); if ( GetUserNameEx( NameDisplay, szName, &nChars ) ) { printf( "Name: %s\n", szName); } else { printf( "Failed to GetUserNameEx\n" ); printf( "%d\n", GetLastError() ); } return 0; }

    Read the article

  • Fast find object by string property

    - by Andrew Kalashnikov
    Hello, colleagues. I've got task to fast find object by its string property. Object: class DicDomain { public virtual string Id{ get; set; } public virtual string Name { get; set; } } For storing my object I use List[T] dictionary where T is DicDomain for now . I've got 5-10 such lists, which contain about 500-20000 at each one. Task is find objects by its Name. I use next code now: List<T> entities = dictionary.FindAll(s => s.Name.Equals(word, StringComparison.OrdinalIgnoreCase)); I've got some questions: Is my search speed optimal. I think now. Data structure. It List good for this task. What about hashtable,sorted... Method Find. May be i should use string intern?? I haven't much exp at these tasks. Can u give me good advice for increase perfomance. Thanks

    Read the article

  • How to update a string property of an sqlite database item

    - by Thomas Joos
    hi all, I'm trying to write an application that checks if there is an active internet connection. If so it reads an xml and checks every 'lastupdated' item ( php generated string ). It compares it to the database items and if there is a new value, this particular item needs to be updated. My code seems to work ( compiles, no error messages, no failures, .. ) but I notice that the particular property does not change, it becomese (null). When I output the binded string value it returns the correct string value I want to update into the db.. Any idea what I'm doing wrong? const char *sql = "update myTable Set last_updated=? Where node_id =?"; sqlite3_stmt *statement; // Preparing a statement compiles the SQL query into a byte-code program in the SQLite library. // The third parameter is either the length of the SQL string or -1 to read up to the first null terminator. if (sqlite3_prepare_v2(database, sql, -1, &statement, NULL) == SQLITE_OK){ NSLog(@"last updated item: %@", [d lastupdated]); sqlite3_bind_text(statement, 1, [d lastupdated],-1,SQLITE_TRANSIENT); sqlite3_bind_int (statement, 2, [d node_id]); }else { NSLog(@"SQLite statement error!"); } if(SQLITE_DONE != sqlite3_step(statement)){ NSAssert1(0, @"Error while updating. '%s'", sqlite3_errmsg(database)); }else { NSLog(@"SQLite Update done!"); }

    Read the article

  • performance issue: difference between select s.* vs select *

    - by kamil
    Recently I had some problem in performance of my query. The thing is described here: poor Hibernate select performance comparing to running directly - how debug? After long time of struggling, I've finally discovered that the query with select prefix like: select sth.* from Something as sth... Is 300x times slower then query started this way: select * from Something as sth.. Could somebody help me, and asnwer why is that so? Some external documents on this would be really useful. The table used for testing was: SALES_UNIT table contains some basic info abot sales unit node such as name and etc. The only association is to table SALES_UNIT_TYPE, as ManyToOne. The primary key is ID and field VALID_FROM_DTTM which is date. SALES_UNIT_RELATION contains relation PARENT-CHILD between sales unit nodes. Consists of SALES_UNIT_PARENT_ID, SALES_UNIT_CHILD_ID and VALID_TO_DTTM/VALID_FROM_DTTM. No association with any tables. The PK here is ..PARENT_ID, ..CHILD_ID and VALID_FROM_DTTM The actual query I've done was: select s.* from sales_unit s left join sales_unit_relation r on (s.sales_unit_id = r.sales_unit_child_id) where r.sales_unit_child_id is null select * from sales_unit s left join sales_unit_relation r on (s.sales_unit_id = r.sales_unit_child_id) where r.sales_unit_child_id is null Same query, both uses left join and only difference is with select.

    Read the article

  • .Net SQL Parameter for String List Problem

    - by JK
    I am writing a C# program in which I send a query to SQL Server to be processed and a dataset returns. I am using parameters to pass information to the query before it is sent to SQL server. This works fine except in the situation below. The query looks like this: reportQuery = " Select * From tableName Where Account_Number in (@AccountNum); and Account_Date = @AccountDate "; The AccountDate parameter works find but not the AccountNum parameter. I need the final query to execute like this: Select * From tableName Where Account_Number in ('AX3456','YZYL123','ZZZ123'); and Account_Date = '1-Jan-2010' The problem is that I have these account numbers (actually text) in a C# string list. To feed it to the parameter, I have been declaring the parameter as a string. I turn the list into one string and feed it to the parameter. I think the problem is that I am feeding the paramater this: "'AX3456','YZYL123','ZZZ123'" when it wants this 'AX3456','YZYL123','ZZZ123' How do I get the string list into the query using a parameter and have it execute as shown above? This is how I am declaring and assigning the parameter. SqlParameter AccountNumsParam = new SqlParameter(); AccountNumsParam.ParameterName = "@AccountNums"; AccountNumsParam.SqlDbType = SqlDbType.NVarChar; AccountNumsParam.Value = AccountNumsString; FYI, AccountNumString == "'AX3456','YZYL123','ZZZ123'"

    Read the article

  • Unable to parse variable length string separated by delimiter

    - by Technext
    Hi, I have a problem with parsing a string, which consists only of directory path. For ex. My input string is Abc\Program Files\sample\ My output should be Abc//Program Files//sample The script should work for input path of any length i.e., it can contain any no. of subdirectories. (For ex., abc\temp\sample\folder\joe) I have looked for help in many links but to no avail. Looks like FOR command extracts only one whole line or a string (when we use ‘token’ keyword in FOR syntax) but my problem is that I am not aware of the input path length and hence, the no. of tokens. My idea was to use \ as a delimiter and then extract each word before and after it (), and put the words to an output file along with // till we reach the end of the string. I tried implementing the following but it did not work: @echo off FOR /F "delims=\" %%x in (orig.txt) do ( IF NOT %%x == "" echo.%%x//output.txt ) The file orig.txt contains only one line i.e, Abc\Program Files\sample\ The output that I get contains only: Abc// The above output contains blank spaces as well after ‘Abc//’ My desired output should be: Abc//program Files//sample// Can anyone please help me with this? Regards, Technext

    Read the article

  • Passing.getText() String to another class

    - by DanMc
    I'm currently working on a first year university project and I have a problem, although I doubt it's a very complicated one, but I've been searching and I just can't find a suitable answer to it. The problem concerns two classes. A gui class (class1) and another class (class2). I have a JTextField in class1 and am trying to pass through the .getText() value to class2 and store it in a String type variable. The current code I'm trying to achieve this with is the following: (Class1) private JTextField textField = new JTextField("Something"); ... public String getTextFieldString() { return textField.getText(); } (Class2) private c1 Class1 = new Class1(); private String s = new String(); ... s = c1.getTextFieldString(); I'm pretty new to coding, I've read that maybe I need to pass through an argument somewhere and I assume that's because textField is not static in itself, it changes when somebody enters a new value. (sorry for stating the obvious there.) Anyway, help is appreciated. Thanks a lot!

    Read the article

  • String Index Out Of Bound Exception error

    - by Fd Fehfhd
    Im not really sure why a am getting this error. But here is my code it is meant to test palindromes disregarding punctuation. So here is my code import java.util.Scanner; public class PalindromeTester { public static void main(String [] args) { Scanner kb = new Scanner(System.in); String txt = ""; int left; int right; int cntr = 0; do { System.out.println("Enter a word, phrase, or sentence (blank line to stop):"); txt = kb.nextLine(); txt = txt.toLowerCase(); char yP; String noP = ""; for (int i = 0; i < txt.length(); i++) { yP = txt.charAt(i); if (Character.isLetterOrDigit(txt.charAt(yP))) { noP += yP; } } txt = noP; left = 0; right = txt.length() -1; while (txt.charAt(left) == txt.charAt(right) && right > left) { left++; right--; } if (left > right) { System.out.println("Palindrome"); cntr++; } else { System.out.println("Not a palindrome"); } } while (!txt.equals("")); System.out.println("You found " + cntr + " palindromes. Thank you for using palindromeTester."); } } And if i test it and then i put enter so it will tell me how many palindromes you found the error i am getting is javav.lang.StringIndexOutOfBoundException : String index out of range 0 at PalindromeTester.main(PalindromeTester.java:38) and line 28 is while (txt.charAt(left) == txt.charAt(right) && right > left) Thanks for the help in advance

    Read the article

  • NHibernate with string primary key and relationships

    - by John_
    I've have just been stumped with this problem for an hour and I annoyingly found the problem eventually. THE CIRCUMSTANCES I have a table which users a string as a primary key, this table has various many to one and many to many relationships all off this primary key. When searching for multiple items from the table all relationships were brought back. However whenever I tried to get the object by the primary key (string) it was not bringing back any relationships, they were always set to 0. THE PARTIAL SOLUTION So I looked into my logs to see what the SQL was doing and that was returning the correct results. So I tried various things in all sorts of random ways and eventually worked out it was. The case of the string being passed into the get method was not EXACTLY the same case as it was in the database, so when it tried to match up the relationship items with the main entity it was finding nothing (Or at least NHIbernate wasn't because as I stated above the SQL was actually returning the correct results) THE REAL SOLUTION Has anyone else come across this? If so how do you tell NHibernate to ignore case when matching SQL results to the entity? It is silly because it worked perfectly well before now all of a sudden it has started to pay attention to the case of the string.

    Read the article

  • Java - Counting how many characters show up in another string

    - by Vu Châu
    I am comparing two strings, in Java, to see how many characters from the first string show up in the second string. The following is some expectations: matchingChars("AC", "BA") ? 1 matchingChars("ABBA", "B") ? 2 matchingChars("B", "ABBA") ? 1 My approach is as follows: public int matchingChars(String str1, String str2) { int count = 0; for (int a = 0; a < str1.length(); a++) { for (int b = 0; b < str2.length(); b++) { char str1Char = str1.charAt(a); char str2Char = str2.charAt(b); if (str1Char == str2Char) { count++; str1 = str1.replace(str1Char, '0'); } } } return count; } I know my approach is not the best, but I think it should do it. However, for matchingChars("ABBA", "B") ? 2 My code yields "1" instead of "2". Does anyone have any suggestion or advice? Thank you very much.

    Read the article

  • Performance difference between functions and pattern matching in Mathematica

    - by Samsdram
    So Mathematica is different from other dialects of lisp because it blurs the lines between functions and macros. In Mathematica if a user wanted to write a mathematical function they would likely use pattern matching like f[x_]:= x*x instead of f=Function[{x},x*x] though both would return the same result when called with f[x]. My understanding is that the first approach is something equivalent to a lisp macro and in my experience is favored because of the more concise syntax. So I have two questions, is there a performance difference between executing functions versus the pattern matching/macro approach? Though part of me wouldn't be surprised if functions were actually transformed into some version of macros to allow features like Listable to be implemented. The reason I care about this question is because of the recent set of questions (1) (2) about trying to catch Mathematica errors in large programs. If most of the computations were defined in terms of Functions, it seems to me that keeping track of the order of evaluation and where the error originated would be easier than trying to catch the error after the input has been rewritten by the successive application of macros/patterns.

    Read the article

< Previous Page | 121 122 123 124 125 126 127 128 129 130 131 132  | Next Page >