Search Results

Search found 40479 results on 1620 pages for 'binary files'.

Page 136/1620 | < Previous Page | 132 133 134 135 136 137 138 139 140 141 142 143  | Next Page >

  • Where should my application setup put the binary executables in Windows 7?

    - by KeyboardMonkey
    I created a small Windows app, and am builder a setup for it using NSIS, but what I can't find out is where to put the executables to conform to the new Windows security model. Traditionally we put program files in, well, "c:\program files". With the security model getting more mangled with each Windows version, some users have restricted accounts, and I'm not sure installing into program files will work for these users. Where can I install my program's files that will cater for these lower-privileged users? Oh and I want to avoid ClickOnce.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Using windows CopyFile function to copy all files with certain name format

    - by Ben313
    Hello! I am updating some C code that copys files with a certain name. basically, I have a directory with a bunch of files named like so: AAAAA.1.XYZ AAAAA.2.ZYX AAAAA.3.YZX BBBBB.1.XYZ BBBBB.2.ZYX Now, In the old code, they just used a call to ShellExecute and used xcopy.exe. to get all the files starting with AAAAA, they just gave xcopy the name of the file as AAAAA.* and it knew to copy all of the files starting with AAAAA. now, im trying to get it to copy with out having to use the command line, and I am running into trouble. I was hoping CopyFile would be smart enough to handle AAAAA.* as the file to be copied, but it doesnt at all do what xcopy did. So, any Ideas on how to do this without the external call to xcopy.exe?

    Read the article

  • Windows script to create directories of 3,000 files

    - by uhpl1
    We have some email archiving that is dumping all the emails into a directory. Because of some performance reasons with the server, I want to setup an automated task that will run a script once a day and if there is more than 3,000 (or whatever number) of files in the main directory, create a new directory with the date and move all the main directory files into it. I'm sure someone has already written something similar, so if anyone could point me at it that would be great. Batch file or Powershell would both be fine.

    Read the article

  • Search Files (Preferably with index) on Windows 2000 Server

    - by ThinkBohemian
    I have many files on a windows server 2000 machine that is setup to act as a networked disk drive, is there anyway I can index the files and make that index available as a search to more people than just me? Bonus if the index can look inside of documents such as readme.txt? If there is no easy way to do this globaly (for all users) Is there a way I could generate and store an index locally on my computer? If this is the wrong place to ask this question, any advice on community more suited?

    Read the article

  • puppet agent doesn't retrieve files from master

    - by nicmon
    I have a very basic question regarding to Puppet 3.0.1 configuration. I setup a puppet master server (CentOS) with 2 agents (CentOS and Windows 7), all 3 can ping and access each other. There is no error at all. I have copied a file under /etc/puppet/files/test2.txt my site.pp (/etc/puppet/manifests) contains these lines: node default { include test file { "/tmp/testmaster.txt": owner => root, group => root, mode => 644, source => "puppet:///files/test2.txt" } } but there will no file be created on agent servers under /tmp/ once I run "puppet agent --test" here is the output: [root@agent1 ~]# puppet agent --test Info: Retrieving plugin Info: Caching catalog for agent1.mydomain.com Info: Applying configuration version '1354267916' Finished catalog run in 0.02 seconds "puppet apply /etc/puppet/manifests/site.pp" creates the testmaster.txt under /tmp/ on master.

    Read the article

  • multiple FileSystemWatchers to monitor files on local system?

    - by Jason Crowes
    We're writing a text editor like tool for our internal accounting package system that has actions that can be done by our own Xml language specs. These macro commands are specified in Xml files and we need the ability to monitor if files openned have bean modified externally. The only problem is that there maybe 20-30 files with different paths openned at any one time. Would it be good to use multiple FileSystemWatchers for this scenario? Or would it be better to monitor the root drive and catch specific events that match an open file in the editor (though lots of events could be raised). Some are local drives (C,D,E) others are their network drives (U,X,G,H). Files are quite chunky too about 300-400Kb.

    Read the article

  • Getting data from closed files with concatenate formula

    - by Pav
    Each day a program is creating an excel file for me with some data for the current day. Like what is the price for products, how many people are available today and things like that. Based on all this I need to make some forecasts and workplace allocations for workers. The problem is, that I need to drag all this information manually all the time. So to make it automatic I placed the formula in cells like: ='c:\ABC\[ABC 29-01-14.xlsx]sheet'!a1 Everything works fine, but next day I have to change file name for "ABC 30-01-14" for each cell, what is the same as entering the data manually. So I used "concatenate" formula to change date according to today's date automatically. I used "indirect" formula to turn it in to a real formula, not text string, and realized that it is working only for open files, not closed. Is there any way to do this for closed files without VBA, because I don't know it, or with VBA but explained for an idiot.

    Read the article

  • EF 4.x generated entity classes (POCO) and Map files

    - by JBeckton
    I have an MVC 4 app that I am working on and using the code first implementation except I cheated a bit and created my database first then generated my entity classes (poco) from my database using the EF power tools (reverse engineer). I guess you can say I did database first method but I have no edmx file just the context class and my entity classes (poco) I have a few projects in the works using MVC and EF with pocos but just the one project I used the tool to generate my pocos from the database. My question is about the mapping files that get created when I generate my pocos using the tool. What is the purpose of these Map files? I figured the map files are needed when generating the db from the model like with the true code first method, in my case where I am using a tool to generate my model from the database do the map files have any influence on how my app uses the entity classes?

    Read the article

  • Which open source repository or version control systems store files' original mtime, ctime and atime

    - by sampablokuper
    I want to create a personal digital archive. I want to be able to check digital files (some several years old, some recent, some not yet created) into that archive and have them preserved, along with their metadata such as ctime, atime and mtime. I want to be able to check these files out of that archive, modify their contents and commit the changes back to the archive, while keeping the earlier commits and their metadata intact. I want the archive to be very reliable and secure, and able to be backed up remotely. I want to be able to check files in and out of the archive from PCs running Linux, Mac OS X 10.5+ or Win XP+. I want to be able to check files in and out of the archive from PCs with RAM capacities lower than the size of the files. E.g. I want to be able to check in/out a 13GB file using a PC with 2GB RAM. I thought Subversion could do all this, but apparently it can't. (At least, it couldn't a couple of years ago and as far as I know it still can't; correct me if I'm wrong.) Is there a libre VCS or similar capable of all these things? Thanks for your help.

    Read the article

  • Best Place to Store Config Files and Log Files on Windows for My Program?

    - by Dave
    I need to store log files and config files for my application. Where is the best place to store them? Right now I'm just using the current directory, which ends up putting them in the Program Files directory where my program lives. The log files will probably be accessed by the user somewhat regularly, so %APPDATA% seems a little hard to get to. Is a directory under %USERPROFILE%\My Documents the best? It needs to work for all versions of Windows from 2000 forward.

    Read the article

  • Preventing logrotate's dateext from overwriting files

    - by Thirler
    I'm working with a system where I would like to use the dateext function of logrotate (or some other way) to add the date to a logfile when it is rotated. However in this system it is important that no logging is missing and dateext will overwrite any existing files (which will happen if logrotate is called twice on a day). Is there a reliable way to prevent dateext to overwrite existing files, but instead make another file?. It is acceptable that either no rotate happens or a file is created with a less predictable name (date with an extra number, or the time or something).

    Read the article

  • How to programmatically cut/copy/get files to/from Windows clipboard in a systam standard compliand

    - by Ivan
    How to put a cut/copy reference to specific files and/or folders into Windows clipboard so that when I open standard Windows Explorer window, go to somewhere and press Ctrl+V - the files are pasted? If I copy or cut some files/folders in Windows Explorer, how do I get this info (full names and whether they were cut or copied) in my Program? I program in C#4, but other languages ways are also interesting to know.

    Read the article

  • Storage of various linux config files

    - by stantona
    I'm using git to track/store all my various config files required for linux. They're organized as if they live in my home directory, eg: .Xresources .config/ Awesome rc.lua .xmodmap .zshrc vim/ <- submodule emacs/ <- submodule etc I use git submodules for other things like vim/emacs configuration (since I also want to keep those separate repos). I'm thinking of creating a shell script to create the various links to these files. The goal is to make it easier to setup another linux painlessly. Is this a reasonable idea? Is there a preferred approach? I'm mostly interested in hearing how others people store their configs.

    Read the article

  • Considering modified files for rebuild

    - by harik
    I have a C++ project, I am using Bakefile for build process, Makefiles are generated for msvc, mingw, gnu etc for cross-platform support. Now the problem is that if I change any .h files (which are included in other .cpp files) and performing a rebuild does not recompile modified files. But changing any .cpp file gets recompiled. Based on modified time-stamp of any file which is included in the project I expect to consider that file for rebuild. Am I missing something which required to be added as a tag in .bkl files? Please help.

    Read the article

  • visual-studio-2008 versioninfo for all files updated from one place

    - by ravenspoint
    The version information, displayed when the mouse cursor hovers over the file in windows explorer, is set for a file built by visual studio in the VERSION resource. I would like to set the version in one place for all the files built by a solution, preferably when I change the version in the install properties. Is there a way to do this? The motivation for this is that if the version is not updated for a file, then the installer will leave previous versions of files instead of replacing them with new files. This happens even when the 'RemovePreviousVersions' property is set. In order to save the tedious and error prone task of updating the version in every file built and installed, I remove the version resource from all files - which is not elegant.

    Read the article

  • Using rsync to synchronise folders without overwriting files of same name on Mac OS X

    - by Adam
    I would like to synchronise the contents of two directories. Without overwriting but to create a copy if two files have the same name, but different sizes Without duplicating if two files have the same name and size. To work recursively So far I have found the following command which might work $ rsync -varE --progress ~/folder /volumes/server/folder But I'm not entirely sure what the -E flag does. It was suggested by a user on bananica.com but couldn't see a description for it in the manual. Would this do what I require successfully? Thanks

    Read the article

  • best way to record local modifications to an application's configuration files

    - by Menelaos Perdikeas
    I often install applications in Linux which don't come in package form but rather one just downloads a tarball, unpacks it, and runs the app out of the exploded folder. To adjust the application to my environment I need to modify the default configuration files, perhaps add an odd script of my own and I would like to have a way to record all these modifications automatically so I can apply them to another environment. Clearly, the modifications can not be reproduced verbatim as things like IP addresses or username need to change from system to system; still an exhaustive record to what was changed and added would be useful. My solution is to use a pattern involving git. Basically after I explode the tarball I do a git init and an initial commit and then I can save to a file the output of git diff and a cat of all files appearing as new in the git status -s. But I am sure there are more efficient ways. ???

    Read the article

  • Mixing two wav music files of different size

    - by iphoneDev
    Hi, I want to mix audio files of different size into a one single .wav file. There is a sample through which we can mix files of same size [(http://www.modejong.com/iOS/#ex4 )(Example 4)]. I modified the code to get the mixed file as a .wav file. But I am not able to understand that how to modify this code for unequal sized files. If someone can help me out with some code snippet,i'll be really thankful.

    Read the article

  • Advanced ID3 tags handling and audio files ordering

    - by Juhele
    Some of my files do not have complete ID3 tags and some have typos or small differences in writing – so finally, my portable player sees “Mr. President” as different artist from “Mr President” and so on. I would need some tool which could search similar tags and then allow me to correct the typos or for example override artist in all selected files by manually entered text. The same with empty tag items – sometimes, the track name, album etc. is OK, but the artist is missing etc. I'd like to do this without touching the audio quality, of course (but this should be no problem, I think). I already tried tools like: Winamp Songbird other players Tagscanner – the most advanced free tool I tried. However, it is not able to to solve the problem with similar tags. Do you know such tool? Preferably free and for Windows, if possible. However, if you know some commercial app able to do this, please let me know.

    Read the article

  • Seemingly random 404's for static files in Pyramid project

    - by seth
    I'm running a Pyramid project with mod_wsgi. Some of the files in my static directory (images, stylesheets, javascript) load fine, but others are coming up as not found. The files that are not working are all web fonts (otf, svg, woff and eot). I tried adding a text file into the static directory where the fonts are to see if I could access it, but it also came back with 404. The same text file also can't be accessed when put in the images folder. From what I'm looking at, it doesn't seem to be a permissions issue. Any ideas?

    Read the article

  • How to ignore the .classpath for Eclipse projects using Mercurial?

    - by Feanor
    I'm trying to share a repository between my Mac (laptop) and PC (desktop). There are some external dependencies for the project that are stored on different places on each machine, and noted in the .classpath file in the Eclipse project. When the project changes are shared, the dependencies break. I'm trying to figure out how to keep this from happening. I've tried using .hgignore with the following settings, among others, without success: syntax: glob *.classpath Based on this question, it appears that the .hgignore file will not allow Mercurial to ignore files that are also committed to the repository. Is there another way around this? Other ways to configure the project to make it work?

    Read the article

  • Oracle application - files missing in the Mount point in UNix server

    - by arun_V
    My oracle application test instance is down, When I browse through the Unix server, I couldn’t find any files in the mount point,U01 U06 or U10, when I put BDF command it shows the following $ bdf Filesystem kbytes used avail %used Mounted on /dev/vg00/lvol3 204800 35571 158662 18% / /dev/vg00/lvol1 299157 38506 230735 14% /stand /dev/vg00/lvol8 1392640 1261068 123620 91% /var /dev/vg00/lvol7 1327104 825170 470631 64% /usr /dev/vg00/lvol4 716800 385891 310746 55% /tmp /dev/vg00/lvol6 872448 814943 53936 94% /opt /dev/vg00/lvolssh 32768 13243 18306 42% /opt/openssh /dev/vg00/lvol5 204800 187397 16334 92% /home /dev/vg00/lvolback 512000 472879 36704 93% /backup dg-ora04:/dgora03_u10 204800 167088 35416 83% /u10 dg-ora04:/dgora03_u06 204800 167088 35416 83% /u06 dg-ora04:/dgora03_u01 204800 167088 35416 83% /u01 Why can't I see any files inside the mount points?

    Read the article

< Previous Page | 132 133 134 135 136 137 138 139 140 141 142 143  | Next Page >