Search Results

Search found 29956 results on 1199 pages for 'query builder methods'.

Page 133/1199 | < Previous Page | 129 130 131 132 133 134 135 136 137 138 139 140  | Next Page >

  • Parameterized SPARQL query with JENA

    - by sandra
    I'm trying to build a small semantic web application using Jena framework, JSP and JAVA. I have a remote SPARQL endpoint and I've already written a simple query which works fine but now I need to use some parameters. Here is my code so far: final static String serviceEndpoint = "http://fishdelish.cs.man.ac.uk/sparql/"; String comNameQuery = "PREFIX fd: <http://fishdelish.cs.man.ac.uk/rdf/vocab/resource/> " + "SELECT ?name ?language ?type" + "WHERE { ?nameID fd:comnames_ComName ?name ;" + "fd:comnames_Language ?language ;" + "fd:comnames_NameType ?type ." + "}"; Query query = QueryFactory.create(comNameQuery); QueryExecution qe = QueryExecutionFactory.sparqlService(serviceEndpoint,query); try { ResultSet rs = qe.execSelect(); if ( rs.hasNext() ) { System.out.println(ResultSetFormatter.asText(rs)); } } catch(Exception e) { System.out.println(e.getMessage()); } finally { qe.close(); } What I want to do is to parameterized ?name. I'm new to Jena and I'm not really sure how to use parameters in a SPARQL query. I would appreciate it if someone could help me with this.

    Read the article

  • Optimize MySQL query (ngrams, COUNT(), GROUP BY, ORDER BY)

    - by Gerardo
    I have a database with thousands of companies and their locations. I have implemented n-grams to optimize search. I am making one query to retrieve all the companies that match with the search query and another one to get a list with their locations and the number of companies in each location. The query I am trying to optimize is the latter. Maybe the problem is this: Every company ('anunciante') has a field ('estado') to make logical deletes. So, if 'estado' equals 1, the company should be retrieved. When I run the EXPLAIN command, it shows that it goes through almost 40k rows, when the actual result (the reality matching companies) are 80. How can I optimize this? This is my query (XXX represent the n-grams for the search query): SELECT provincias.provincia AS provincia, provincias.id, COUNT(*) AS cantidad FROM anunciantes JOIN anunciante_invertido AS a_i0 ON anunciantes.id = a_i0.id_anunciante JOIN indice_invertido AS indice0 ON a_i0.id_invertido = indice0.id LEFT OUTER JOIN domicilios ON anunciantes.id = domicilios.id_anunciante LEFT OUTER JOIN localidades ON domicilios.id_localidad = localidades.id LEFT OUTER JOIN provincias ON provincias.id = localidades.id_provincia WHERE anunciantes.estado = 1 AND indice0.id IN (SELECT invertido_ngrama.id_palabra FROM invertido_ngrama JOIN ngrama ON ngrama.id = invertido_ngrama.id_ngrama WHERE ngrama.ngrama = 'XXX') AND indice0.id IN (SELECT invertido_ngrama.id_palabra FROM invertido_ngrama JOIN ngrama ON ngrama.id = invertido_ngrama.id_ngrama WHERE ngrama.ngrama = 'XXX') AND indice0.id IN (SELECT invertido_ngrama.id_palabra FROM invertido_ngrama JOIN ngrama ON ngrama.id = invertido_ngrama.id_ngrama WHERE ngrama.ngrama = 'XXX') AND indice0.id IN (SELECT invertido_ngrama.id_palabra FROM invertido_ngrama JOIN ngrama ON ngrama.id = invertido_ngrama.id_ngrama WHERE ngrama.ngrama = 'XXX') AND indice0.id IN (SELECT invertido_ngrama.id_palabra FROM invertido_ngrama JOIN ngrama ON ngrama.id = invertido_ngrama.id_ngrama WHERE ngrama.ngrama = 'XXX') GROUP BY provincias.id ORDER BY cantidad DESC And this is the query explained (hope it can be read in this format): id select_type table type possible_keys key key_len ref rows Extra 1 PRIMARY anunciantes ref PRIMARY,estado estado 1 const 36669 Using index; Using temporary; Using filesort 1 PRIMARY domicilios ref id_anunciante id_anunciante 4 db84771_viaempresas.anunciantes.id 1 1 PRIMARY localidades eq_ref PRIMARY PRIMARY 4 db84771_viaempresas.domicilios.id_localidad 1 1 PRIMARY provincias eq_ref PRIMARY PRIMARY 4 db84771_viaempresas.localidades.id_provincia 1 1 PRIMARY a_i0 ref PRIMARY,id_anunciante,id_invertido PRIMARY 4 db84771_viaempresas.anunciantes.id 1 Using where; Using index 1 PRIMARY indice0 eq_ref PRIMARY PRIMARY 4 db84771_viaempresas.a_i0.id_invertido 1 Using index 6 DEPENDENT SUBQUERY ngrama const PRIMARY,ngrama ngrama 5 const 1 Using index 6 DEPENDENT SUBQUERY invertido_ngrama eq_ref PRIMARY,id_palabra,id_ngrama PRIMARY 8 func,const 1 Using index 5 DEPENDENT SUBQUERY ngrama const PRIMARY,ngrama ngrama 5 const 1 Using index 5 DEPENDENT SUBQUERY invertido_ngrama eq_ref PRIMARY,id_palabra,id_ngrama PRIMARY 8 func,const 1 Using index 4 DEPENDENT SUBQUERY ngrama const PRIMARY,ngrama ngrama 5 const 1 Using index 4 DEPENDENT SUBQUERY invertido_ngrama eq_ref PRIMARY,id_palabra,id_ngrama PRIMARY 8 func,const 1 Using index 3 DEPENDENT SUBQUERY ngrama const PRIMARY,ngrama ngrama 5 const 1 Using index 3 DEPENDENT SUBQUERY invertido_ngrama eq_ref PRIMARY,id_palabra,id_ngrama PRIMARY 8 func,const 1 Using index 2 DEPENDENT SUBQUERY ngrama const PRIMARY,ngrama ngrama 5 const 1 Using index 2 DEPENDENT SUBQUERY invertido_ngrama eq_ref PRIMARY,id_palabra,id_ngrama PRIMARY 8 func,const 1 Using index

    Read the article

  • How to turn this linq query to lazy loading

    - by Luke101
    I would like to make a certain select item to lazy load latter in my linq query. Here is my query var posts = from p in context.post where p.post_isdeleted == false && p.post_parentid == null select new { p.post_date, p.post_id, p.post_titleslug, p.post_votecount, FavoriteCount = context.PostVotes.Where(x => x.PostVote_postid == p.post_id).Count() //this should load latter }; I have deleted the FavoriteCount item in the select query and would like it to ba added later based on certain conditions. Here is the way I have it lazy loaded if (GetFavoriteInfo) { posts = posts.Select(x => new { FavoriteCount = context.PostVotes.Where(y => y.PostVote_postid == x.post_id).Count() }); } I am getting a syntax error with this the above query. How do I fix this

    Read the article

  • PHP MySQL Weird Update Problem

    - by Tim
    I have a heap based table in MySQL that I am trying to update via PHP, but for some reason, the updates do not seem to be taking place. Here is my test code: <?php $freepoints[] = 1; $freepoints[] = 2; $freepoints[] = 3; foreach ($freepoints as $entrypoint) { $query = "update gates set lane='{$entrypoint}' where traffic > 50 limit 50"; echo "$query\n"; mysql_query($query); echo mysql_affected_rows()."\n"; } ?> This outputs the following: update gates set lane='1' where traffic > 50 limit 50 50 update gates set lane='2' where traffic > 50 limit 50 50 update gates set lane='3' where traffic > 50 limit 50 50 In the database to start with lanes 1/2/3 had 0 records and lanes 4/5/6 had 100 records. From this I am expecting all 6 lanes to now have 50 records each. However when I look lanes 4/5/6 still have 100 records and 1/2/3 still have 0 records. When I copy the query "update gates set lane='1' where traffic 50 limit 50" into phpMyAdmin it works absolutely fine, so any ideas why it isn't working in my PHP script when mysql_affected_rows is saying it has updated 50 records?

    Read the article

  • LINQtoSQL: Query to return List<String>

    - by ctrlShiftBryan
    I have a LINQ query that returns some object like this... var query = from c in db.Customers where ... select c; Then I do this List<String> list = new List<String>(); foreach (ProgramLanguage c in query) { //GetUL returns a String list.Add(GetUL(c.Property,c.Property2)); } Is there a way to combine into something list this? var query = from c in db.Customers where ... select new { GetUL(c.Property,c.Property2) }).ToList<String>();

    Read the article

  • how to call update query in procedure of oracle

    - by Deven
    how to call update query in procedure of oracle hello friends i am having one table t1 in which i am having userid, week and year fields r there if i want to call procedure which takes all three values as arguments and fire update query how can i do it my update query should be like update t1 set week = (value of procedure argument) , year = (value of procedure argument) where userid=(value of procedure argument);

    Read the article

  • Conditionally Summing the same Column multiple times in a single select statement?

    - by btollett
    I have a single table that shows employee deployments, for various types of deployment, in a given location for each month: ID | Location_ID | Date | NumEmployees | DeploymentType_ID As an example, a few records might be: 1 | L1 | 12/2010 | 7 | 1 (=Permanent) 2 | L1 | 12/2010 | 2 | 2 (=Temp) 3 | L1 | 12/2010 | 1 | 3 (=Support) 4 | L1 | 01/2011 | 4 | 1 5 | L1 | 01/2011 | 2 | 2 6 | L1 | 01/2011 | 1 | 3 7 | L2 | 12/2010 | 6 | 1 8 | L2 | 01/2011 | 6 | 1 9 | L2 | 12/2010 | 3 | 2 What I need to do is sum the various types of people by date, such that the results look something like this: Date | Total Perm | Total Temp | Total Supp 12/2010 | 13 | 5 | 1 01/2011 | 10 | 2 | 1 Currently, I've created a separate query for each deployment type that looks like this: SELECT Date, SUM(NumEmployees) AS "Total Permanent" FROM tblDeployment WHERE DeploymentType_ID=1 GROUP BY Date; We'll call that query qSumPermDeployments. Then, I'm using a couple of joins to combine the queries: SELECT qSumPermDeployments.Date, qSumPermDeployments.["Total Permanent"] AS "Permanent" qSumTempDeployments.["Total Temp"] AS "Temp" qSumSupportDeployments.["Total Support"] AS Support FROM (qSumPermDeployments LEFT JOIN qSumTempDeployments ON qSumPermDeployments.Date = qSumTempDeployments.Date) LEFT JOIN qSumSupportDeployments ON qSumPermDeployments.Date = qSumSupportDeployments.Date; Note that I'm currently constructing that final query under the assumption that a location will only have temp or support employees if they also have permanent employees. Thus, I can create the joins using the permanent employee results as the base table. Given all of the data I currently have, that assumption holds up, but ideally I'd like to move away from that assumption. So finally, my question. Is there a way to simplify this down to a single query or is it best to separate it out into multiple queries - if for no other reason that readability.

    Read the article

  • Datetime comparaison in CAML Query for Sharepoint

    - by Garcia Julien
    Hi, i'm trying to have some item from a sharepoint list, depends on date in a custom column. I've created my query with 2U2 Caml Builder, and that's worked but when I put it in my own code in my webpart, it always return to me all the items od the list. Here is my code: DateTime startDate = new DateTime(Int32.Parse(year), 1, 1); DateTime endDate = new DateTime(Int32.Parse(year), 12, 31); SPQuery q = new SPQuery(); q.Query = "<Query><Where><And><Geq><FieldRef Name='Publicate Date' /><Value IncludeTimeValue='FALSE' Type='DateTime'>" + SPUtility.CreateISO8601DateTimeFromSystemDateTime(startDate) + "</Value></Geq><Leq><FieldRef Name='Publicate_x0020_Date' /><Value IncludeTimeValue='FALSE' Type='DateTime'>" + SPUtility.CreateISO8601DateTimeFromSystemDateTime(endDate) + "</Value></Leq></And></Where></Query>"; SPListItemCollection allItem = library.GetItems(q);

    Read the article

  • Sql inline query with parameters. Parameter is not read when the query is executed.

    - by fzshah76
    Hi All: I am having a problem with my sql query in c#, basically it's inline query with parameters, but when I run it it tells me that parameter 1 or parameter 2 is not there here is my query declared on top of the page as public: public const string InsertStmtUsersTable = "insert into Users (username, password, email, userTypeID, memberID, CM7Register) " + "Values(@username, @password, @email, @userTypeID, @memberID,@CM7Register ); select @@identity"; this is my code for assigning the parameters, I know I am having problem so I am assigning the params twice: Username =(cmd.Parameters["@username"].Value = row["username"].ToString()) as string; cmd.Parameters["@username"].Value = row["username"].ToString(); In 1 methopd it calls this query and tries to insert to table, here is the code: Result = Convert.ToInt32(SqlHelper.ExecuteScalar(con, CommandType.Text,InsertStmtUsersTable)); Exact error message is: Must declare the variable '@username'.

    Read the article

  • Linq query joining with a subquery

    - by Alan Fisher
    I am trying to reproduce a SQL query using a LINQ to Entities query. The following SQL works fine, I just don't see how to do it in LINQ. I have tried for a few hours today but I'm just missing something. SELECT h.ReqID, rs.RoutingSection FROM ReqHeader h JOIN ReqRoutings rr ON rr.ReqRoutingID = (SELECT TOP 1 r1.ReqRoutingID FROM ReqRoutings r1 WHERE r1.ReqID = h.ReqID ORDER BY r1.ReqRoutingID desc) JOIN ReqRoutingSections rs ON rs.RoutingSectionID = rr.RoutingSectionID Edit*** Here is my table scema- Requisitions: ReqID PK string ReqDate datetime etc... ReqRoutings: ID PK int ReqID FK RoutingSection FK int RoutingDate ReqRoutingSections: Id PK int RoutingSection string The idea is that each Requisition can be routed many times, for my query I need the last RoutingSection to be returned along with the Requisition info. Sample data: Requisitions: - 1 record ReqID 123456 ReqDate '12/1/2012' ReqRoutings: -- 3 records id 1 ReqID 123456 RoutingSection 3 RoutingDate '12/2/2012' id 2 ReqID 123456 RoutingSection 2 RoutingDate '12/3/2012' id 3 ReqID 123456 RoutingSection 4 RoutingDate '12/4/2012' ReqRoutingSections: -- 3 records id 2 Supervision id 3 Safety id 4 Qaulity Control The results of the query would be ReqID = '123456' RoutingSection = 'QualityControl' -- Last RoutingSection requisition was routed to

    Read the article

  • CakePHP - get last query run

    - by Phantz
    I want to get the last query CakePHP ran. I can't turn debug on in core.php and I can't run the code locally. I need a way to get the last sql query and log it to the error log without effecting the live site. This query is failing but is being run. something like this would be great: $this->log($this->ModelName->lastQuery); Thanks in advance.

    Read the article

  • wordpress generating slow mysql queries - is it index problem?

    - by tash
    Hello Stack Overflow I've got very slow Mysql queries coming up from my wordpress site. It's making everything slow and I think this is eating up CPU usage. I've pasted the Explain results for the two most frequently problematic queries below. This is a typical result - although very occasionally teh queries do seem to be performed at a more normal speed. I have the usual wordpress indexes on the database tables. You will see that one of the queries is generated from wordpress core code, and not from anything specific - like the theme - for my site. I have a vague feeling that the database is not always using the indexes/is not using them properly... Is this right? Does anyone know how to fix it? Or is it a different problem entirely? Many thanks in advance for any help anyone can offer - it is hugely appreciated Query: [wp-blog-header.php(14): wp()] SELECT SQL_CALC_FOUND_ROWS wp_posts.* FROM wp_posts WHERE 1=1 AND wp_posts.post_type = 'post' AND (wp_posts.post_status = 'publish' OR wp_posts.post_status = 'private') ORDER BY wp_posts.post_date DESC LIMIT 0, 6 id select_type table type possible_keys key key_len ref rows Extra 1 SIMPLE wp_posts ref type_status_date type_status_date 63 const 427 Using where; Using filesort Query time: 34.2829 (ms) 9) Query: [wp-content/themes/LMHR/index.php(40): query_posts()] SELECT SQL_CALC_FOUND_ROWS wp_posts.* FROM wp_posts WHERE 1=1 AND wp_posts.ID NOT IN ( SELECT tr.object_id FROM wp_term_relationships AS tr INNER JOIN wp_term_taxonomy AS tt ON tr.term_taxonomy_id = tt.term_taxonomy_id WHERE tt.taxonomy = 'category' AND tt.term_id IN ('217', '218', '223', '224') ) AND wp_posts.post_type = 'post' AND (wp_posts.post_status = 'publish' OR wp_posts.post_status = 'private') ORDER BY wp_posts.post_date DESC LIMIT 0, 6 id select_type table type possible_keys key key_len ref rows Extra 1 PRIMARY wp_posts ref type_status_date type_status_date 63 const 427 Using where; Using filesort 2 DEPENDENT SUBQUERY tr ref PRIMARY,term_taxonomy_id PRIMARY 8 func 1 Using index 2 DEPENDENT SUBQUERY tt eq_ref PRIMARY,term_id_taxonomy,taxonomy PRIMARY 8 antin1_lovemusic2010.tr.term_taxonomy_id 1 Using where Query time: 70.3900 (ms)

    Read the article

  • Duplicate an AppEngine Query object to create variations of a filter without affecting the base quer

    - by Steve Mayne
    In my AppEngine project I have a need to use a certain filter as a base then apply various different extra filters to the end, retrieving the different result sets separately. e.g.: base_query = MyModel.all().filter('mainfilter', 123) Then I need to use the results of various sub queries separately: subquery1 = basequery.filter('subfilter1', 'xyz') #Do something with subquery1 results here subquery2 = basequery.filter('subfilter2', 'abc') #Do something with subquery2 results here Unfortunately 'filter()' affects the state of the basequery Query instance, rather than just returning a modified version. Is there any way to duplicate the Query object and use it as a base? Is there perhaps a standard Python way of duping an object that could be used? The extra filters are actually applied by the results of different forms dynamically within a wizard, and they use the 'running total' of the query in their branch to assess whether to ask further questions. Obviously I could pass around a rudimentary stack of filter criteria, but I'd rather use the Query itself if possible, as it adds simplicity and elegance to the solution.

    Read the article

  • What to name 2 methods with same signatures

    - by coffeeaddict
    Initially I had a method in our DL that would take in the object it's updating like so: internal void UpdateCash(Cash Cash) { using (OurCustomDbConnection conn = CreateConnection("UpdateCash")) { conn.CommandText = @"update Cash set captureID = @captureID, ac_code = @acCode, captureDate = @captureDate, errmsg = @errorMessage, isDebit = @isDebit, SourceInfoID = @sourceInfoID, PayPalTransactionInfoID = @payPalTransactionInfoID, CreditCardTransactionInfoID = @CreditCardTransactionInfoID where id = @cashID"; conn.AddParam("@captureID", cash.CaptureID); conn.AddParam("@acCode", cash.ActionCode); conn.AddParam("@captureDate", cash.CaptureDate); conn.AddParam("@errorMessage", cash.ErrorMessage); conn.AddParam("@isDebit", cyberCash.IsDebit); conn.AddParam("@PayPalTransactionInfoID", cash.PayPalTransactionInfoID); conn.AddParam("@CreditCardTransactionInfoID", cash.CreditCardTransactionInfoID); conn.AddParam("@sourceInfoID", cash.SourceInfoID); conn.AddParam("@cashID", cash.Id); conn.ExecuteNonQuery(); } } My boss felt that creating an object every time just to update one or two fields is overkill. But I had a couple places in code using this. He recommended using just UpdateCash and sending in the ID for CAsh and field I want to update. Well the problem is I have 2 places in code using my original method. And those 2 places are updating 2 completely different fields in the Cash table. Before I was just able to get the existing Cash record and shove it into a Cash object, then update the properties I wanted to be updated in the DB, then send back the cash object to my method above. I need some advice on what to do here. I have 2 methods and they have the same signature. I'm not quite sure what to rename these because both are updating 2 completely different fields in the Cash table: internal void UpdateCash(int cashID, int paypalCaptureID) { using (OurCustomDbConnection conn = CreateConnection("UpdateCash")) { conn.CommandText = @"update Cash set CaptureID = @paypalCaptureID where id = @cashID"; conn.AddParam("@captureID", paypalCaptureID); conn.ExecuteNonQuery(); } } internal void UpdateCash(int cashID, int PayPalTransactionInfoID) { using (OurCustomDbConnection conn = CreateConnection("UpdateCash")) { conn.CommandText = @"update Cash set PaymentSourceID = @PayPalTransactionInfoID where id = @cashID"; conn.AddParam("@PayPalTransactionInfoID", PayPalTransactionInfoID); conn.ExecuteNonQuery(); } } So I thought hmm, maybe change the names to these so that they are now unique and somewhat explain what field its updating: UpdateCashOrderID UpdateCashTransactionInfoID ok but that's not really very good names. And I can't go too generic, for example: UpdateCashTransaction(int cashID, paypalTransactionID) What if we have different types of transactionIDs that the cash record holds besides just the paypalTransactionInfoID? such as the creditCardInfoID? Then what? Transaction doesn't tell me what kind. And furthermore what if you're updating 2 fields so you have 2 params next to the cashID param: UpdateCashTransaction(int cashID, paypalTransactionID, someOtherFieldIWantToUpdate) see my frustration? what's the best way to handle this is my boss doesn't like my first route?

    Read the article

  • giving a query as part of a uri in autobench

    - by Deepika
    I am using autobench for doing becnhmark. An example of autobench command is as shown below. autobench --single_host --host1 testhost.foo.com --uri1 /index.html --quiet --timeout 5 --low_rate 20 --high_rate 200 --rate_step 20 --num_call 10 --num_conn 5000 --file bench.tsv** The uri which I have to specify has a query attached to it. When I run the command which has the query, I get the following result dem_req_rate req_rate_localhost con_rate_localhost min_rep_rate_localhost avg_rep_rate_localhost max_rep_rate_localhost stddev_rep_rate_localhost resp_time_localhost net_io_localhost errors_localhost 200 0 20 0 0 0 0 0 0 101 400 0 40 0 0 0 0 0 0 101 600 0 60 0 0 0 0 0 0 101 800 0 80 0 0 0 0 0 0 101 1000 0 100 0 0 0 0 0 0 101 1200 0 120 0 0 0 0 0 0 101 1400 0 140 0 0 0 0 0 0 101 1600 0 160 0 0 0 0 0 0 101 1800 0 180 0 0 0 0 0 0 101 2000 0 200 0 0 0 0 0 0 101 The query request, response are all zeroes. Can anybody please tell me how to give a query as part of the uri? Thank you in advance

    Read the article

  • Mocking methods that call other methods Still hit database.Can I avoid it?

    - by devnet247
    Hi, It has been decided to write some unit tests using moq etc..It's lots of legacy code c# (this is beyond my control so cannot answer the whys of this) Now how do you cope with a scenario when you dont want to hit the database but you indirectly still hit the database? This is something I put together it's not the real code but gives you an idea. How would you deal with this sort of scenario? Basically calling a method on a mocked interface still makes a dal call as inside that method there are other methods not part of that interface?Hope it's clear [TestFixture] public class Can_Test_this_legacy_code { [Test] public void Should_be_able_to_mock_login() { var mock = new Mock<ILoginDal>(); User user; var userName = "Jo"; var password = "password"; mock.Setup(x => x.login(It.IsAny<string>(), It.IsAny<string>(),out user)); var bizLogin = new BizLogin(mock.Object); bizLogin.Login(userName, password, out user); } } public class BizLogin { private readonly ILoginDal _login; public BizLogin(ILoginDal login) { _login = login; } public void Login(string userName, string password, out User user) { //Even if I dont want to this will call the DAL!!!!! var bizPermission = new BizPermission(); var permissionList = bizPermission.GetPermissions(userName); //Method I am actually testing _login.login(userName,password,out user); } } public class BizPermission { public List<Permission>GetPermissions(string userName) { var dal=new PermissionDal(); var permissionlist= dal.GetPermissions(userName); return permissionlist; } } public class PermissionDal { public List<Permission> GetPermissions(string userName) { //I SHOULD NOT BE GETTING HERE!!!!!! return new List<Permission>(); } } public interface ILoginDal { void login(string userName, string password,out User user); } public interface IOtherStuffDal { List<Permission> GetPermissions(); } public class Permission { public int Id { get; set; } public string Name { get; set; } } Any suggestions? Am I missing the obvious? Is this Untestable code? Very very grateful for any suggestions.

    Read the article

  • how can i pass parameter to linq query

    - by girish
    i want to pass parameter to linq query... public IEnumerable GetPhotos() { PhotoDBDataContext db = new PhotoDBDataContext(); var tProduct = db.Photos; var query = from p in db.Photos orderby p.PhotoId descending select new { p.Album, p.AlbumId, p.Description, p.Photographer, p.PhotographerId, p.PhotoId, p.Tags, p.Thumbnail, p.Url }; return query; } in above example "orderby p.PhotoId descending" is used, i want to use parameter in place of p.PhotoId is it possible...

    Read the article

  • Fulltext and composite indexes and how they affect the query

    - by Brett
    Just say I had a query as below.. SELECT name,category,address,city,state FROM table WHERE MATCH(name,subcategory,category,tag1) AGAINST('education') AND city='Oakland' AND state='CA' LIMIT 0, 10; ..and I had a fulltext index as name,subcategory,category,tag1 and a composite index as city,state; is this good enough for this query? Just wondering if something extra is needed when mixing additional AND's when making use of the fulltext index with the MATCH/AGAINST. Edit: What I am trying to understand is, what happens with the additional columns that are within the query but are not indexed in the chosen index (the fulltext index), the above example being city and state. How does MySQL now find the matching rows for these since it can't use two indexes (or can it?) - so, basically, I'm trying to understand how MySQL goes about finding the data optimally for the columns NOT in the chosen fulltext index and if there is anything I can or should do to optimize the query.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Zend Framework - counting rows in select clause ?

    - by moogeek
    Hello! I'm investigating Zend Framework and currently stucked in counting resulting rows of sql query... Every method I try (from documentation and some blogposts and tutorials) returns an error (like Call to undefined function) or simply gives the incorrect value. I've tried this: $checkquery = $db->select() ->from('users', 'COUNT(*)') ->where('login = ?', $login) ->where('password = ?', $password) ->query(); $checkrequest=fetchRow($checkquery)->num; ...then this one: $checkquery = $db->select() ->from('users', '*') ->where('login = ?', $login) ->where('password = ?', $password) ->query(); $checkrequest=count($checkquery->fetchAll()); and even: $checkquery = $db->select() ->from('users', '*') ->where('login = ?', $login) ->where('password = ?', $password) ->query(); $checkrequest=$checkquery->fetchAll()->num; Also rowCount() and count(fetchRow()) and count(fetchAll()->toArray()). But always I got an error message or duplicate inserts in db in further insert function. So what is the correct way to do the resulting row calculation in select clause in Zend Framework 1.9 (I use this one) ?

    Read the article

  • What are the advantages of a query using a derived table(s) over a query not using them?

    - by AspOnMyNet
    I know how derived tables are used, but I still can’t really see any real advantages of using them. For example, in the following article http://techahead.wordpress.com/2007/10/01/sql-derived-tables/ the author tried to show benefits of a query using derived table over a query without one with an example, where we want to generate a report that shows off the total number of orders each customer placed in 1996, and we want this result set to include all customers, including those that didn’t place any orders that year and those that have never placed any orders at all( he’s using Northwind database ). But when I compare the two queries, I fail to see any advantages of a query using a derived table ( if nothing else, use of a derived table doesn't appear to simplify our code, at least not in this example): Regular query: SELECT C.CustomerID, C.CompanyName, COUNT(O.OrderID) AS TotalOrders FROM Customers C LEFT OUTER JOIN Orders O ON C.CustomerID = O.CustomerID AND YEAR(O.OrderDate) = 1996 GROUP BY C.CustomerID, C.CompanyName Query using a derived table: SELECT C.CustomerID, C.CompanyName, COUNT(dOrders.OrderID) AS TotalOrders FROM Customers C LEFT OUTER JOIN (SELECT * FROM Orders WHERE YEAR(Orders.OrderDate) = 1996) AS dOrders ON C.CustomerID = dOrders.CustomerID GROUP BY C.CustomerID, C.CompanyName Perhaps this just wasn’t a good example, so could you show me an example where benefits of derived table are more obvious? thanx

    Read the article

  • pl/sql Oracle syntax

    - by Paul
    I have a query in pl/sql that i need to migrate to ms sql. select count(*) from table1 t1 where (conditions1) and (conditions2) and variable = t1.column1(+) Could anyone tell me what the (+) after the column means ? (is it sort of a sum ?)

    Read the article

  • a query is inserted from PHPMYAdmin but not from PHP

    - by iyad al aqel
    i'm writing a php code to insert form values in a forum values $dbServer = mysql_connect("localhost" , "root", "") ; if(!$dbServer) die ("Unable to connect"); mysql_select_db("kfumWonder"); $name= $_POST['name'] ; $password= md5($_POST['password']); $email= $_POST['email'] ; $major= $_POST['major'] ; $dateOfBirth=$_POST['dateOfBirth'] ; $webSite = $_POST['website']; $joinDate= date("Y m d") ; $query = "INSERT INTO user (name, password, email, major, dob, website, join_date) Values ('$name', '$password', '$email', '$major', '$dateOfBirth', '$webSite' , '$joinDate')" ; //echo $query ; $result = mysql_query($query) ; if (! $result ) echo " no results " ; this works perfectly fine when i took the printed query and run it in PHPMyAdmin but when i run this code nothing happens , any ideas !?

    Read the article

  • Query a stored procedure for it's parameter names and types

    - by ho1
    Is there any easy way to query a stored procedure (Oracle - PL/SQL) for what parameters it expects? I know that I can query USER_SOURCE to get the whole procedure but I'd then have to parse the whole procedure, and if the parameter is of type [table].[column]%TYPE I'd then have to query the table schema as well. Either using just sql or via ODP.Net.

    Read the article

< Previous Page | 129 130 131 132 133 134 135 136 137 138 139 140  | Next Page >