Search Results

Search found 35976 results on 1440 pages for 'js test driver'.

Page 130/1440 | < Previous Page | 126 127 128 129 130 131 132 133 134 135 136 137  | Next Page >

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • require.js - How can I set a version on required modules as part of the URL?

    - by Ovesh
    I am using require.js to require JS modules in my application. I need a way to bust client cache on new JS modules, by way of a different requested URL. i.e., if the file hello/there.js has already been cached on the client, I can change the file name to force the browser to get the new file. In other words, for the module hello/there, I'd like require.js to request the url hello/there___v1234___.js (the file name can look different, it's just an example), according to a version string which is accessible on the client. What is the best way to achieve that?

    Read the article

  • I want to style within JS

    - by 422
    Issue I have is I can use tags, but I would like to style particular words. Adding a class doesnt work, is it because I am within script dom ? Example: var config = [ { "name" : "tour_1", "bgcolor" : "black", "color" : "white", "position" : "BR", "text" : "Customize your user profile, it's easy. This is your shop window on <strong>here</strong> and <strong>there</strong>", "time" : 4000 } Instead of strong, I would like to apply class, like <p class="orange"> But it wont have it, any suggestions... please

    Read the article

  • With JS add default date on TextBox

    - by senzacionale
    <asp:TextBox ID="txtDate" runat="server" AutoPostBack="true" OnTextChanged="txtDate_TextChanged"></asp:TextBox> how can with Jquery add default date. I do not know where and when to call this code: function addDefaultDate() { if ($('#txtDate').val().length == 0) { var now = new Date(); $('#txtDate').text(now.getDate() + '.' + now.getMonth() + '.' + now.getYear()); } }

    Read the article

  • MooTools is not a function js error

    - by Adriane
    hello whatever i append to $('click_filter1') it shows the error ... is not a function (for show(), hide(), toggle()) if i insert an alert, the alert gets executed, so the framework is init ok the element with the id exists for sure what can be the problem of this? why iam getting this error? $('click_filter1').addEvent('click', function() { $('click_filter1').show(); }.bind(this));

    Read the article

  • Is it easy to develop a simple Firefox plugin (JS injection)

    - by Moons
    Hello everyone! So I was just wondering if it was easy to develop a very simple Firefox plugin where you could click a button, and it would execute some Javascript code! Please note that I have never developed any kind of plugin for firefox, I just want to know if that is an easy task to do (like less than an hour)

    Read the article

  • trying to understand some codes related to window.onload in js

    - by user2507818
    <body> <script language="javascript"> window.tdiff = []; fred = function(a,b){return a-b;}; window.onload = function(e){ console.log("window.onload", e, Date.now() ,window.tdiff, (window.tdiff[1] = Date.now()) && window.tdiff.reduce(fred) ); } </script> </body> Above code is taken from a site. In firefox-console, it shows: window.onload load 1372646227664 [undefined, 1372646227664] 1372646227664 Question: For window.tdiff->[undefined, 1372646227664], why not:[], because when runs to code:window.tdiff, it is still an empty array? For window.tdiff.reduce(fred)->1372646227664, window.tdiff = [undefined, 1372646227664], undefined - 1372646227664, should be NaN, why it shows 1372646227664?

    Read the article

  • Hide / show content via CSS:hover (or JS if need be)

    - by Chris
    I have the following html: <li> <span class="one">Stuff here</span> <span class="two">More stuff</span> </li> .one { display: block; } .two { display: none; } What is the easiest method, preferably CSS only, to hide one and show two when the mouse rolls over the <li> container. If this cannot be done via CSS and only Javascript, I would prefer jQuery via something like live() as the content is updated live and do not wish to constantly rebind manually. EDIT: I forgot to mention that this has to work in IE6 :/

    Read the article

  • How can I get the Forever to write to a different log file every day?

    - by user1438940
    I have a cluster of production servers running a Node.JS app via Forever. As far as I can tell, my options for log files are as follows: Let Forever do it on its own, in which case it will log to ~/.forever/XXXX.log Specify one specific log file for the entire life of the process What I'd like to do, however, is have it log to a different file every day. eg. 20121027.log, 20121028.log, etc. Is this possible? If so, how can it be done?

    Read the article

  • Drivers for NVIDIA 520M not working in Ubuntu 12.04

    - by Don
    I am aware that this is nominally a duplicate question, however I've read the other questions and haven't been able to resolve my problem after many hours and attempts, so please don't delete it. Additionally, it seems like many answers to the other questions are specifically dependent on certain situations. My situation being different from the others I found represented, here's my question. Until last night, I had Ubuntu 12.04 installed with Wubi, and it ran ok, though slowly and with occasional hangs. So I partitioned the drive and installed 12.04 in its own partition. Now when I start it, I am stuck using 2D. I believe this is an NVIDIA bug. My NVIDIA card is a GT 520M and my machine has Optimus. Additional Drivers only displays my wireless driver. Going to System Settings Details Graphics shows Driver:Unknown, Experience:Standard. I downloaded the driver from the NVIDIA website, and ran the installer with no errors, except that the "distribution-provided pre-install script failed". After rebooting, my screen was stuck at 640X480, which was fixed by editing /etc/X11/xorg.conf However, I still was stuck in 2D, and nothing else had changed either. A thread suggested something called Bumblebee. I tried that, and when I ran optirun firefoxI got a frozen blank screen. Following another suggestion, I checked the BIOS to try and disable Optimus. I found and ran myriad other commands to try and fix the problem and nothing changed. Now I have just done a clean re-install of Ubuntu. From there, I: Installed all the updates Downloaded the NVIDIA driver Installed it Got screen stuck at 640X480, fixed in xorg.conf. To recap the problem: I can't get the NVIDIA drivers working I am stuck using 2D I'm an idiot I think if the first one is solved, the solution to the second will naturally follow. If you need me to provide any other information, I'd be happy to. From what I've seen in other threads, I think this information may help: lsmod: dh@donsMachine:~$ lsmod Module Size Used by nvidia 12353161 0 snd_hda_codec_hdmi 32474 1 snd_hda_codec_realtek 223867 1 joydev 17693 0 parport_pc 32866 0 ppdev 17113 0 rfcomm 47604 0 bnep 18281 2 bluetooth 180104 10 rfcomm,bnep snd_hda_intel 33773 3 snd_hda_codec 127706 3 snd_hda_codec_hdmi,snd_hda_codec_realtek,snd_hda_intel snd_hwdep 13668 1 snd_hda_codec snd_pcm 97188 3 snd_hda_codec_hdmi,snd_hda_intel,snd_hda_codec uvcvideo 72627 0 videodev 98259 1 uvcvideo v4l2_compat_ioctl32 17128 1 videodev snd_seq_midi 13324 0 snd_rawmidi 30748 1 snd_seq_midi snd_seq_midi_event 14899 1 snd_seq_midi snd_seq 61896 2 snd_seq_midi,snd_seq_midi_event lib80211_crypt_tkip 17390 0 wl 2568210 0 lib80211 14381 2 lib80211_crypt_tkip,wl snd_timer 29990 2 snd_pcm,snd_seq snd_seq_device 14540 3 snd_seq_midi,snd_rawmidi,snd_seq snd 78855 16 snd_hda_codec_hdmi,snd_hda_codec_realtek,snd_hda_intel,snd_hda_codec,snd_hwdep,snd_pcm,snd_rawmidi,snd_seq,snd_timer,snd_seq_device psmouse 87692 0 serio_raw 13211 0 i915 468745 2 soundcore 15091 1 snd snd_page_alloc 18529 2 snd_hda_intel,snd_pcm drm_kms_helper 46978 1 i915 drm 242038 3 i915,drm_kms_helper mei 41616 0 i2c_algo_bit 13423 1 i915 mxm_wmi 12979 0 acer_wmi 28418 0 sparse_keymap 13890 1 acer_wmi video 19596 1 i915 wmi 19256 2 mxm_wmi,acer_wmi mac_hid 13253 0 lp 17799 0 parport 46562 3 parport_pc,ppdev,lp tg3 152032 0 sdhci_pci 18826 0 sdhci 33205 1 sdhci_pci lspci -nn | grep VGA dh@donsMachine:~$ lspci -nn | grep VGA 00:02.0 VGA compatible controller [0300]: Intel Corporation 2nd Generation Core Processor Family Integrated Graphics Controller [8086:0116] (rev 09) 01:00.0 VGA compatible controller [0300]: NVIDIA Corporation Device [10de:0df7] (rev a1) lshw dh@donsMachine:~$ sudo lshw [sudo] password for dh: donsmachine description: Notebook product: EasyNote TS44HR () vendor: Packard Bell version: V1.12 serial: LXBWZ02017134209D71601 width: 64 bits capabilities: smbios-2.7 dmi-2.7 vsyscall32 configuration: boot=normal chassis=notebook uuid=16FE576B-CA15-11E0-B096-B870F4E51243 *-core description: Motherboard product: SJV50_HR vendor: Packard Bell physical id: 0 version: Base Board Version serial: Base Board Serial Number slot: Base Board Chassis Location *-firmware description: BIOS vendor: Packard Bell physical id: 0 version: V1.12 date: 07/11/2011 size: 1MiB capacity: 2496KiB capabilities: pci upgrade shadowing cdboot bootselect edd int13floppynec int13floppytoshiba int13floppy360 int13floppy1200 int13floppy720 int13floppy2880 int9keyboard int10video acpi usb biosbootspecification *-memory description: System Memory physical id: 1b slot: System board or motherboard size: 4GiB *-bank:0 description: SODIMM DDR3 Synchronous 1333 MHz (0.8 ns) product: NT2GC64B88B0NS-CG vendor: Nanya Technology physical id: 0 serial: 598E126E slot: ChannelA-DIMM0 size: 2GiB width: 64 bits clock: 1333MHz (0.8ns) *-bank:1 description: DIMM [empty] physical id: 1 slot: ChannelA-DIMM1 *-bank:2 description: SODIMM DDR3 Synchronous 1333 MHz (0.8 ns) product: NT2GC64B88B0NS-CG vendor: Nanya Technology physical id: 2 serial: 159E126C slot: ChannelB-DIMM0 size: 2GiB width: 64 bits clock: 1333MHz (0.8ns) *-bank:3 description: DIMM [empty] physical id: 3 slot: ChannelB-DIMM1 *-cpu description: CPU product: Intel(R) Core(TM) i3-2330M CPU @ 2.20GHz vendor: Intel Corp. physical id: 2e bus info: cpu@0 version: Intel(R) Core(TM) i3-2330M CPU @ 2.20GHz slot: CPU1 size: 2GHz capacity: 4GHz width: 64 bits clock: 1333MHz capabilities: x86-64 fpu fpu_exception wp vme de pse tsc msr pae mce cx8 apic sep mtrr pge mca cmov pat pse36 clflush dts acpi mmx fxsr sse sse2 ss ht tm pbe syscall nx rdtscp constant_tsc arch_perfmon pebs bts rep_good nopl xtopology nonstop_tsc aperfmperf pni pclmulqdq dtes64 monitor ds_cpl vmx est tm2 ssse3 cx16 xtpr pdcm pcid sse4_1 sse4_2 x2apic popcnt tsc_deadline_timer xsave avx lahf_lm arat epb xsaveopt pln pts tpr_shadow vnmi flexpriority ept vpid cpufreq configuration: cores=2 enabledcores=2 threads=4 *-cache:0 description: L1 cache physical id: 30 slot: L1 Cache size: 32KiB capacity: 32KiB capabilities: synchronous internal write-through instruction *-cache:1 description: L2 cache physical id: 31 slot: L2 Cache size: 256KiB capacity: 256KiB capabilities: synchronous internal write-through unified *-cache:2 description: L3 cache physical id: 32 slot: L3 Cache size: 3MiB capacity: 3MiB capabilities: synchronous internal write-through unified *-cache description: L1 cache physical id: 2f slot: L1 Cache size: 32KiB capacity: 32KiB capabilities: synchronous internal write-through data *-pci description: Host bridge product: 2nd Generation Core Processor Family DRAM Controller vendor: Intel Corporation physical id: 100 bus info: pci@0000:00:00.0 version: 09 width: 32 bits clock: 33MHz configuration: driver=agpgart-intel resources: irq:0 *-pci:0 description: PCI bridge product: Xeon E3-1200/2nd Generation Core Processor Family PCI Express Root Port vendor: Intel Corporation physical id: 1 bus info: pci@0000:00:01.0 version: 09 width: 32 bits clock: 33MHz capabilities: pci pm msi pciexpress normal_decode bus_master cap_list configuration: driver=pcieport resources: irq:40 ioport:2000(size=4096) memory:d0000000-d10fffff ioport:a0000000(size=301989888) *-display description: VGA compatible controller product: NVIDIA Corporation vendor: NVIDIA Corporation physical id: 0 bus info: pci@0000:01:00.0 version: a1 width: 64 bits clock: 33MHz capabilities: pm msi pciexpress vga_controller bus_master cap_list rom configuration: driver=nvidia latency=0 resources: irq:16 memory:d0000000-d0ffffff memory:a0000000-afffffff memory:b0000000-b1ffffff ioport:2000(size=128) memory:d1000000-d107ffff *-display description: VGA compatible controller product: 2nd Generation Core Processor Family Integrated Graphics Controller vendor: Intel Corporation physical id: 2 bus info: pci@0000:00:02.0 version: 09 width: 64 bits clock: 33MHz capabilities: msi pm vga_controller bus_master cap_list rom configuration: driver=i915 latency=0 resources: irq:43 memory:d1400000-d17fffff memory:c0000000-cfffffff ioport:3000(size=64) *-communication description: Communication controller product: 6 Series/C200 Series Chipset Family MEI Controller #1 vendor: Intel Corporation physical id: 16 bus info: pci@0000:00:16.0 version: 04 width: 64 bits clock: 33MHz capabilities: pm msi bus_master cap_list configuration: driver=mei latency=0 resources: irq:42 memory:d1a04000-d1a0400f *-usb:0 description: USB controller product: 6 Series/C200 Series Chipset Family USB Enhanced Host Controller #2 vendor: Intel Corporation physical id: 1a bus info: pci@0000:00:1a.0 version: 04 width: 32 bits clock: 33MHz capabilities: pm debug ehci bus_master cap_list configuration: driver=ehci_hcd latency=0 resources: irq:16 memory:d1a0a000-d1a0a3ff *-multimedia description: Audio device product: 6 Series/C200 Series Chipset Family High Definition Audio Controller vendor: Intel Corporation physical id: 1b bus info: pci@0000:00:1b.0 version: 04 width: 64 bits clock: 33MHz capabilities: pm msi pciexpress bus_master cap_list configuration: driver=snd_hda_intel latency=0 resources: irq:44 memory:d1a00000-d1a03fff *-pci:1 description: PCI bridge product: 6 Series/C200 Series Chipset Family PCI Express Root Port 1 vendor: Intel Corporation physical id: 1c bus info: pci@0000:00:1c.0 version: b4 width: 32 bits clock: 33MHz capabilities: pci pciexpress msi pm normal_decode bus_master cap_list configuration: driver=pcieport resources: irq:17 memory:9fb00000-9fbfffff ioport:d1800000(size=1048576) *-network description: Ethernet interface product: NetLink BCM57785 Gigabit Ethernet PCIe vendor: Broadcom Corporation physical id: 0 bus info: pci@0000:02:00.0 logical name: eth0 version: 10 serial: b8:70:f4:e5:12:43 capacity: 1Gbit/s width: 64 bits clock: 33MHz capabilities: pm msi msix pciexpress bus_master cap_list rom ethernet physical tp 10bt 10bt-fd 100bt 100bt-fd 1000bt 1000bt-fd autonegotiation configuration: autonegotiation=on broadcast=yes driver=tg3 driverversion=3.121 firmware=sb latency=0 link=no multicast=yes port=twisted pair resources: irq:16 memory:d1830000-d183ffff memory:d1840000-d184ffff memory:d1850000-d18507ff *-generic:0 description: SD Host controller product: NetXtreme BCM57765 Memory Card Reader vendor: Broadcom Corporation physical id: 0.1 bus info: pci@0000:02:00.1 version: 10 width: 64 bits clock: 33MHz capabilities: pm msi pciexpress bus_master cap_list configuration: driver=sdhci-pci latency=0 resources: irq:17 memory:d1800000-d180ffff *-generic:1 UNCLAIMED description: System peripheral product: Broadcom Corporation vendor: Broadcom Corporation physical id: 0.2 bus info: pci@0000:02:00.2 version: 10 width: 64 bits clock: 33MHz capabilities: pm msi pciexpress bus_master cap_list configuration: latency=0 resources: memory:d1810000-d181ffff *-generic:2 UNCLAIMED description: System peripheral product: Broadcom Corporation vendor: Broadcom Corporation physical id: 0.3 bus info: pci@0000:02:00.3 version: 10 width: 64 bits clock: 33MHz capabilities: pm msi pciexpress bus_master cap_list configuration: latency=0 resources: memory:d1820000-d182ffff *-pci:2 description: PCI bridge product: 6 Series/C200 Series Chipset Family PCI Express Root Port 2 vendor: Intel Corporation physical id: 1c.1 bus info: pci@0000:00:1c.1 version: b4 width: 32 bits clock: 33MHz capabilities: pci pciexpress msi pm normal_decode bus_master cap_list configuration: driver=pcieport resources: irq:16 memory:d1900000-d19fffff *-network description: Wireless interface product: BCM43225 802.11b/g/n vendor: Broadcom Corporation physical id: 0 bus info: pci@0000:03:00.0 logical name: eth1 version: 01 serial: 68:a3:c4:44:81:96 width: 64 bits clock: 33MHz capabilities: pm msi pciexpress bus_master cap_list ethernet physical wireless configuration: broadcast=yes driver=wl0 driverversion=5.100.82.38 ip=192.168.0.12 latency=0 multicast=yes wireless=IEEE 802.11bgn resources: irq:17 memory:d1900000-d1903fff *-usb:1 description: USB controller product: 6 Series/C200 Series Chipset Family USB Enhanced Host Controller #1 vendor: Intel Corporation physical id: 1d bus info: pci@0000:00:1d.0 version: 04 width: 32 bits clock: 33MHz capabilities: pm debug ehci bus_master cap_list configuration: driver=ehci_hcd latency=0 resources: irq:23 memory:d1a09000-d1a093ff *-isa description: ISA bridge product: HM65 Express Chipset Family LPC Controller vendor: Intel Corporation physical id: 1f bus info: pci@0000:00:1f.0 version: 04 width: 32 bits clock: 33MHz capabilities: isa bus_master cap_list configuration: latency=0 *-storage description: SATA controller product: 6 Series/C200 Series Chipset Family 6 port SATA AHCI Controller vendor: Intel Corporation physical id: 1f.2 bus info: pci@0000:00:1f.2 logical name: scsi0 logical name: scsi1 version: 04 width: 32 bits clock: 66MHz capabilities: storage msi pm ahci_1.0 bus_master cap_list emulated configuration: driver=ahci latency=0 resources: irq:41 ioport:3098(size=8) ioport:30bc(size=4) ioport:3090(size=8) ioport:30b8(size=4) ioport:3060(size=32) memory:d1a08000-d1a087ff *-disk description: ATA Disk product: ST9500325AS vendor: Seagate physical id: 0 bus info: scsi@0:0.0.0 logical name: /dev/sda version: 0001 serial: S2W1AMSX size: 465GiB (500GB) capabilities: partitioned partitioned:dos configuration: ansiversion=5 signature=a45f21e9 *-volume:0 description: Windows NTFS volume physical id: 1 bus info: scsi@0:0.0.0,1 logical name: /dev/sda1 version: 3.1 serial: 46aa-2a25 size: 19GiB capacity: 20GiB capabilities: primary ntfs initialized configuration: clustersize=4096 created=2011-08-25 21:32:00 filesystem=ntfs label=PQSERVICE state=clean *-volume:1 description: Windows NTFS volume physical id: 2 bus info: scsi@0:0.0.0,2 logical name: /dev/sda2 version: 3.1 serial: 10aa-ad1a size: 98MiB capacity: 100MiB capabilities: primary bootable ntfs initialized configuration: clustersize=4096 created=2011-08-25 21:32:03 filesystem=ntfs label=SYSTEM RESERVED state=clean *-volume:2 description: Windows NTFS volume physical id: 3 bus info: scsi@0:0.0.0,3 logical name: /dev/sda3 version: 3.1 serial: 668c5afc-182e-ff4b-b084-3cc09f54972d size: 395GiB capacity: 395GiB capabilities: primary ntfs initialized configuration: clustersize=4096 created=2011-08-25 21:32:03 filesystem=ntfs label=Don's Machine state=clean *-volume:3 description: Extended partition physical id: 4 bus info: scsi@0:0.0.0,4 logical name: /dev/sda4 size: 49GiB capacity: 49GiB capabilities: primary extended partitioned partitioned:extended *-logicalvolume:0 description: Linux swap / Solaris partition physical id: 5 logical name: /dev/sda5 capacity: 3945MiB capabilities: nofs *-logicalvolume:1 description: Linux filesystem partition physical id: 6 logical name: /dev/sda6 logical name: / capacity: 46GiB configuration: mount.fstype=ext4 mount.options=rw,relatime,errors=remount-ro,user_xattr,barrier=1,data=ordered state=mounted *-cdrom description: DVD-RAM writer product: DVD-RW DVRTD11RS vendor: PIONEER physical id: 1 bus info: scsi@1:0.0.0 logical name: /dev/cdrom logical name: /dev/cdrw logical name: /dev/dvd logical name: /dev/dvdrw logical name: /dev/sr0 version: 1.01 capabilities: removable audio cd-r cd-rw dvd dvd-r dvd-ram configuration: ansiversion=5 status=nodisc *-serial UNCLAIMED description: SMBus product: 6 Series/C200 Series Chipset Family SMBus Controller vendor: Intel Corporation physical id: 1f.3 bus info: pci@0000:00:1f.3 version: 04 width: 64 bits clock: 33MHz configuration: latency=0 resources: memory:d1a06000-d1a060ff ioport:3040(size=32) *-power UNCLAIMED description: OEM_Define1 product: OEM_Define5 vendor: OEM_Define2 physical id: 1 version: OEM_Define6 serial: OEM_Define3 capacity: 75mWh *-battery description: Lithium Ion Battery product: CRB Battery 0 vendor: -Virtual Battery 0- physical id: 2 version: 10/12/2007 serial: Battery 0 slot: Fake

    Read the article

  • How to use Nginx to export the mongoDB connection?

    - by Totty
    I have on my server 2 things: the node.js server and a mongodb database; The node.js server is reachable from myip/server; and now I would like to export the mongodb database to myip/database for example. Now when I use my mongodb viewer (MongoVUE) with "http://myip/database:9000" (the port 9000 is set in nginx and it's also the port that I start mongod). If I go to "http://myip/database:9000" or "http://myip/database" in a browser it look like: "You are trying to access MongoDB on the native driver port. For http diagnostic access, add 1000 to the port number". But in MongoVUE it says: Unable to connect to server 192.168.1.16/database:9000: No such host is known. Type: MongoDB.Driver.MongoConnectionException Stack: at MongoDB.Driver.Internal.DirectConnector.Connect(TimeSpan timeout) at MongoDB.Driver.MongoServer.Connect(TimeSpan timeout, ConnectWaitFor waitFor) at MongoDB.Driver.MongoServer.Connect(TimeSpan timeout) at MongoDB.Driver.MongoServer.Connect() at MangoUI.MMongo.FQlxNlJKqO74gYmXgZR4(Object ) at MangoUI.MMongo.Open(Boolean useSamus) at MangoUI.MMongo.Open() at MangoUI.ComNavTree.wJQdUqApCpjoC39P59n(Object ) at MangoUI.ComNavTree.ExpandMe(MTreeNode expand) at MangoUI.ComNavTree.tree_BeforeExpand(Object sender, TreeViewCancelEventArgs e) No such host is known Type: System.Net.Sockets.SocketException Stack: at System.Net.Dns.GetAddrInfo(String name) at System.Net.Dns.InternalGetHostByName(String hostName, Boolean includeIPv6) at System.Net.Dns.GetHostAddresses(String hostNameOrAddress) at MongoDB.Driver.MongoServerAddress.ToIPEndPoint(AddressFamily addressFamily) at MongoDB.Driver.MongoServerInstance.Connect(Boolean slaveOk) at MongoDB.Driver.Internal.DirectConnector.Connect(TimeSpan timeout)

    Read the article

  • Dual displays not working - NVidia - Ubuntu 12.04 - Second Monitor - Two Screens

    - by user75105
    Graphics Card: NVidia 460 GTX. Driver: NVIDIA accelerated graphics driver (version current) I have one DVI monitor, an old Dell LCD from 2005, and one VGA monitor, an Asus ML238H from 2010 whose HDMI port broke. The Asus is plugged into my graphics card's primary monitor slot and is the better monitor even though it is VGA but my computer defaults to the Dell. This happens when I boot as well; the loading screens, the motherboard brand image, etc. are all displayed on the Dell monitor until Windows loads. Then both monitors work. The same thing happened when I booted up Ubuntu 12.04 but I did not see the second monitor when the log-in screen popped up, nor did I when I logged in. I went to System Settings/Displays and my Asus monitor is not an option. I clicked Detect Displays and the Asus is not detected. I looked at the other questions regarding NVIDIA drivers and recalled my problems with Ubuntu a few years ago and decided to check the driver. I went to Additional Drivers to install the proprietary driver and it looks like it's installed and active but I'm still having this problem. There is another driver option, the post-release NVIDIA driver, but that does not fix the problem either. Also, under System Details/Graphics the graphics device is listed as Unknown, which might indicate that it is using an open source generic driver and not the proprietary NVidia driver. But under Additional Drivers it says that I am using the NVidia driver. Any help is appreciated.

    Read the article

  • Dual displays not working - NVidia - Ubuntu 12.4

    - by user75105
    Graphics Card: NVidia 460 GTX. Driver: NVIDIA accelerated graphics driver (version current) I have one DVI monitor, an old Dell LCD from 2005, and one VGA monitor, an Asus ML238H from 2010 whose HDMI port broke. The Asus is plugged into my graphics card's primary monitor slot and is the better monitor even though it is VGA but my computer defaults to the Dell. This happens when I boot as well; the loading screens, the motherboard brand image, etc. are all displayed on the Dell monitor until Windows loads. Then both monitors work. The same thing happened when I booted up Ubuntu 12.4 but I did not see the second monitor when the log-in screen popped up, nor did I when I logged in. I went to System Settings/Displays and my Asus monitor is not an option. I clicked Detect Displays and the Asus is not detected. I looked at the other questions regarding NVIDIA drivers and recalled my problems with Ubuntu a few years ago and decided to check the driver. I went to Additional Drivers to install the proprietary driver and it looks like it's installed and active but I'm still having this problem. There is another driver option, the post-release NVIDIA driver, but that does not fix the problem either. Also, under System Details/Graphics the graphics device is listed as Unknown, which might indicate that it is using an open source generic driver and not the proprietary NVidia driver. But under Additional Drivers it says that I am using the NVidia driver. Any help is appreciated.

    Read the article

  • How does one convert from a Java resultset to ColdFusion query in Railo?

    - by Shawn Grigson
    The following works fine in CFMX 7 and CF8, and I'd assume CF9 as well: <!--- 'conn' is a JDBC connection ---> <cfset stat = conn.createStatement() /> <cfset rs = stat.executeQuery(trim(arguments.sql)) /> <!--- convert this Java resultset to a CF query recordset ---> <cfset queryTable = CreateObject("java", "coldfusion.sql.QueryTable")> <cfset queryTable.init(rs) > <cfset query = queryTable.FirstTable() /> This creates a statement using a JDBC driver, executes a query against it, putting it into a java resultset, and then coldfusion.sql.QueryTable is instantiated, passed the Java resulset object, and then queryTable.FirstTable() is called, which returns an actual coldfusion resultset (for cfloop and the like). The problem comes with a difference in Railo's implementation. Running this code in Railo returns the following error: No matching Constructor for coldfusion.sql.QueryTable(org.sqlite.RS) found. I've dumped the Railo java object, and don't see init() among the methods. Am I missing something simple? I'd love to get this working in Railo as well. Please note: I am doing a DSN-less connection to a SQLite db. I understand how to set up a CF datasource. My only hiccup at this point is doing the translation from a Java result set to a Railo query.

    Read the article

  • windows kernel mode IOCTL returns random results

    - by clyfe
    I use the following code to fetch PSTORAGE_HOTPLUG_INFO capabilities from disks via IOCTL in a minifilter driver, but the returning hotplugInfo structure has all the fields set to random nonzero values on subsequent executions. What am I doing wrong? RESULT: 00000014 0.00046322 IOCTL Volume Media Removable, 64 00000015 0.00046451 IOCTL Volume Media Hotplug 154 00000016 0.00046562 IOCTL Volume Device Hotplug 244 00000054 1020.44311523 IOCTL Volume Media Removable, 240 00000055 1020.44311523 IOCTL Volume Media Hotplug 102 00000056 1020.44311523 IOCTL Volume Device Hotplug 244 Sample code: //int SomeFunction(PFLT_VOLUME pFLTVolume) STORAGE_HOTPLUG_INFO storageHotplugInfo; KEVENT event; IO_STATUS_BLOCK ioStatus; PIRP pirp; PDEVICE_OBJECT deviceObject; PSTORAGE_HOTPLUG_INFO hotplugInfo; ASSERT(KeGetCurrentIrql() <= DISPATCH_LEVEL); status = FltGetDiskDeviceObject(pFLTVolume, &deviceObject); if(!NT_SUCCESS(status)){ DbgPrint("No Device for Volume\n"); return 0; } KeInitializeEvent(&event, NotificationEvent, FALSE); ASSERT(KeGetCurrentIrql() <= APC_LEVEL); pirp = IoBuildDeviceIoControlRequest( IOCTL_STORAGE_GET_HOTPLUG_INFO, deviceObject, NULL, 0, &storageHotplugInfo, sizeof(STORAGE_HOTPLUG_INFO), FALSE, &event, &ioStatus ); if(!pirp){ return 0; } ASSERT(KeGetCurrentIrql() <= DISPATCH_LEVEL); status = IoCallDriver(deviceObject, pirp); if (status == STATUS_PENDING) { status = KeWaitForSingleObject( &event, Executive, KernelMode, FALSE, NULL); } else { ioStatus.Status = status; } status = ioStatus.Status; hotplugInfo = (PSTORAGE_HOTPLUG_INFO) &pirp->AssociatedIrp.SystemBuffer; if(hotplugInfo->MediaRemovable){ DbgPrint("IOCTL Volume Media Removable, %d\n", hotplugInfo->MediaRemovable); } if(hotplugInfo->MediaHotplug){ DbgPrint("IOCTL Volume Media Hotplug %d\n", hotplugInfo->MediaHotplug); } if(hotplugInfo->DeviceHotplug){ DbgPrint("IOCTL Volume Device Hotplug %d\n", hotplugInfo->DeviceHotplug); } ObDereferenceObject(deviceObject);

    Read the article

  • How to enforce foreign keys using Xerial SQLite JDBC?

    - by Space_C0wb0y
    According to their release notes, the Xerial SQLite JDBC driver supports foreign keys since version 3.6.20.1. I have tried some time now to get a foreign key constraint to be enforced, but to no avail. Here is what I came up with: public static void main(String[] args) throws ClassNotFoundException, SQLException { Class.forName("org.sqlite.JDBC"); SQLiteConfig config = new SQLiteConfig(); config.enforceForeignKeys(true); Connection connection = DriverManager.getConnection("jdbc:sqlite::memory:", config.toProperties()); connection.createStatement().executeUpdate( "CREATE TABLE artist(" + "artistid INTEGER PRIMARY KEY, " + "artistname TEXT);"); connection.createStatement().executeUpdate( "CREATE TABLE track("+ "trackid INTEGER," + "trackname TEXT," + "trackartist INTEGER," + "FOREIGN KEY(trackartist) REFERENCES artist(artistid)" + ");"); connection.createStatement().executeUpdate( "INSERT INTO track VALUES(14, 'Mr. Bojangles', 3)"); } The table definitions are taken directly from the sample in the SQLite documentation. This is supposed to fail, but it doesn't. I also checked, and it really inserts the tuple (no ignore or something like that). Does anyone have any experience with that, or knows how to make it work?

    Read the article

  • Login Problem Windows Authentication

    - by user109280
    Duplicate of: http://stackoverflow.com/questions/881928/windows-authentication-trusted-connection-problem I logged in the Windows Server(Machine 1) as "abc\user1 ". Windows Server machine is in abc domain. MSSQL Server is in the "abc" domain on Machine 1 and have mixed mode.authentication. It has account "abc\user1 " and "abc\user2 ". Both has role of sysadmin and serveradmin. I logged in another machine(Machine 2) using "abc\user2 ". Same Domain. Run the ant which connect to MSSQL Server. URL is formed as follows. jdbc:sqlserver://%DB_IP%:%DB_PORT%;SelectMethod=cursor;integratedSecurity=true;DatabaseName=dbname; 1) From Machine 2, If I use "abc\user2" credential for connection, then it works fine. since integratedSecurity=true. 2) From Machine 2, If I use "abc\user1" credential for connection, then it doesn't fine, since integratedSecurity=true and take System Credentials i.e "abc\user2". Even if I make integratedSecurity=false , then also it doesn't connect using "abc\user1" What changes to URL I have make to work for "abc\user1" from Machine2 for connection. what properties to be added in url? OR Driver doesn't support to use another domain\User Credentials? What need to set on MSSQL Server ?? Deepak

    Read the article

  • System Calls in windows & Native API?

    - by claws
    Recently I've been using lot of Assembly language in *NIX operating systems. I was wondering about the windows domain. Calling convention in linux: mov $SYS_Call_NUM, %eax mov $param1 , %ebx mov $param2 , %ecx int $0x80 Thats it. That is how we should make a system call in linux. Reference of all system calls in linux: Regarding which $SYS_Call_NUM & which parameters we can use this reference : http://docs.cs.up.ac.za/programming/asm/derick_tut/syscalls.html OFFICIAL Reference : http://kernel.org/doc/man-pages/online/dir_section_2.html Calling convention in Windows: ??? Reference of all system calls in Windows: ??? Unofficial : http://www.metasploit.com/users/opcode/syscalls.html , but how do I use these in assembly unless I know the calling convention. OFFICIAL : ??? If you say, they didn't documented it. Then how is one going to write libc for windows without knowing system calls? How is one gonna do Windows Assembly programming? Atleast in the driver programming one needs to know these. right? Now, whats up with the so called Native API? Is Native API & System calls for windows both are different terms referring to same thing? In order to confirm I compared these from two UNOFFICIAL Sources System Calls: http://www.metasploit.com/users/opcode/syscalls.html Native API: http://undocumented.ntinternals.net/aindex.html My observations: All system calls are beginning with letters Nt where as Native API is consisting of lot of functions which are not beginning with letters Nt. System Call of windows are subset of Native API. System calls are just part of Native API. Can any one confirm this and explain.

    Read the article

  • How to filter and intercept Linux packets by using net_dev_add() API?

    - by Khajavi
    I'm writing ethernet network driver for linux. I want to receive packets, edit and resend them. I know how to edit the packet in packet_interceptor function, but how can I drop incoming packets in this function?? #include <linux/netdevice.h> #include <linux/skbuff.h> #include <linux/ip.h> #include <net/sock.h> struct packet_type my_proto; int packet_interceptor(struct sk_buff *skb, struct net_device *dev, struct packet_type *pt, struct net_device *orig_dev) { // I dont want certain packets go to upper in net_devices for further processing. // How can I drop sk_buff here?! return 0; } static int hello_init( void ) { printk(KERN_INFO "Hello, world!\n"); my_proto.type = htons(ETH_P_ALL); my_proto.dev = NULL; my_proto.func = packet_interceptor; dev_add_pack(&my_proto); return 0; } static void hello_exit(void) { dev_remove_pack(&my_proto); printk(KERN_INFO "Bye, world\n"); } module_init(hello_init); module_exit(hello_exit);

    Read the article

  • [SQLServer JDBC Driver][SQLServer]Could not find stored procedure 'master..xp_jdbc_open2'.

    - by Vijaya Moderator -Oracle
    When connecting to MS SQL Server Database via Weblogic Datasource and using XA jdbc driver, the following error is thrown. <Jun 3, 2014 5:16:49 AM PDT> <Error> <Console> <BEA-240003> <Console encountered the following error java.sql.SQLException: [FMWGEN][SQLServer JDBC Driver][SQLServer]Could not find stored procedure 'master..xp_jdbc_open2'. at weblogic.jdbc.sqlserverbase.ddb_.b(Unknown Source)at weblogic.jdbc.sqlserverbase.ddb_.a(Unknown Source)at weblogic.jdbc.sqlserverbase.ddb9.b(Unknown Source)at weblogic.jdbc.sqlserverbase.ddb9.a(Unknown Source)at weblogic.jdbc.sqlserver.tds.ddr.v(Unknown Source)at weblogic.jdbc.sqlserver.tds.ddr.a(Unknown Source)at weblogic.jdbc.sqlserver.tds.ddq.a(Unknown Source)at weblogic.jdbc.sqlserver.tds.ddr.a(Unknown Source)at weblogic.jdbc.sqlserver.ddj.m(Unknown Source)at weblogic.jdbc.sqlserverbase.ddel.e(Unknown Source)at weblogic.jdbc.sqlserverbase.ddel.a(Unknown Source)  The cause behind the issue is that  the MS SQL Server was not installed with the Stored procedures to enable JTA/XA Solution To connect to SQL Server via XA Driver from WLS Datasource you need to install Stored Procedures for JTATo use JDBC distributed transactions through JTA, your system administrator should use the following procedure to install Microsoft SQL Server JDBC XA procedures. This procedure must be repeated for each MS SQL Server installation that will be involved in a distributed transaction.To install stored procedures for JTA:1. Copy the appropriate sqljdbc.dll and instjdbc.sql files from the WL_HOME\server\lib directory to the SQL_Server_Root/bin directory of the MS SQL Server database server, where WL_HOME is the directory in which WebLogic server is installed, typically c:\Oracle\Middleware\wlserver_10.x.  Note:  If you are installing stored procedures on a database server with multiple Microsoft SQL Server instances, each running SQL Server instance must be able to locate the sqljdbc.dll file.Therefore the sqljdbc.dll file needs to be anywhere on the global PATH or on the application-specific path. For the application-specific path, place the sqljdbc.dll file into the :\Program Files\Microsoft SQL Server\MSSQL$\Binn directory for each instance. 2. From the database server, use the ISQL utility to run the instjdbc.sql script. As a precaution, have your system administrator back up the master database before running instjdbc.sql. At a command prompt, use the following syntax to run instjdbc.sql:  ISQL -Usa -Psa_password -Sserver_name -ilocation\instjdbc.sql  where:  sa_password is the password of the system administrator.  server_name is the name of the server on which SQL Server resides.  location is the full path to instjdbc.sql. (You copied this script to the SQL_Server_Root/bin directory in step 1.)  The instjdbc.sql script generates many messages. In general, these messages can be ignored; however, the system administrator should scan the output for any messages that may indicate an execution error. The last message should indicate that instjdbc.sql ran successfully. The script fails when there is insufficient space available in the master database to store the JDBC XA procedures or to log changes to existing procedures.

    Read the article

  • which graphics driver will solve my laptop screen display problem?

    - by vi.su.
    which graphics driver will solve my laptop screen display problem? Recently installed Ubuntu 10.04.4 LTS on my laptop and upgraded it to 12.10, through 12.04.1 LTS. I am not able to get the display right, from the beginning. During boot laptop screen is all green, and images / videos are not getting displayed properly when logged in. Actual problem started last week, when this laptop was with Windows Vista (preloaded), and I tried to update Nvidia graphics drivers. something went wrong and I couldn't find a way to fix, so decided to install Ubuntu. Over last week, installed / re-installed Ubuntu many times with various drivers with no success. Laptop : Dell Inspiron 1420 Installed OS : ubuntu 10.04 LTS (Current, Ubuntu 12.10) Nvidia driver : GeForce 8400M GS (tried in previous installations; not installed now) Print-screen was not able to catch this issue as mentioned in the comment, so I am posting screen photos.

    Read the article

< Previous Page | 126 127 128 129 130 131 132 133 134 135 136 137  | Next Page >