Search Results

Search found 13534 results on 542 pages for 'python 3 1'.

Page 134/542 | < Previous Page | 130 131 132 133 134 135 136 137 138 139 140 141  | Next Page >

  • Python interface to PayPal - urllib.urlencode non-ASCII characters failing

    - by krys
    I am trying to implement PayPal IPN functionality. The basic protocol is as such: The client is redirected from my site to PayPal's site to complete payment. He logs into his account, authorizes payment. PayPal calls a page on my server passing in details as POST. Details include a person's name, address, and payment info etc. I need to call a URL on PayPal's site internally from my processing page passing back all the params that were passed in abovem and an additional one called 'cmd' with a value of '_notify-validate'. When I try to urllib.urlencode the params which PayPal has sent to me, I get a: While calling send_response_to_paypal. Traceback (most recent call last): File "<snip>/account/paypal/views.py", line 108, in process_paypal_ipn verify_result = send_response_to_paypal(params) File "<snip>/account/paypal/views.py", line 41, in send_response_to_paypal params = urllib.urlencode(params) File "/usr/local/lib/python2.6/urllib.py", line 1261, in urlencode v = quote_plus(str(v)) UnicodeEncodeError: 'ascii' codec can't encode character u'\ufffd' in position 9: ordinal not in range(128) I understand that urlencode does ASCII encoding, and in certain cases, a user's contact info can contain non-ASCII characters. This is understandable. My question is, how do I encode non-ASCII characters for POSTing to a URL using urllib2.urlopen(req) (or other method) Details: I read the params in PayPal's original request as follows (the GET is for testing): def read_ipn_params(request): if request.POST: params= request.POST.copy() if "ipn_auth" in request.GET: params["ipn_auth"]=request.GET["ipn_auth"] return params else: return request.GET.copy() The code I use for sending back the request to PayPal from the processing page is: def send_response_to_paypal(params): params['cmd']='_notify-validate' params = urllib.urlencode(params) req = urllib2.Request(PAYPAL_API_WEBSITE, params) req.add_header("Content-type", "application/x-www-form-urlencoded") response = urllib2.urlopen(req) status = response.read() if not status == "VERIFIED": logging.warn("PayPal cannot verify IPN responses: " + status) return False return True Obviously, the problem only arises if someone's name or address or other field used for the PayPal payment does not fall into the ASCII range.

    Read the article

  • Python: slicing a very large binary file

    - by Duncan Tait
    Say I have a binary file of 12GB and I want to slice 8GB out of the middle of it. I know the position indices I want to cut between. How do I do this? Obviously 12GB won't fit into memory, that's fine, but 8GB won't either... Which I thought was fine, but it appears binary doesn't seem to like it if you do it in chunks! I was appending 10MB at a time to a new binary file and there are discontinuities on the edges of each 10MB chunk in the new file. Is there a Pythonic way of doing this easily?

    Read the article

  • Searching a list of tuples in python

    - by Niclas Nilsson
    I'm having a database (sqlite) of members of an organisation (less then 200 people). Now I'm trying to write an wx app that will search the database and return some contact information in a wx.grid. The app will have 2 TextCtrls, one for the first name and one for the last name. What I want to do here is make it possible to only write one or a few letters in the textctrls and that will start to return result. So, if I search "John Smith" I write "Jo" in the first TextCtrl and that will return every single John (or any one else having a name starting with those letters). It will not have an "search"-button, instead it will start searching whenever I press a key. One way to solve this would be to search the database with like " SELECT * FROM contactlistview WHERE forname LIKE 'Jo%' " But that seems like a bad idea (very database heavy to do that for every keystroke?). Instead i thought of use fetchall() on a query like this " SELECT * FROM contactlistview " and then, for every keystroke, search the list of tuples that the query have returned. And that is my problem: Searching a list is not that difficult but how can I search a list of tuples with wildcards?

    Read the article

  • Decoding not reversing unicode encoding in Django/Python

    - by PhilGo20
    Ok, I have a hardcoded string I declare like this name = u"Par Catégorie" I have a # -- coding: utf-8 -- magic header, so I am guessing it's converted to utf-8 Down the road it's outputted to xml through xml_output.toprettyxml(indent='....', encoding='utf-8') And I get a UnicodeDecodeError: 'ascii' codec can't decode byte 0xc3 in position 3: ordinal not in range(128) Most of my data is in French and is ouputted correctly in CDATA nodes, but that one harcoded string keep ... I don't see why an ascii codec is called. what's wrong ?

    Read the article

  • Forwarding an email with python smtplib

    - by robbles
    I'm trying to put together a script that automatically forwards certain emails that match a specific criteria to another email. I've got the downloading and parsing of messages using imaplib and email working, but I can't figure out how to forward an entire email to another address. Do I need to build a new message from scratch, or can I somehow modify the old one and re-send it? Here's what I have so far (client is an imaplib.IMAP4 connection, and id is a message ID): status, data = client.fetch(id, '(RFC822)') email_body = data[0][1] mail = email.message_from_string(email_body) # ...Process message... # This doesn't work forward = email.message.Message() forward.set_payload(mail.get_payload()) forward['From'] = '[email protected]' forward['To'] = '[email protected]' smtp.sendmail(user, ['[email protected]'], forward.as_string()) I'm sure there's something slightly more complicated I need to be doing with regard to the MIME content of the message. Surely there's some simple way of just forwarding the entire message though? # This doesn't work either, it just freezes...? mail['From'] = '[email protected]' mail['To'] = '[email protected]' smtp.sendmail(user, ['[email protected]'], mail.as_string())

    Read the article

  • Memory efficient import many data files into panda DataFrame in Python

    - by richardh
    I import into a panda DataFrame a directory of |-delimited.dat files. The following code works, but I eventually run out of RAM with a MemoryError:. import pandas as pd import glob temp = [] dataDir = 'C:/users/richard/research/data/edgar/masterfiles' for dataFile in glob.glob(dataDir + '/master_*.dat'): print dataFile temp.append(pd.read_table(dataFile, delimiter='|', header=0)) masterAll = pd.concat(temp) Is there a more memory efficient approach? Or should I go whole hog to a database? (I will move to a database eventually, but I am baby stepping my move to pandas.) Thanks! FWIW, here is the head of an example .dat file: cik|cname|ftype|date|fileloc 1000032|BINCH JAMES G|4|2011-03-08|edgar/data/1000032/0001181431-11-016512.txt 1000045|NICHOLAS FINANCIAL INC|10-Q|2011-02-11|edgar/data/1000045/0001193125-11-031933.txt 1000045|NICHOLAS FINANCIAL INC|8-K|2011-01-11|edgar/data/1000045/0001193125-11-005531.txt 1000045|NICHOLAS FINANCIAL INC|8-K|2011-01-27|edgar/data/1000045/0001193125-11-015631.txt 1000045|NICHOLAS FINANCIAL INC|SC 13G/A|2011-02-14|edgar/data/1000045/0000929638-11-00151.txt

    Read the article

  • Fuzzy string matching algorithm in Python

    - by Mridang Agarwalla
    Hi guys, I'm trying to find some sort of a good, fuzzy string matching algorithm. Direct matching doesn't work for me — this isn't too good because unless my strings are a 100% similar, the match fails. The Levenshtein method doesn't work too well for strings as it works on a character level. I was looking for something along the lines of word level matching e.g. String A: The quick brown fox. String B: The quick brown fox jumped over the lazy dog. These should match as all words in string A are in string B. Now, this is an oversimplified example but would anyone know a good, fuzzy string matching algorithm that works on a word level. Thanks in advance.

    Read the article

  • Lightweight Object->Database in python

    - by pehrs
    I am in need of a lightweight way to store dictionaries of data into a database. What I need is something that: Creates a database table from a simple type description (int, float, datetime etc) Takes a dictionary object and inserts it into the database (including handling datetime objects!) If possible: Can handle basic references, so the dictionary can reference other tables I would prefer something that doesn't do a lot of magic. I just need an easy way to setup and get data into an SQL database. What would you suggest? There seems to be a lot of ORM software around, but I find it hard to evaluate them.

    Read the article

  • Django Python Macports

    - by MacPython
    I installed Django via Macports. I wasted a lot of time on making it work. It still does not work. I would like to COMPLETELY uninstall Django (Macports) and install with the easy install (DJANGO). I would like to keep Macports and not uninstall it, because I read it SHOULD be useful. How can I achieve this? Thank you for your attention.

    Read the article

  • Can't get MySQL source query to work using Python mysqldb module

    - by Chris
    I have the following lines of code: sql = "source C:\\My Dropbox\\workspace\\projects\\hosted_inv\\create_site_db.sql" cursor.execute (sql) When I execute my program, I get the following error: Error 1064: You have an error in your SQL syntax; check the manual that corresponds to your MySQL server version for the right syntax to use near 'source C:\My Dropbox\workspace\projects\hosted_inv\create_site_db.sql' at line 1 Now I can copy and past the following into mysql as a query: source C:\\My Dropbox\\workspace\\projects\\hosted_inv\\create_site_db.sql And it works perfect. When I check the query log for the query executed by my script, it shows that my query was the following: source C:\\My Dropbox\\workspace\\projects\\hosted_inv\\create_site_db.sql However, when I manually paste it in and execute, the entire create_site_db.sql gets expanded in the query log and it shows all the sql queries in that file. Am I missing something here on how mysqldb does queries? Am I running into a limitation. My goal is to run a sql script to create the schema structure, but I don't want to have to call mysql in a shell process to source the sql file. Any thoughts? Thanks!

    Read the article

  • Python: x-y-plot with matplotlib

    - by kame
    I want to plot some data. The first column contains the x-data. But matplotlib doesnt plot this. Where is my mistake? #fresnel formula import numpy as np from numpy import cos from scipy import * from pylab import plot, show, ylim, yticks from matplotlib import * from pprint import pprint n1 = 1.0 n2 = 1.5 #alpha, beta, intensity data = [ [10, 22, 4.3], [20, 42, 4.2], [30, 62, 3.6], [40, 83, 1.3], [45, 102, 2.8], [50, 123, 3.0], [60, 143, 3.2], [70, 163, 3.8], ] for i in range(len(data)): rhotang1 = (n1 * cos(data[i][0]) - n2 * cos(data[i][1])) rhotang2 = (n1 * cos(data[i][0]) + n2 * cos(data[i][1])) rhotang = rhotang1 / rhotang2 data[i].append(rhotang) #append 4th value pprint(data) x = data[:][0] y1 = data[:][2] y3 = data[:][3] plot(x, y1, x, y3) show() EDIT: http://paste.pocoo.org/show/205534/ But it doesnt work.

    Read the article

  • How to read a csv file with python

    - by john
    Hello, I'm trying to read a csv file but it doesn't work. I can read my csv file but when I see what I read, there where white space between values. Here is my code # -*- coding: iso-8859-1 -*- import sql_db, tmpl_macros, os import security, form, common import csv class windows_dialect(csv.Dialect): """Describe the usual properties of unix-generated CSV files.""" delimiter = ',' quotechar = '"' doublequote = 1 skipinitialspace = 0 lineterminator = 'n' quoting = csv.QUOTE_MINIMAL def reco(d): cars = {210:'"', 211:'"', 213:"'", 136:'à', 143:'è', 142:'é'} for c in cars: d = d.replace(chr(c),cars[c]) return d def page_process(ctx): if ctx.req_equals('catalog_send'): if 'catalog_file' in ctx.locals.__dict__: contenu = ctx.locals.catalog_file[0].file.read() #contenu.encode('') p = csv.reader(contenu, delimiter=',') inserted = 0 modified = 0 (cr,db) = sql_db.cursor_get() for line in p: if line: logfile = open('/tmp/test.log', 'a') logfile.write(line[0]) logfile.write('\n') logfile.write('-----------------------------\n') logfile.close()

    Read the article

  • Python: Split by 1 or more occurrences of a delimiter

    - by Adam Matan
    Hi, I have a formatted string from a log file, which looks like: >>> a="test result" That is, the test and the result are split by some spaces - it was probably created using formatted string which gave test some constant spacing. Simple splitting won't do the trick: >>> a.split(" ") ['test', '', '', '', ... '', '', '', '', '', '', '', '', '', '', '', 'result'] split(DELIMITER, COUNT) cleared some unnecessary values: >>> a.split(" ",1) ['test', ' result'] This helped - but of course, I really need: ['test', 'result'] I can use split() followed by map + strip(), but I wondered if there is a more Pythonic way to do it. Thanks, Adam

    Read the article

  • Python: Class factory using user input as class names

    - by Sano98
    Hi everyone, I want to add class atttributes to a superclass dynamically. Furthermore, I want to create classes that inherit from this superclass dynamically, and the name of those subclasses should depend on user input. There is a superclass "Unit", to which I can add attributes at runtime. This already works. def add_attr (cls, name, value): setattr(cls, name, value) class Unit(object): pass class Archer(Unit): pass myArcher = Archer() add_attr(Unit, 'strength', 5) print "Strenght ofmyarcher: " + str(myArcher.strength) Archer.strength = 2 print "Strenght ofmyarcher: " + str(myArcher.strength) This leads to the desired output: Strenght ofmyarcher: 5 Strenght ofmyarcher: 2 But now I don't want to predefine the subclass Archer, but I'd rather let the user decide how to call this subclass. I've tried something like this: class Meta(type, subclassname): def __new__(cls, subclassname, bases, dct): return type.__new__(cls, subclassname, Unit, dct) factory = Meta() factory.__new__("Soldier") but no luck. I guess I haven't really understood what new does here. What I want as a result here is class Soldier(Unit): pass being created by the factory. And if I call the factory with the argument "Knight", I'd like a class Knight, subclass of Unit, to be created. Any ideas? Many thanks in advance! Bye -Sano

    Read the article

  • Help a Python newbie with a Django model inheritance problem

    - by Joshmaker
    I'm working on my first real Django project after years of PHP programming, and I am running into a problem with my models. First, I noticed that I was copying and pasting code between the models, and being a diligent OO programmer I decided to make a parent class that the other models could inherit from: class Common(model.Model): self.name = models.CharField(max_length=255) date_created = models.DateTimeField(auto_now_add=True) date_modified = models.DateTimeField(auto_now=True) def __unicode__(self): return self.name class Meta: abstract=True So far so good. Now all my other models extend "Common" and have names and dates like I want. However, I have a class for "Categories" were the name has to be unique. I assume there should be a relatively simple way for me to access the name attribute from Common and make it unique. However, the different methods I have tried to use have all failed. For example: class Category(Common): def __init__(self, *args, **kwargs): self.name.unique=True Spits up the error "Caught an exception while rendering: 'Category' object has no attribute 'name' Can someone point me in the right direction?

    Read the article

  • How to Extract data asocaited with attribute of XML file using python 3.2

    - by user1460383
    I have this xml format..... <event timestamp="0.447463" bustype="LIN" channel="LIN 1"> <col name="Time"/> <col name="Start of Frame">0.440708</col> <col name="Channel">LIN 1</col> <col name="Dir">Tx</col> <col name="Event Type">LIN Frame (Diagnostic Request)</col> <col name="Frame Name">MasterReq_DB</col> <col name="Id">3C</col> <col name="Data">81 06 04 04 FF FF 50 4C</col> <col name="Publisher">TestMaster (simulated)</col> <col name="Checksum">D3 &quot;Classic&quot;</col> <col name="Header Duration">2.090 ms (40.1 bits)</col> <col name="Resp. Duration">4.688 ms (90.0 bits)</col> <col name="Time difference">0.049987</col> <empty/> </event> In above xml, i need to extract data associated with attribute 'name' Am able to get all names but am unable to fetch MasterReq_DB< field Please help me ... Thanks in advance

    Read the article

  • Opening SSL URLs with Python

    - by RadiantHex
    Hi folks, I'm using mechanize to navigate pages, it works pretty well. Unfortunately I have a random error come up, by random I mean it occasionally appears. URLError at /test/ urlopen error [Errno 1] _ssl.c:1325: error:140943FC:SSL routines:SSL3_READ_BYTES:sslv3 alert bad record mac I really need help on this one :) any ideas?

    Read the article

  • read a binary file (python)

    - by beratch
    Hi, I cant read a file, and I dont understand why: f = open("test/test.pdf", "r") data = list(f.read()) print data Returns : [] I would like to open a PDF, and extract every bytes, and put it in a List. What's wrong with my code ? :( Thanks,

    Read the article

  • Python metaclass for enforcing immutability of custom types

    - by Mark Lehmacher
    Having searched for a way to enforce immutability of custom types and not having found a satisfactory answer I came up with my own shot at a solution in form of a metaclass: class ImmutableTypeException( Exception ): pass class Immutable( type ): ''' Enforce some aspects of the immutability contract for new-style classes: - attributes must not be created, modified or deleted after object construction - immutable types must implement __eq__ and __hash__ ''' def __new__( meta, classname, bases, classDict ): instance = type.__new__( meta, classname, bases, classDict ) # Make sure __eq__ and __hash__ have been implemented by the immutable type. # In the case of __hash__ also make sure the object default implementation has been overridden. # TODO: the check for eq and hash functions could probably be done more directly and thus more efficiently # (hasattr does not seem to traverse the type hierarchy) if not '__eq__' in dir( instance ): raise ImmutableTypeException( 'Immutable types must implement __eq__.' ) if not '__hash__' in dir( instance ): raise ImmutableTypeException( 'Immutable types must implement __hash__.' ) if _methodFromObjectType( instance.__hash__ ): raise ImmutableTypeException( 'Immutable types must override object.__hash__.' ) instance.__setattr__ = _setattr instance.__delattr__ = _delattr return instance def __call__( self, *args, **kwargs ): obj = type.__call__( self, *args, **kwargs ) obj.__immutable__ = True return obj def _setattr( self, attr, value ): if '__immutable__' in self.__dict__ and self.__immutable__: raise AttributeError( "'%s' must not be modified because '%s' is immutable" % ( attr, self ) ) object.__setattr__( self, attr, value ) def _delattr( self, attr ): raise AttributeError( "'%s' must not be deleted because '%s' is immutable" % ( attr, self ) ) def _methodFromObjectType( method ): ''' Return True if the given method has been defined by object, False otherwise. ''' try: # TODO: Are we exploiting an implementation detail here? Find better solution! return isinstance( method.__objclass__, object ) except: return False However, while the general approach seems to be working rather well there are still some iffy implementation details (also see TODO comments in code): How do I check if a particular method has been implemented anywhere in the type hierarchy? How do I check which type is the origin of a method declaration (i.e. as part of which type a method has been defined)?

    Read the article

  • feedparser fails during script run, but can't reproduce in interactive python console

    - by Rhubarb
    It's failing with this when I run eclipse or when I run my script in iPython: 'ascii' codec can't decode byte 0xe2 in position 32: ordinal not in range(128) I don't know why, but when I simply execute the feedparse.parse(url) statement using the same url, there is no error thrown. This is stumping me big time. The code is as simple as: try: d = feedparser.parse(url) except Exception, e: logging.error('Error while retrieving feed.') logging.error(e) logging.error(formatExceptionInfo(None)) logging.error(formatExceptionInfo1()) Here is the stack trace: d = feedparser.parse(url) File "C:\Python26\lib\site-packages\feedparser.py", line 2623, in parse feedparser.feed(data) File "C:\Python26\lib\site-packages\feedparser.py", line 1441, in feed sgmllib.SGMLParser.feed(self, data) File "C:\Python26\lib\sgmllib.py", line 104, in feed self.goahead(0) File "C:\Python26\lib\sgmllib.py", line 143, in goahead k = self.parse_endtag(i) File "C:\Python26\lib\sgmllib.py", line 320, in parse_endtag self.finish_endtag(tag) File "C:\Python26\lib\sgmllib.py", line 360, in finish_endtag self.unknown_endtag(tag) File "C:\Python26\lib\site-packages\feedparser.py", line 476, in unknown_endtag method() File "C:\Python26\lib\site-packages\feedparser.py", line 1318, in _end_content value = self.popContent('content') File "C:\Python26\lib\site-packages\feedparser.py", line 700, in popContent value = self.pop(tag) File "C:\Python26\lib\site-packages\feedparser.py", line 641, in pop output = _resolveRelativeURIs(output, self.baseuri, self.encoding) File "C:\Python26\lib\site-packages\feedparser.py", line 1594, in _resolveRelativeURIs p.feed(htmlSource) File "C:\Python26\lib\site-packages\feedparser.py", line 1441, in feed sgmllib.SGMLParser.feed(self, data) File "C:\Python26\lib\sgmllib.py", line 104, in feed self.goahead(0) File "C:\Python26\lib\sgmllib.py", line 138, in goahead k = self.parse_starttag(i) File "C:\Python26\lib\sgmllib.py", line 296, in parse_starttag self.finish_starttag(tag, attrs) File "C:\Python26\lib\sgmllib.py", line 338, in finish_starttag self.unknown_starttag(tag, attrs) File "C:\Python26\lib\site-packages\feedparser.py", line 1588, in unknown_starttag attrs = [(key, ((tag, key) in self.relative_uris) and self.resolveURI(value) or value) for key, value in attrs] File "C:\Python26\lib\site-packages\feedparser.py", line 1584, in resolveURI return _urljoin(self.baseuri, uri) File "C:\Python26\lib\site-packages\feedparser.py", line 286, in _urljoin return urlparse.urljoin(base, uri) File "C:\Python26\lib\urlparse.py", line 215, in urljoin params, query, fragment)) File "C:\Python26\lib\urlparse.py", line 184, in urlunparse return urlunsplit((scheme, netloc, url, query, fragment)) File "C:\Python26\lib\urlparse.py", line 192, in urlunsplit url = scheme + ':' + url File "C:\Python26\lib\encodings\cp1252.py", line 15, in decode return codecs.charmap_decode(input,errors,decoding_table)

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Python dealing with dates and times

    - by randombits
    I'm looking for a solution to the following: Given today's date, figure out what month was before. So 2 should return for today, since it is currently March, the third month of the year. 12 should return for January. Then based on that, I need to be able to iterate through a directory and find all files that were created that month. Bonus points would include finding the most current file created for the previous month.

    Read the article

< Previous Page | 130 131 132 133 134 135 136 137 138 139 140 141  | Next Page >