Search Results

Search found 9830 results on 394 pages for 'percent complete'.

Page 134/394 | < Previous Page | 130 131 132 133 134 135 136 137 138 139 140 141  | Next Page >

  • replace the line to add some text

    - by shantanuo
    The MySQL dump backup file has the following line... # head -40 backup20-Apr-2010-07-32.sql | grep 'CHANGE MASTER TO ' -- CHANGE MASTER TO MASTER_LOG_FILE='mysql-bin.000068', MASTER_LOG_POS=176357756; a) I need to complete the statement with the parameters like Master host, user and password. b) I do also need to remove the comment "--" The line should look something like this... CHANGE MASTER TO MASTER_HOST='111.222.333.444', MASTER_USER='slave_user', MASTER_PASSWORD='slave_user', MASTER_LOG_FILE='mysql-bin.000068', MASTER_LOG_POS=176357756;

    Read the article

  • How to turn on monitor after wake-up from suspend mode?

    - by alek.sys
    Hi all, I need wake up PC from sleep to perform some actions - from C#. I've used CreateWaitableTimer functions, everything goes fine, at given time PC wakes up - but monitor stays in power save mode (turned off). So i want to know - how possible to turn on monitor after wake up? PS I've tried "Complete Guide on How To Turn A Monitor On/Off/Standby" - with SendMessage (Codeproject) and SetThreadExecutionState(ES_DISPLAY_REQUIRED) - it doesn't work Any ideas?

    Read the article

  • Online webpage archive service

    - by the_void
    Hello, I am looking for a service that can take a snapshot of a webpage at a certain time and save it online. Something like: http://www.diigo.com or http://www.iterasi.net/ (like a bookmark, but also with content). The first doesn't do that well with javascript and doesn't save the complete page while the latter doesn't have free accounts any more.

    Read the article

  • How to change button background image on mouseOver?

    - by slave016
    I have img1, and img2 in my resources. I have easily set btn.backgroundImage as img1 in btn properties. Images paths are: c:\Project\Resources... Now I don't know how to set btn.backgroundImage to be img2, I want to do it on event "MouseEnter". So I would apreciate complete code, because I am pretty green about this... I apreciate any given idea...

    Read the article

  • Ruby / rubyzip alternative capable of handling rar/tar/zip/7z?

    - by Nick Gorbikoff
    I was wondering if anyone knows of rubyzip alternatives for Ruby, that can handle various formats in particular zip / rar / 7z? I know of libarchive, but it's not complete for my purposes ( it's a good gem thou). (To clarify, libarchive - won't work for me - cause I need to be able to run in on Windows. ( Yeah I know sucks to be me)) Right now I end up running system commands to the os, but I'd like something OS independent, and capable of handling those formats - reading and writing. Thank you

    Read the article

  • Where the hell is shared_ptr!?!

    - by Jake
    I am so frustrated right now after several hours trying to find where the hell is shared_ptr located at. None of the examples i see show complete code to include the headers for shared_ptr (and working). simply stating "std" "tr1" and "" is not helping at all! I have downloaded boosts and all but still it doesn't show up! Can someone help me by telling exactly where to find it? Thanks for letting me vent my frustrations!

    Read the article

  • pthread and child process data sharing in C

    - by mustafabattal
    hi everyone, my question is somewhat conceptual, how is parent process' data shared with child process created by a "fork()" call or with a thread created by "pthread_create()" for example, are global variables directly passed into child process and if so, does modification on that variable made by child process effect value of it in parent process? i appreciate partial and complete answers in advance, if i'm missing any existing resource, i'm sorry, i've done some search on google but couldn't find good results thanks again for your time and answers

    Read the article

  • SQLAlchemy - select for update example

    - by Mark
    I'm looking for a complete example of using select for update in SQLAlchemy, but haven't found one googling. I need to lock a single row and update a column, the following code doesn't work (blocks forever): s = table.select(table.c.user=="test",for_update=True) u = table.update().where(table.c.user=="test") u.execute(email="foo") Do I need a commit? How do I do that? As far as I know you need to: begin transaction select ... for update update commit

    Read the article

  • JQUERY animate Delay?

    - by AnApprentice
    I'm using JQUERY animate to show a banner at the top of the page, which is a DIV that is set to top -60 to hide it. I'm using the following JS call to show the div: // Animation $('#message-dock').animate({ top: 0 }, 500, function() { // Animation complete. }); What I can't figure out is for some reason there is an unwanted delay before I start seeing the div and I can't figure out why? Any Ideas?

    Read the article

  • How can I create an editable combo box in HTML/Javascript?

    - by Christian Davén
    I need to let users select an item from a dropdown list, but also allow them to instead enter any text, even if it doesn't match an item in the list. How can I achieve this on a web page with HTML and Javascript? The select field doesn't let users enter text, and the input text field doesn't show the preferred alternatives. All items must show if the user opens the dropdown, so it can't be a simple auto-complete that only shows matching items.

    Read the article

  • Auto-Completion in Unix VI editor

    - by IllustratedInsomnia
    Hey guys, after using graphical IDE's like Visual Studio, I'm used to pressing CTRL+Space to auto-complete a variable or function name. Now, I know such a thing isn't completely possible in VI, but I heard there was a list of commands that could be mapped that allowed automatic completion of variables and functions in the current file opened. Does anyone know what this sequence is? Thanks in advance.

    Read the article

  • Code Contracts Vs. Object Initializers (.net 4.0)

    - by Mystagogue
    At face value, it would seem that object initializers present a problem for .net 4.0 "code contracts", where normally the invariant should be established by the time the object constructor is finished. Presumably, however, object-initializers require properties to be set after construction is complete. My question is if the invariants of "code contracts" are able to handle object initializers, "as if" the properties were set before the constructor completes? That would be very nice indeed!!

    Read the article

  • Javascript expando objects

    - by xyz
    What are expando objects in javascripts? For what purpose we need this ? Any complete example will be appreciated I found 1 article here Javascript: The red-headed stepchild of web development Thanks

    Read the article

  • Restoring older firmware through XCode?

    - by Moshe
    I'm trying to restore iPhone OS 3.1.3 to a 3GS that has been upgraded to iOS 4. iTunes refuses to complete the install. What needs to be done? I am currently using the GM XCode. Should I be using the latest public stable version instead? Update: XCode reports that "The baseband cannot be rolled back".

    Read the article

  • Removing the transperancy from image while keeping the actual image

    - by KPL
    Hello people, I have three images,and , they are not square or rectangular in shape. They are just like face of anyone. So,basically, my images are in the size 196x196 or anything like that, but complete square or rectangle with the face in the middle and transperant background in the rest of the portion. Now, I want to remove the transperant background too and just keep the faces. Don't know if this is possible and mind you, this isn't a programming question.

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • How to keep iPhone app out of iPad store?

    - by Eric
    I have an iPhone app that I have started to turn into a universal app, however the process is not complete and I want to release an update to the iPhone version. I know that you can specify device capabilities in the Info.plist file to restrict your app to certain devices, but how can I do this to prevent the unfinished universal version from appearing in the iPad store? Is checking the LSRequiresiPhoneOS BOOL entry (in the Info.plist file) enough? Thanks!

    Read the article

< Previous Page | 130 131 132 133 134 135 136 137 138 139 140 141  | Next Page >