Search Results

Search found 9254 results on 371 pages for 'approach'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 128/371 | < Previous Page | 124 125 126 127 128 129 130 131 132 133 134 135  | Next Page >

  • Image upload storage strategies

    - by MatW
    When a user uploads an image to my site, the image goes through this process; user uploads pic store pic metadata in db, giving the image a unique id async image processing (thumbnail creation, cropping, etc) all images are stored in the same uploads folder So far the site is pretty small, and there are only ~200,000 images in the uploads directory. I realise I'm nowhere near the physical limit of files within a directory, but this approach clearly won't scale, so I was wondering if anyone had any advice on upload / storage strategies for handling large volumes of image uploads.

    Read the article

  • MSBuild CreateItem condition include based on config file

    - by Mac
    I'm trying to select a list of test dlls that contain corresponding config files MyTest.Tests.dll MyTest.Tests.config I have to use a createItem as the dlls are not available at the time of the script loading <CreateItem Include="$(AssemblyFolder)\*.Tests.dll" Condition="???" <Output TaskParameter="Include" ItemName="TestBinariesWithConfig"/> </CreateItem> Is there a condition I can use or is this the wrong approach? Thanks Mac

    Read the article

  • similar to __asm int 3 in Max OS X/ Xcode?

    - by Mark
    Hi, When using visual studio to develop c++ applications, I used to write _asm int 3; and then build the application. When the application is executed, if the code path that has "_asm int 3" is encountered Visual Studio Debugger used to get lauched and I could debug the problems. Is there any similar approach when developing using Xcode on Mac OS X? Thanks a lot. Mark

    Read the article

  • How to make disconnected closed curves connected by adding a shortest path using MATLAB?

    - by user198729
    bwlabel can be used to get disconnected objects in an image: [L Ne] = bwlabel(image); I want to make the objects(But my target is only the contours(closed curve) of these objects) connected by adding a shortest path where necessary. How do I approach this? UPDATE Or how to dilate the closed curves so that they get connected? How to calculate the shortest path between two disconnected closed curves?

    Read the article

  • Handling multiple HTTP requests from one source (e.g.a hacker)

    - by Haraldo
    Hi there, I have a script to handle http requests. I'm trying to think of some of the security issues I might have with it. My biggest concern at the moment is how I can manage multiple requests from the same source over and over. For instance someone trying to shut down my system. Do I need to be concerned or will Apache handling this issue. If not what is the best approach to take using php? Thanks,

    Read the article

  • url optimization in rails?

    - by piemesons
    Hello I want to create seo optimize url in rails.Same like done in stackoverflow. Right now this is my url http://localhost:3000/questions/56 I want to make it something like this:- http://localhost:3000/questions/56/this-is-my-optimized-url i am using restful approach. is there any plug-in available for this.

    Read the article

  • MySQL & PHP: auto connect to DB or to properly way to pass host/db to MySQL methods

    - by SODA
    Hi, does anyone know of a known method in PHP to auto connect to MySQL db/table in case an app is using multiple databases on multiple hosts? Question 1: are there scripts around that allow to auto connect to necessary host/DB based on query? Question 2: if above is not possible, is there a known approach to properly passing host/DB info to make sure app is properly connected before executing the query?

    Read the article

  • JAVA SDK Modifying Table Column

    - by tathamr
    I have the ReportBlock from the type VTable that I am modifying. I am able to get the horizonatal block axis to modify the cells but, I cannot seem to modify the column header (different object). I started to look into trying to get back a smalltable but, I am not confident in this approach. Any idea?

    Read the article

  • Checking for duplicates in a vector

    - by xbonez
    I have to check a vector for duplicates. What is the best way to approach this: I take the first element, compare it against all other elements in the vector. Then take the next element and do the same and so on. Is this the best way to do it, or is there a more efficient way to check for dups?

    Read the article

  • C++ game designing & polymorphism question

    - by Kotti
    Hi! I'm trying to implement some sort of 'just-for-me' game engine and the problem's plot goes the following way: Suppose I have some abstract interface for a renderable entity, e.g. IRenderable. And it's declared the following way: interface IRenderable { // (...) // Suppose that Backend is some abstract backend used // for rendering, and it's implementation is not important virtual void Render(Backend& backend) = 0; }; What I'm doing right now is something like declaring different classes like class Ball : public IRenderable { virtual void Render(Backend& backend) { // Rendering implementation, that is specific for // the Ball object // (...) } }; And then everything looks fine. I can easily do something like std::vector<IRenderable*> items, push some items like new Ball() in this vector and then make a call similiar to foreach (IRenderable* in items) { item->Render(backend); } Ok, I guess it is the 'polymorphic' way, but what if I want to have different types of objects in my game and an ability to manipulate their state, where every object can be manipulated via it's own interface? I could do something like struct GameState { Ball ball; Bonus bonus; // (...) }; and then easily change objects state via their own methods, like ball.Move(...) or bonus.Activate(...), where Move(...) is specific for only Ball and Activate(...) - for only Bonus instances. But in this case I lose the opportunity to write foreach IRenderable* simply because I store these balls and bonuses as instances of their derived, not base classes. And in this case the rendering procedure turns into a mess like ball.Render(backend); bonus.Render(backend); // (...) and it is bad because we actually lose our polymorphism this way (no actual need for making Render function virtual, etc. The other approach means invoking downcasting via dynamic_cast or something with typeid to determine the type of object you want to manipulate and this looks even worse to me and this also breaks this 'polymorphic' idea. So, my question is - is there some kind of (probably) alternative approach to what I want to do or can my current pattern be somehow modified so that I would actually store IRenderable* for my game objects (so that I can invoke virtual Render method on each of them) while preserving the ability to easily change the state of these objects? Maybe I'm doing something absolutely wrong from the beginning, if so, please point it out :) Thanks in advance!

    Read the article

  • matlab and gplot

    - by JPC
    Hi, Im trying to find a way to plot a truss in matlab, i can do it by using an adjacancy matrix and the gplot function, but its very long winded approach especially if there are a lot of nodes connected to one another. Is there a faster way to do this? I'm new to matlab and the programming world any help would be really appreciated. JC

    Read the article

  • Custom search engine in asp.net mvc and entity framework

    - by Rahat
    Hi, does anyone have any idea how I can get started building a search engine for my asp.net mvc site using entity framework. I plan to build something like: http://www.carsguide.com.au/search/?N=4294962119++492&type=cars there on the left there is a refine search option panel. What's the best approach to design a model for the UI and optimized query with entity framework.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Can an algorithmic process ever give true random numbers ?

    - by Arkapravo
    I have worked with random functions in python,ruby, MATLAB, Bash and Java. Nearly every programming language has a function to generate Random numbers. However, these apparently random sequences are termed as pseudo-random number sequences as the generation follows a deterministic approach, and the sequence seems to repeat (usually with a very large period). My question, can an algorithmic/programming process ever yield true random numbers ? The questions probably is more of theoretical computer science than just programming !

    Read the article

  • How to use another type of EditingControl in a single C# 3.5 DataGridView column ?

    - by too
    Is this possible to have two (or more) different kinds of cells to be displayed interchangeably in single column of C# .Net 3.5 DataGridView? I know one column has specified single EditingControl type, yet I think grid is flexible enough to do some tricks, I may think of only: Adding as many invisible columns to grid as required types of cells and on CellBeginEdit somehow exchange current cell with other column's cell Create custom column and custom cell with possibility of changing EditingControl for single cell Which approach is better, are there any examples ?

    Read the article

  • How to RESTful delete record Asp.Net Mvc 2

    - by Picflight
    I have delete links in my Asp.Net Mvc2 application. /{controller}/Delete/{id} It seems using link to delete has a security risk. Don’t use Delete Links because they create Security Holes I found this Implementing RESTful Routes & Controllers in ASP.NET MVC 2.0 but I am not sure how to implement a simple delete functionality using the new HttpDeleteAttribute class. Are there any examples on deleting, the RESTful approach?

    Read the article

  • Replace between 2 items in observableArray - knockout

    - by Yojik
    im tring to Replace between 2 items in observableArray with knockout but something is wrong.. after the replace of the items ,i will change and send the displayOrder property (in both itmems) to the server (or should i take other approach for this) rankDownMessage: function () { console.log("ranking down msg"); var currentItemindex = viewModel.messages.indexOf(this); var nextItemIndex = currentItemindex + 1; viewModel.messages.replace( viewModel.messages()[nextItemIndex], viewModel.messages()[currentItemindex] ); } only the first item changed to the second item but the second item doesnt become the first one

    Read the article

  • How to cutomize a modelform widget in django 1.1?

    - by muudscope
    I'm trying to modify a django form to use a textarea instead of a normal input for the "address" field in my house form. The docs seem to imply this changed from django 1.1 (which I'm using) to 1.2. But neither approach is working for me. Here's what I've tried: class HouseForm(forms.ModelForm): address = forms.Textarea() # Should work with django 1.1, but doesn't class Meta: model = House #widgets = { 'address': forms.Textarea() } # 1.2 style - doesn't work either.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 124 125 126 127 128 129 130 131 132 133 134 135  | Next Page >