Search Results

Search found 13534 results on 542 pages for 'python 2 x'.

Page 135/542 | < Previous Page | 131 132 133 134 135 136 137 138 139 140 141 142  | Next Page >

  • Shared value in parallel python

    - by Jonathan
    Hey all- I'm using ParallelPython to develop a performance-critical script. I'd like to share one value between the 8 processes running on the system. Please excuse the trivial example but this illustrates my question. def findMin(listOfElements): for el in listOfElements: if el < min: min = el import pp min = 0 myList = range(100000) job_server = pp.Server() f1 = job_server.submit(findMin, myList[0:25000]) f2 = job_server.submit(findMin, myList[25000:50000]) f3 = job_server.submit(findMin, myList[50000:75000]) f4 = job_server.submit(findMin, myList[75000:100000]) The pp docs don't seem to describe a way to share data across processes. Is it possible? If so, is there a standard locking mechanism (like in the threading module) to confirm that only one update is done at a time? l = Lock() if(el < min): l.acquire if(el < min): min = el l.release I understand I could keep a local min and compare the 4 in the main thread once returned, but by sharing the value I can do some better pruning of my BFS binary tree and potentially save a lot of loop iterations. Thanks- Jonathan

    Read the article

  • use doctest and logging in python program

    - by Luke
    #!/usr/bin/python2.4 import logging import sys import doctest def foo(x): """ foo (0) 0 """ print ("%d" %(x)) _logger.debug("%d" %(x)) def _test(): doctest.testmod() _logger = logging.getLogger() _logger.setLevel(logging.DEBUG) _formatter = logging.Formatter('%(message)s') _handler = logging.StreamHandler(sys.stdout) _handler.setFormatter(_formatter) _logger.addHandler(_handler) _test() I would like to use logger module for all of my print statements. I have looked at the first 50 top google links for this, and they seem to agree that doctest uses it's own copy of the stdout. If print is used it works if logger is used it logs to the root console. Can someone please demonstrate a working example with a code snippet that will allow me to combine. Note running nose to test doctest will just append the log output at the end of the test, (assuming you set the switches) it does not treat them as a print statement.

    Read the article

  • Python fit polynomial, power law and exponential from data

    - by Nadir
    I have some data (x and y coordinates) coming from a study and I have to plot them and to find the best curve that fits data. My curves are: polynomial up to 6th degree; power law; and exponential. I am able to find the best fit for polynomial with while(i < 6): coefs, val = poly.polyfit(x, y, i, full=True) and I take the degree that minimizes val. When I have to fit a power law (the most probable in my study), I do not know how to do it correctly. This is what I have done. I have applied the log function to all x and y and I have tried to fit it with a linear polynomial. If the error (val) is lower than the others polynomial tried before, I have chosen the power law function. Am I correct? Now how can I reconstruct my power law starting from the line y = mx + q in order to draw it with the original points? I need also to display the function found. I have tried with: def power_law(x, m, q): return q * (x**m) using x_new = np.linspace(x[0], x[-1], num=len(x)*10) y1 = power_law(x_new, coefs[0], coefs[1]) popt, pcov = curve_fit(power_law, x_new, y1) but it seems not to work well.

    Read the article

  • removing pairs of elements from numpy arrays that are NaN (or another value) in Python

    - by user248237
    I have an array with two columns in numpy. For example: a = array([[1, 5, nan, 6], [10, 6, 6, nan]]) a = transpose(a) I want to efficiently iterate through the two columns, a[:, 0] and a[:, 1] and remove any pairs that meet a certain condition, in this case if they are NaN. The obvious way I can think of is: new_a = [] for val1, val2 in a: if val2 == nan or val2 == nan: new_a.append([val1, val2]) But that seems clunky. What's the pythonic numpy way of doing this? thanks.

    Read the article

  • Documenting module/class/function bodies in python sphinx docs

    - by perrierism
    Is there a way with Sphinx documentation to output a function or class body (the code itself) with the autodoc feature? I'm using autodoc to much success. In addition to the docstrings getting pulled in to the documentation I want like a link to click for each function where it will show you the source... is that possible? This is about what most of my documentation looks like now: .. module:`foo.mymodule` Title =================== .. automodule:: foo.mymodule .. autoclass:: MyModulesClass :members: :undoc-members:

    Read the article

  • Opening SSL URLs with Python

    - by RadiantHex
    Hi folks, I'm using mechanize to navigate pages, it works pretty well. Unfortunately I have a random error come up, by random I mean it occasionally appears. URLError at /test/ urlopen error [Errno 1] _ssl.c:1325: error:140943FC:SSL routines:SSL3_READ_BYTES:sslv3 alert bad record mac I really need help on this one :) any ideas?

    Read the article

  • Convert alphabet letters to number in python

    - by altin
    Can someone help me finish this characters = ['a''b''c''d''e''f''g''h''i''j''k''l''m''n''o''p''q''r''t''u''v''w''x''y''z'] numbers = ['1''2''3''4''5''6''7''8''9''10''11''12''13''14''15''16''17''18''19''20''21''22''23''24'] text = raw_input(' Write text: ') Ive tryed to many ways but couldnt get to the pint, I want to make exc if i type hello the output to be in numbers lined like in alphabet... example a = 1 < in alphabet Can anyone give ideas ? or help sth ?

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Python - urllib2 & cookielib

    - by Adrian
    I am trying to open the following website and retrieve the initial cookie and use it for the second url-open BUT if you run the following code it outputs 2 different cookies. How do I use the initial cookie for the second url-open? import cookielib, urllib2 cj = cookielib.CookieJar() opener = urllib2.build_opener(urllib2.HTTPCookieProcessor(cj)) home = opener.open('https://www.idcourts.us/repository/start.do') print cj search = opener.open('https://www.idcourts.us/repository/partySearch.do') print cj Output shows 2 different cookies every time as you can see: <cookielib.CookieJar[<Cookie JSESSIONID=0DEEE8331DE7D0DFDC22E860E065085F for www.idcourts.us/repository>]> <cookielib.CookieJar[<Cookie JSESSIONID=E01C2BE8323632A32DA467F8A9B22A51 for www.idcourts.us/repository>]>

    Read the article

  • Common Pitfalls in Python

    - by Anurag Uniyal
    Today I was bitten again by "Mutable default arguments" after many years. I usually don't use mutable default arguments unless needed but I think with time I forgot about that, and today in the application I added tocElements=[] in a pdf generation function's argument list and now 'Table of Content' gets longer and longer after each invocation of "generate pdf" :) My question is what other things should I add to my list of things to MUST avoid? Mutable default arguments Import modules always same way e.g. from y import x and import x are different things, they are treated as different modules. Do not use range in place of lists because range() will become an iterator anyway, the following will fail: myIndexList = [0,1,3] isListSorted = myIndexList == range(3) # will fail in 3.0 isListSorted = myIndexList == list(range(3)) # will not same thing can be mistakenly done with xrange: `myIndexList == xrange(3)`. Catching multiple exceptions try: raise KeyError("hmm bug") except KeyError,TypeError: print TypeError It prints "hmm bug", though it is not a bug, it looks like we are catching exceptions of type KeyError,TypeError but instead we are catching KeyError only as variable TypeError, use this instead: try: raise KeyError("hmm bug") except (KeyError,TypeError): print TypeError

    Read the article

  • Listing all possible values for SOAP enumeration with Python SUDS

    - by bdk
    I'm connecting with a SUDS client to a SOAP Server whose wsdl contains manu enumerations like the following: </simpleType> <simpleType name="FOOENUMERATION"> <restriction base="xsd:string"> <enumeration value="ALPHA"><!-- enum const = 0 --> <enumeration value="BETA"/><!-- enum const = 1 --> <enumeration value="GAMMA"/><!-- enum const = 2 --> <enumeration value="DELTA"/><!-- enum const = 3 --> </restriction> </simpleType> In my client I am receiving sequences which contain elements of these various enumeration types. My need is that given a member variable, I need to know all possible enumeration values. Basically I need a function which takes an instance of one of these enums and returns a list of strings which are all the possible values. When I have an instance, running: print type(foo.enumInstance) I get: <class 'suds.sax.text.Text'> I'm not sure how to get the actual simpleType name from this, and then get the possible values from that short of parsing the WSDL myself.

    Read the article

  • Python TKinter connect variable to entry widget

    - by Sano98
    Hi everyone, I'm trying to associate a variable with a Tkinter entry widget, in a way that: Whenever I change the value (the "content") of the entry, mainly by typing something into it, the variable automatically gets assigned the value of what I've typed. Without me having to push a button "Update value " or something like that first. Whenever the variable gets changed (by some other part of the programm), I want the entry value displayed to be adjusted automatically. I believe that this could work via the textvariable. I read the example on http://effbot.org/tkinterbook/entry.htm, but it is not exactly helping me for what I have in mind. I have a feeling that there is a way of ensuring the first condition with using entry's "validate". Any ideas? Thank you for your input! Sano

    Read the article

  • Python web scraping involving HTML tags with attributes

    - by rohanbk
    I'm trying to make a web scraper that will parse a web-page of publications and extract the authors. The skeletal structure of the web-page is the following: <html> <body> <div id="container"> <div id="contents"> <table> <tbody> <tr> <td class="author">####I want whatever is located here ###</td> </tr> </tbody> </table> </div> </div> </body> </html> I've been trying to use BeautifulSoup and lxml thus far to accomplish this task, but I'm not sure how to handle the two div tags and td tag because they have attributes. In addition to this, I'm not sure whether I should rely more on BeautifulSoup or lxml or a combination of both. What should I do? At the moment, my code looks like what is below: import re import urllib2,sys import lxml from lxml import etree from lxml.html.soupparser import fromstring from lxml.etree import tostring from lxml.cssselect import CSSSelector from BeautifulSoup import BeautifulSoup, NavigableString address='http://www.example.com/' html = urllib2.urlopen(address).read() soup = BeautifulSoup(html) html=soup.prettify() html=html.replace('&nbsp', '&#160') html=html.replace('&iacute','&#237') root=fromstring(html) I realize that a lot of the import statements may be redundant, but I just copied whatever I currently had in more source file. EDIT: I suppose that I didn't make this quite clear, but I have multiple tags in page that I want to scrape.

    Read the article

  • Python learner needs help spotting an error

    - by Protean
    This piece of code gives a syntax error at the colon of "elif process.loop(i, len(list_i) != 'repeat':" and I can't seem to figure out why. class process: def loop(v1, v2): if v1 < v2 - 1: return 'repeat' def isel(chr_i, list_i): for i in range(len(list_i)): if chr_i == list_i[i]: return list_i[i] elif process.loop(i, len(list_i) != 'repeat': return 'error'()

    Read the article

  • Python: how to enclose strings in a list with < and >

    - by Michael Konietzny
    Hello, i would like to enclose strings inside of list into < (formatted like <%s). The current code does the following: def create_worker (general_logger, general_config): arguments = ["worker_name", "worker_module", "worker_class"] __check_arguments(arguments) def __check_arguments(arguments): if len(sys.argv) < 2 + len(arguments): print "Usage: %s delete-project %s" % (__file__," ".join(arguments)) sys.exit(10) The current output looks like this: Usage: ...\handler_scripts.py delete-project worker_name worker_module worker_class and should look like this: Usage: ...\handler_scripts.py delete-project <worker_name> <worker_module> <worker_class> Is there any short way to do this ? Greetings, Michael

    Read the article

  • recursively implementing 'minimum number of coins' in python

    - by user5198
    This problem is same as asked in here. Given a list of coins, their values (c1, c2, c3, ... cj, ...), and the total sum i. Find the minimum number of coins the sum of which is i (we can use as many coins of one type as we want), or report that it's not possible to select coins in such a way that they sum up to S. I"m just introduced to dynamic programming yesterday and I tried to make a code for it. # Optimal substructure: C[i] = 1 + min_j(C[i-cj]) cdict = {} def C(i, coins): if i <= 0: return 0 if i in cdict: return cdict[i] else: answer = 1 + min([C(i - cj, coins) for cj in coins]) cdict[i] = answer return answer Here, C[i] is the optimal solution for amount of money 'i'. And available coins are {c1, c2, ... , cj, ...} for the program, I've increased the recursion limit to avoid maximum recursion depth exceeded error. But, this program gives the right answer only someones and when a solution is not possible, it doesn't indicate that. What is wrong with my code and how to correct it?

    Read the article

  • Python, a smarter way of string to integer conversion

    - by Hellnar
    Hello I have written this code to convert string in such format "0(532) 222 22 22" to integer such as 05322222222 . class Phone(): def __init__(self,input): self.phone = input def __str__(self): return self.phone #convert to integer. def to_int(self): return int((self.phone).replace(" ","").replace("(","").replace(")","")) test = Phone("0(532) 222 22 22") print test.to_int() It feels very clumsy to use 3 replace methods to solve this. I am curious if there is a better solution?

    Read the article

  • python search replace using wildcards

    - by tom smith
    hi somewhat confused.. but trying to do a search/repace using wildcards if i have something like: <blah.... ssf ff> <bl.... ssf dfggg ff> <b.... ssf ghhjj fhf> and i want to replace all of the above strings with say, <hh >t any thoughts/comments on how this can be accomplished? thanks update (thanks for the comments!) i'm missing something... my initial sample text are: Soo Choi</span>LONGEDITBOX">Apryl Berney Soo Choi</span>LONGEDITBOX">Joel Franks Joel Franks</span>GEDITBOX">Alexander Yamato and i'm trying to get Soo Choi foo Apryl Berney Soo Choi foo Joel Franks Joel Franks foo Alexander Yamato i've tried derivations of name=re.sub("</s[^>]*\">"," foo ",name) but i'm missing something... thoughts... thanks

    Read the article

  • Converting string to datetime object in python

    - by Gussi
    Given this string: "Fri, 09 Apr 2010 14:10:50 +0000" how does one convert it to a datetime object? After doing some reading I feel like this should work, but it doesn't... >>> from datetime import datetime >>> >>> str = 'Fri, 09 Apr 2010 14:10:50 +0000' >>> fmt = '%a, %d %b %Y %H:%M:%S %z' >>> datetime.strptime(str, fmt) Traceback (most recent call last): File "<stdin>", line 1, in <module> File "/usr/lib64/python2.6/_strptime.py", line 317, in _strptime (bad_directive, format)) ValueError: 'z' is a bad directive in format '%a, %d %b %Y %H:%M:%S %z' It should be noted that this works without a problem >>> from datetime import datetime >>> >>> str = 'Fri, 09 Apr 2010 14:10:50' >>> fmt = '%a, %d %b %Y %H:%M:%S' >>> datetime.strptime(str, fmt) datetime.datetime(2010, 4, 9, 14, 10, 50) But I'm stuck with "Fri, 09 Apr 2010 14:10:50 +0000", I would prefer to convert exactly that without changing (or slicing) that string in any way.

    Read the article

  • python: using __import__ to import a module which in turn generates an ImportError

    - by bbb
    Hi there, I have a funny problem I'd like to ask you guys ('n gals) about. I'm importing some module A that is importing some non-existent module B. Of course this will result in an ImportError. This is what A.py looks like import B Now let's import A >>> import A Traceback (most recent call last): File "<stdin>", line 1, in <module> File "/tmp/importtest/A.py", line 1, in <module> import B ImportError: No module named B Alright, on to the problem. How can I know if this ImportError results from importing A or from some corrupt import inside A without looking at the error's string representation. The difference is that either A is not there or does have incorrect import statements. Hope you can help me out... Cheers bb

    Read the article

< Previous Page | 131 132 133 134 135 136 137 138 139 140 141 142  | Next Page >