Search Results

Search found 4839 results on 194 pages for 'designer cs'.

Page 132/194 | < Previous Page | 128 129 130 131 132 133 134 135 136 137 138 139  | Next Page >

• C++ Vector of pointers

  - by xbonez

  For my latest CS homework, I am required to create a class called Movie which holds title, director, year, rating, actors etc. Then, I am required to read a file which contains a list of this info and store it in a vector of pointers to Movies. I am not sure what the last line means. Does it mean, I read the file, create multiple Movie objects. Then make a vector of pointers where each element (pointer) points to one of those Movie objects? Do I just make two vectors - one of pointers and one of Movies and make a one-to-one mapping of the two vectors?

  Read the article

• Where should I set the DataContext - code behind or xaml?

  - by dovholuk

  (honestly I searched and read all the 'related questions' that seemed relevant - i do hope i didn't "miss" this question from elsewhere but here goes...) There are two different ways (at least) to set the DataContext. One can use XAML or one can use the code behind. What is the 'best practice' and why? I tend to favor setting it in XAML because it allows a designer to define collections on their own but I need 'ammunition' on why it's a best practice or why I'm crazy and the code behind is the bomb...

  Read the article

• Image-free, custom-styled search bar

  - by Jon

  I'm working with the designer and he sent me the following design for the search bar on our webpage: I'm very much against using images in webpage design unless completely necessary, so I'm hoping that I can recreate the whole search bar widget in CSS. I know how to do border-radius, gradients, box-shadows, etc, so that's not a problem. Question: Assuming CSS3 browser compatibility, how can I go about recreating the actual search button (the magnifying glass portion) with the double curved edge, and the slight drop shadow on the bottom left? Thoughts: My initial feeling was that the search button would be circular and free-standing, then overlap the search input div with a negative left-margin, but then I was unsure how I would get that drop shadow. Edit: I'm not completely opposed to using an image for the magnifying glass, but I've seen a similar icon created in CSS before. Would an image vs. pure CSS end up loading at the same speed, or should I do all I can do in pure CSS?

  Read the article

• CruiseControl.NET, Visual Studio & SubVersion

  - by Ian

  Hi All, I am setting up a Continuous Integration server. I have one issue that doesn't seem to be mentioned in the tutorials. I have a ASP.net Web Application that I need to compile and them publish. My Problem is that I seem to be able to compile the app but when I attempt to use a buildPublisher this copies every thing including .svn files & folders and ms CS files. I am using an MSBuild task to compile my source. I tried setting my MSBuild Output Directory to directory but this didn't seem to have any effect. What am I not understanding? Thanks

  Read the article

• How to set DataGridView columns text format to uppercase by adding new property?

  - by Jooj

  Hello, I have a custom DataGridView control and want to set the text format for custom columns in the designer (CellStyle builder). Let's say I want to make the text format to uppercase. After searching about this I've found some solutions with adding new events and then changing the text format but this is not what I want. I want to add a new property to all designed columns and there set or change the text format. How to do this? Thank and best regards.

  Read the article

• How do I ensure my abstract class's function can only operate on extenders of the same type as the c

  - by incrediman

  For example, let's say this is my abstract class: abstract class A{ int x; int y; void foo(A fooMe); } ...and B and C are two classes which extend A. What I want is for B to only be able to call foo() on other Bs, and for C to only be able to call foo() on other Cs. But I want this to be out of the hands of the programmer who's extending my A class - that is, I want a way to ensure this functionality within As code alone. What can I do? (If possible) I'd like to avoid any hack or generics solution that's too messy - I still want foo to be able to be called like this, for example: B b=new B(); B bb=new B(); bb.foo(b);

  Read the article

• Passing derived objects in a constructure

  - by Clarence Klopfstein

  This is a bit of a convoluted question, hopefully I can make it clear. I am finding that this may not be possible, but am trying to see if anybody has a solution. I have four classes, two are core classes and two are those core classes extended: extUser Extends coreUser extSecurity Extends coreSecurity In the constructor for coreUser you have this: public coreUser(string id, ref coreSecurity cs) When trying to extend coreUser you would have this: public extUser(string id ref extSecurity es) : base(id, ref es) This fails because es is of type, extSecurity and the base class expects a type of coreSecurity. I've not found anyway to cast this to allow for me to override this base class in C#. In VB it works just fine. Ideas?

  Read the article

• How to set ItemsSource?

  - by Mark

  This dialog makes no sense to me And I'm having trouble finding good tutorials on it. Most of the examples aren't detailed enough, or do stuff via code, but I'd like to take advantage of the IDE as much as possible. Whats the difference between ItemsSource and DataContext? I'd like to bind it to just a List for starters. I don't need SQL or databases or anything fancy. Where would I declare my list? In MainWindow.xaml.cs? How do I get it to appear in that dialog?

  Read the article

• from JS to iphone dev - what's the best language to start with?

  - by Enkai

  I am a total beginner and would like to eventually learn to develop for the iphone. I have just done a beginner's CS course where the language we learned was JavaScript. We studied basic concepts like: variables, arrays, loops (for,while,if,if..else..), properties and functions. I'm wondering if I am starting in the right/wrong place by following this book: Learn C on the Mac by Dave Mark? I have read a few chapters and am finding it a bit hard to get my head around the way that C works, for example the way that Strings are printed seems overly complicated as compared to JS. Do you think that JS was the wrong language to start off with and would I be better to go from JS straight to Objective-C rather than to C? I have tried to read up on previous threads on the merits/demerits of learning C first but haven't found any that relate JS to learning C/Obj C/ Cocoa. Any advice appreciated as I am very new to this. Thanks

  Read the article

• Paging with jQuery

  - by zurna

  I get data from another page using jQuery get method. But I have a small problem. Sometimes, data that I take from another page is too long so it's divided into pages. When the user clicks on 1, 2, 3, ... links he/she is redirected to the other page. However, I want data to be reloaded on the same page. Edit $('ul.thumbs li.pagination a').live('click', function() { var pageNumber = parseInt($(this).text().replace(/[^0-9]/g, '')); $.ajax({ type: "GET", url: "images.cs.asp?Process=ViewImages&PAGEID=<%=Request.QueryString("PAGEID")%>", success: function(data) { $("#ViewImages").html(data); }, error: function (XMLHttpRequest, textStatus, errorThrown) { $("#ViewImages").html('.'); } }); return false; });

  Read the article

• html links & hover events over certain locations on an image.

  - by Tommy

  So i created a web site a long time ago using a designer alot like frontpage + expression design put together, and since then Ive gotten more into coding, and I'm learning html, CSS, and all that good stuff.. and i have this re-designed header that Ive made here: http://prntscr.com/8zct So what I need to know, is how i can get it so that when a user clicks on one of the links in the header design it will redirect to a page. and also if possible, how to make it so when a user hovers over a link a drop down may appear with other options. As me being quite new to this sort of stuff, could anybody help me achieve this? PS. I'm working in Visual Studio with ASP. but that doesn't change anything about the html and css stuff. just letting you guys know.

  Read the article

• Text property in a UserControl in C#

  - by yeyeyerman

  I have a control with a inner TextBox. I want to make a direct relationship between the Text property of the UserControl and the Text property of the TextBox. The first thing I realized is that Text was not being displayed in the Properties of the UserControl. Then I added the Browsable(true) attribute. [Browsable(true)] public override string Text { get { return m_textBox.Text; } set { m_textBox.Text = value; } } Now, the text will be shown for a while, but then is deleted. This is because the information is not written within the xxxx.Designer.cs. How can this behviour be changed?

  Read the article

• How do I remove a control if not a specific type?

  - by joek1975

  I have a control that I need to restrict the types of child controls that it can contain during design time (dragging a new control onto an existing control on the form designer). I tried to do this by overriding the OnControlAdded event: Protected Overrides Sub OnControlAdded(ByVal e As System.Windows.Forms.ControlEventArgs) MyBase.OnControlAdded(e) If e.Control.GetType() IsNot GetType(ExpandablePanel) Then MsgBox("You can only add the ExpandablePanel control to the TaskPane.", MsgBoxStyle.Exclamation Or MsgBoxStyle.OkOnly, "TaskPane") Controls.Remove(e.Control) End If End Sub This seems to work, however I get an error message from Visual Studio immediately after the control is removed: 'child' is not a child control of this parent. What does this mean? How can I accomplish this without errors occurring?

  Read the article

• A good ecommerce alternative to Magento?

  - by delboud

  I been dealing with Magneto for the last 6 months now and its a real headache, always some type of error, slow, bloated, dead community and overly complex to customize (and im a designer...) I look at others like zencart but seem kinda dated compared to magento, but are their any other solutions to replace magento thats better and with a good online community? the main selling points im looking for are configurable items (as in options for products), good online community and not so hard to customize or a nice amount of templates available. has to be free and hopefully open source and if it helps this is for a custom car accessories store

  Read the article

• Visual Studio swapping code between projects?!?!?!?!??!

  - by Tom

  Are there any known issues with visual studio and code being swapped between projects? I had a project running in VS2008 and when i went back to it, the code from another project had been swapped in the Program.cs class. I havent made any mistakes, im not talking about some code- i mean the whole project had been swapped out. Its as if the .proj files or .soln files had been swapped from their project folders??? EDIT Ive restarted laptop, opened the code again and its still showing the wrong code BUT when i execute it, its the right code?!?!?!

  Read the article

• Is there any Application Server Frameworks for other languages/platforms than JavaEE and .NET?

  - by Jonas

  I'm a CS student and has rare experience from the enterprise software industry. When I'm reading about enterprise software platforms, I mostly read about these two: Java Enterprise Edition, JavaEE .NET and Windows Communication Foundation By "enterprise software platforms" I mean frameworks and application servers with support for the same characteristics as J2EE and WCF has: [JavaEE] provide functionality to deploy fault-tolerant, distributed, multi-tier Java software, based largely on modular components running on an application server. WCF is designed in accordance with service oriented architecture principles to support distributed computing where services are consumed by consumers. Clients can consume multiple services and services can be consumed by multiple clients. Services are loosely coupled to each other. Is there any alternatives to these two "enterprise software platforms"? Isn't any other programming languages used in a bigger rate for this problem area? I.e Why isn't there any popular application servers for C++/Qt?

  Read the article

• avoid caching of page in browser

  - by Shan

  I am using an iframe to show the child pages.In that one one particular page contains hidden div and i am showing it as a pop-up like thing with javascript by changing the visibility of the hidden div. Problem is before showing the hidden div , some manipulations are done at server level and I am calling the div from C# code after the manipulations like Page.ClientScript.RegisterStartupScript(GetType(), "MyKey", "javascript:OpenModelPopup('cb','cs');", true); so the page is getting posted back and the div is shown. after this, after going to next page if i click browser back it shows that page with that hidden div and on next click of browser back gives the page without hidden div. but I want to show only the initial stage of the page ie. without showing the hidden div that stage with hidden div should not be cached or it should not be shown on click of browser back.

  Read the article

• VS 2008 "Choose Data Source" wizard

  - by ELM

  Good Day, I'm using Visual Studio Professional 2008 SP 1. When I create a connection via the designer, the "Choose Data Source" dialog only lists the following data sources: Microsoft SQL Server Compact 3.5 Microsoft SQL Server Database File When I create a connection on the Server explorer the list is complete with : Microsoft SQL Server Compact 3.5, Microsoft SQL Server Database File, Microsoft SQL Server Compact, ODBC etc. Please help me out. I need to use SQL Server Compact. I have posted the same problem on the following thread with some screenshots: http://social.msdn.microsoft.com/Forums/en/vssetup/thread/906845c3-69e9-431a-ad07-7da2de684d33

  Read the article

• How is the implicit segment register of a near pointer determined?

  - by Daniel Trebbien

  In section 4.3 of Intel 64® and IA-32 Architectures Software Developer's Manual. Volume 1: Basic Architecture, it says: A near pointer is a 32-bit offset ... within a segment. Near pointers are used for all memory references in a flat memory model or for references in a segmented model where the identity of the segment being accessed is implied. This leads me to wondering: how is the implied segment register determined? I know that (%eip) and displaced (%eip) (e.g. -4(%eip)) addresses use %cs by default, and that (%esp) and displaced (%esp) addresses use %ss, but what about (%eax), (%edx), (%edi), (%ebp) etc., and can the implicit segment register depend also on the instruction that the memory address operand appears in?

  Read the article

• Clear the form once form submitted

  - by zurna

  Once the form submitted, response from another page is printed to #GameStorySys. But values entered to the form still stays there. Is it possible for the form values to disappear (but the form should still stay) once the form submitted? $("[name='GameStoryForm']").click(function() { $.ajax({ type: "POST", data: $("#GameStoryForm").serialize(), url: "content/commentary/index.cs.asp?Process=EditLiveCommentaryStory&CommentaryID=<%=Request.QueryString("CommentaryID")%>", success: function(output) { $('#GameStorySys').html(output); }, error: function(output) { $('#GameStorySys').html(output); } }); });

  Read the article

• issue with c# xml documentation

  - by galford13x

  I have the following comment. /// <summary> /// MSDN Time Format compatible with <see cref="DateTime.ParseExact(string, string, IFormatProvider)"/> /// </summary> /// <returns>MSDN Time Format compatible with <see cref="DateTime.ParseExact(string, string, IFormatProvider)"/></returns> but I'm not sure why I receive the following warning Warning 7 XML comment on 'MSLab.DateTime.SystemTimeProvider.GetTimeFormat()' has cref attribute 'DateTime.ParseExact(string, string, IFormatProvider)' that could not be resolved F:\My Documents\Visual Studio 2010\Projects\MSLab\trunk\MSLab\MSLab\DateTime\SystemTimeProvider.cs 110 57 MSLab

  Read the article

• Why Resource (.resx) file added on merely changing Form size and on adding button which is not resou

  - by Muhammad Kashif Nadeem

  1- Resource files suppose to be added on adding some resource in application like image or audio or video etc. But if I just change size of form a .resx file under that particular form. Changing size of form does not add any resource so why this .resx file. 2- I dropped a button on form and a resource file is included again this button is not some kind of resource, it is object created and having information in designer file. 3- A resource file added on dropping button on form but if I delete this resource file and run application it compile and run with NO error and button is still there. If this button has any relation with resource file then there must by some kind of compile or runtime error AND if .resx file has nothing to do with button then why it was added? I am using VS 2008. Thanks in advance for the help

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• C++ Questions about vectors

  - by xbonez

  Hey guys, I have a CS exam tomorrow. Just want to get a few questions cleared up. Thanks a lot, and I really appreciate the help. Que 1. What are parallel vectors? Vectors of the same length that contain data that is meant to be processed together Vectors that are all of the same data type Vectors that are of the same length Any vector of data type parallel Que 2. Arrays are faster and more efficient than vectors. True False Que 3. Arrays can be a return type of a function call. True False Que 4. Vectors can be a return type of a function call. True False

  Read the article

• Programmatically Setting the Version of a Window's Service on the ProjectInstaller

  - by user302004

  I have a Windows Service created in Visual Studio 2005 in C#. I have a setup project and a ProjectInstaller class. I also have code to programmatically get the version from the AssemblyFileVersionAttribute. I need to figure out where I set the version that I've obtained (and where this code should go). I tried placing it in the InitializeComponent method on ProjectInstaller.Designer.cs and then appending the version to serviceInstaller1.DisplayName and serviceInstaller1.ServiceName. This didn't work and you're not supposed to modify the contents of this method. Any ideas?

  Read the article

< Previous Page | 128 129 130 131 132 133 134 135 136 137 138 139  | Next Page >