Search Results

Search found 9254 results on 371 pages for 'approach'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 128/371 | < Previous Page | 124 125 126 127 128 129 130 131 132 133 134 135  | Next Page >

  • 21 CFR part 11 validation for SAAS

    - by javydreamercsw
    In a FDA regulated environment applications need to be validated. I've done that tons of times in my career but now I'm facing SAAS. Has anyone out there faced this before? Any FDA related guideline on this scheme? Besides some black box approach and much support from the provider I see this as hard to do.

    Read the article

  • Can an algorithmic process ever give true random numbers ?

    - by Arkapravo
    I have worked with random functions in python,ruby, MATLAB, Bash and Java. Nearly every programming language has a function to generate Random numbers. However, these apparently random sequences are termed as pseudo-random number sequences as the generation follows a deterministic approach, and the sequence seems to repeat (usually with a very large period). My question, can an algorithmic/programming process ever yield true random numbers ? The questions probably is more of theoretical computer science than just programming !

    Read the article

  • C++ game designing & polymorphism question

    - by Kotti
    Hi! I'm trying to implement some sort of 'just-for-me' game engine and the problem's plot goes the following way: Suppose I have some abstract interface for a renderable entity, e.g. IRenderable. And it's declared the following way: interface IRenderable { // (...) // Suppose that Backend is some abstract backend used // for rendering, and it's implementation is not important virtual void Render(Backend& backend) = 0; }; What I'm doing right now is something like declaring different classes like class Ball : public IRenderable { virtual void Render(Backend& backend) { // Rendering implementation, that is specific for // the Ball object // (...) } }; And then everything looks fine. I can easily do something like std::vector<IRenderable*> items, push some items like new Ball() in this vector and then make a call similiar to foreach (IRenderable* in items) { item->Render(backend); } Ok, I guess it is the 'polymorphic' way, but what if I want to have different types of objects in my game and an ability to manipulate their state, where every object can be manipulated via it's own interface? I could do something like struct GameState { Ball ball; Bonus bonus; // (...) }; and then easily change objects state via their own methods, like ball.Move(...) or bonus.Activate(...), where Move(...) is specific for only Ball and Activate(...) - for only Bonus instances. But in this case I lose the opportunity to write foreach IRenderable* simply because I store these balls and bonuses as instances of their derived, not base classes. And in this case the rendering procedure turns into a mess like ball.Render(backend); bonus.Render(backend); // (...) and it is bad because we actually lose our polymorphism this way (no actual need for making Render function virtual, etc. The other approach means invoking downcasting via dynamic_cast or something with typeid to determine the type of object you want to manipulate and this looks even worse to me and this also breaks this 'polymorphic' idea. So, my question is - is there some kind of (probably) alternative approach to what I want to do or can my current pattern be somehow modified so that I would actually store IRenderable* for my game objects (so that I can invoke virtual Render method on each of them) while preserving the ability to easily change the state of these objects? Maybe I'm doing something absolutely wrong from the beginning, if so, please point it out :) Thanks in advance!

    Read the article

  • Download and Archive Web Pages on the iPhone

    - by Stefan
    Hi, how do I download and archive full web pages (HTML, CSS, JS, images) on the iPhone? I know how to download the single files. But is there any existing approach to get all files (e.g. all included javascripts), which are linked with a particular web page?

    Read the article

  • matlab and gplot

    - by JPC
    Hi, Im trying to find a way to plot a truss in matlab, i can do it by using an adjacancy matrix and the gplot function, but its very long winded approach especially if there are a lot of nodes connected to one another. Is there a faster way to do this? I'm new to matlab and the programming world any help would be really appreciated. JC

    Read the article

  • Designing Business Objects to indicate constraints such as Max Length

    - by JR
    Is there a standard convention when designing business objects for providing consumers with a way to discover constraints such as a property's maximum length? It could be used up in the UI layer to, for example, set a Textbox's MaxLength property according to the maximum length limit back in the business object. Is there a standard design approach for this?

    Read the article

  • Handling multiple HTTP requests from one source (e.g.a hacker)

    - by Haraldo
    Hi there, I have a script to handle http requests. I'm trying to think of some of the security issues I might have with it. My biggest concern at the moment is how I can manage multiple requests from the same source over and over. For instance someone trying to shut down my system. Do I need to be concerned or will Apache handling this issue. If not what is the best approach to take using php? Thanks,

    Read the article

  • Any way to make dialogs appear/disappear with a transition in MFC?

    - by John
    For instance I have a main dialog, when I click a button a smaller dialog appears next to it. But it would be neat if the small one could somehow transition in, rather than simply appear. For instance using transparency, or zooming in, or sliding in from width=0 - full-width. Making an actual dialog do such things isn't too hard, but what about the controls within it? How might we approach this in a way that is reusable on different dialogs?

    Read the article

  • Archiving sharepoint site instade of deleting

    - by Sachin
    Hi All, I have a sharepoint site. This site large nubmer of site and sub site sollection in it. There are few that are created and are not in use. Now my questuion is how can I findout these old sites and before going deleting I have to first archive it. Can any one tell me what is the best possible approach to do it?

    Read the article

  • Updating a TextView with a SeekBar's value (ultra-slow)

    - by Peter Bjorn
    Now look at that! I am having trouble with one of the simplest goals: updating a plain TextView with the value of a SeekBar. This is my approach: @Override public void onProgressChanged(SeekBar seekBar, int progress, boolean fromUser) { if (fromUser) { mInfoText.setText(mFunction.getUserFriendlyString(progress)); } } It basically works, but it kind of blocks the whole UI when I'm dragging. (Note: I tried both View.post() and Activity.runOnUiThread()). Am I overlooking something?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • sed - trying to replace first occurrence after a match

    - by wakkaluba
    I am facing a situation that drives me nuts. I am setting up an update server which uses a json file. Don't ask why or how, it sucks and is my only possibility to achieve it. I have been trying and researching for HOURS (many) because I went ballistic and wanted to crack this on my own. But I have to realize I got stuck and need help. So sorry for this chunk but I think it is somewhat important to see... The file is a one liner and repeating the following sequence with changing values (of course). "plugin_name_foo_bar": {"buildDate": "bla", "dependencies": [{"name": "bla", "optional": true, "version": "1.00"}], "developers": [{"developerId": "bla", "email": "[email protected]", "name": "Bla bla2nd"}], "excerpt": "some text {excerpt} !bla.png|thumbnail,border=1! ", "gav": "bla", "labels": ["report", "scm-related"], "name": "plugin_name_foo_bar", "previousTimestamp": "bla", "previousVersion": "1.0", "releaseTimestamp": "bla", "requiredCore": "1", "scm": "github.com", "sha1": "ynnBM2jWo25ZLDdP3ybBOnV/Pio=", "title": "bla", "url": "http://bla.org", "version": "1.0", "wiki": "https://bla.org"}, "Exclusion": {"buildDate": "bla", "dependencies": [], and the next plugin block is glued straight afterwards. What I now want to do is to search for "plugin_foo_bar": {" as this is the unique identifier for a new plugin description block. I want to replace the first sha1 value occuring afterwards. That's where I keep failing. I always grab the first,last or any occurrence in the entire file and not the block :( "title" is the unique identifier after the sha1 value. So I tried to make the .* less greedy but it ain't working out. last attempt was heading towards: sed -i 's/("name": "plugin_name_foo_bar.*sha1": ")([a-zA-Z0-9!@#\$%^&*()\[\]]*)(", "title"\)/\1blablabla\2/1' default.json to find the sha1 value of that plugin but still no joy. I hope someone knows - preferably a simpler approach - before I now continue with trial and error until I have to puke and freakout. I am working with SED on Windows, so Unix approach might help me to figure out how to achieve this in batch but please make it as one-liner if possible. Scripts are a real pain to convert. And I just need SED and no other solution with other tools like AWK. That is absolutely out of discussion. Any help is appreciated :) Cheers Jan

    Read the article

  • Including Build Date strings in a C# project

    - by David Rutten
    I'd like to hard code the build date into my application (DD-mmmm-YYYY), but how do I embed this constant into the code? I thought perhaps I could make a pre-build event that executes a *.bat file that updates a textfile which is resourced, but it sounds pretty involved. What's the best approach?

    Read the article

  • JAVA SDK Modifying Table Column

    - by tathamr
    I have the ReportBlock from the type VTable that I am modifying. I am able to get the horizonatal block axis to modify the cells but, I cannot seem to modify the column header (different object). I started to look into trying to get back a smalltable but, I am not confident in this approach. Any idea?

    Read the article

  • What is a good way of Enhancing contrast of color images?

    - by erjik
    I split color image for 3 channels and made a contrast enhancement of each channel. Then merged them together, I like the image at the result, but it has different colors. Black objects became yellow and so on... EDIT: The algorithm I used is to calculate the 5th percentile and the 95th percentile as min and max values, and then expand the values of image so that it will have min and max values as 0 and 255. If there is a better approach please tell me.

    Read the article

  • How to cutomize a modelform widget in django 1.1?

    - by muudscope
    I'm trying to modify a django form to use a textarea instead of a normal input for the "address" field in my house form. The docs seem to imply this changed from django 1.1 (which I'm using) to 1.2. But neither approach is working for me. Here's what I've tried: class HouseForm(forms.ModelForm): address = forms.Textarea() # Should work with django 1.1, but doesn't class Meta: model = House #widgets = { 'address': forms.Textarea() } # 1.2 style - doesn't work either.

    Read the article

  • Grails query not using GORM

    - by Tihom
    What is the best way to query for something without using GORM in grails? I have query that doesn't seem to fit in the GORM model, the query has a subquery and a computed field. I posted on stackoverflow already with no response so I decided to take a different approach. I want to query for something not using GORM within a grails application. Is there an easy way to get the connection and go through the result set?

    Read the article

  • url optimization in rails?

    - by piemesons
    Hello I want to create seo optimize url in rails.Same like done in stackoverflow. Right now this is my url http://localhost:3000/questions/56 I want to make it something like this:- http://localhost:3000/questions/56/this-is-my-optimized-url i am using restful approach. is there any plug-in available for this.

    Read the article

  • Image upload storage strategies

    - by MatW
    When a user uploads an image to my site, the image goes through this process; user uploads pic store pic metadata in db, giving the image a unique id async image processing (thumbnail creation, cropping, etc) all images are stored in the same uploads folder So far the site is pretty small, and there are only ~200,000 images in the uploads directory. I realise I'm nowhere near the physical limit of files within a directory, but this approach clearly won't scale, so I was wondering if anyone had any advice on upload / storage strategies for handling large volumes of image uploads.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 124 125 126 127 128 129 130 131 132 133 134 135  | Next Page >