Search Results

Search found 62701 results on 2509 pages for 'sql function'.

Page 1361/2509 | < Previous Page | 1357 1358 1359 1360 1361 1362 1363 1364 1365 1366 1367 1368  | Next Page >

  • using empty on inaccessible object with __isset and __get

    - by David
    <?php class Magic_Methods { protected $meta; public function __construct() { $this->meta = (object) array( 'test' => 1 ); } public function __isset($name) { echo "pass isset {$name} \n"; return isset($this->$name); } public function __get($name) { echo "pass get {$name} \n"; return $this->$name; } } $mm = new Magic_Methods(); $meta = empty($mm->meta->notExisting); var_dump($meta); echo "||\n"; $meta = empty($mm->meta); var_dump($meta); The snippet above does not work as expected for me. Why would the first empty() ommit the __isset? I get this: pass get meta bool(true) || pass isset meta pass get meta bool(false) I would expected identical results or another pass at the __isset, but not a direct call to __get. Or am I missing something here?

    Read the article

  • Returning JSON from JavaScript to Python

    - by Chris Lacy
    I'm writing a simple App Engine app. I have a simple page that allows a user to move a marker on a Google map instance. Each time the user drops the marker, I want to return the long/lat to my Python app. function initialize() { ... // Init map var marker = new GMarker(center, {draggable: true}); GEvent.addListener(marker, "dragend", function() { // I want to return the marker.x/y to my app when this function is called .. }); } To my (admittedly limited) knowledge, I should be: 1). Returning a JSON structure with my required data in the listener callback above 2). In my webapp.RequestHandler Handler class, trying to retrieve the JSON structure during the post method. I would very much like to pass this JSOn data back to the app without causing a page reload (which is what has happened when I've used various post/form.submit methods so far). Can anyone provide me with some psuedo code or an example on how I might achieve what I'm after? Thanks.

    Read the article

  • HREF link that targets nothing, does not want to use hash or void(0)

    - by Mattis
    I have a link that I want to be able to click to trigger a piece of jQuery code. Currently I have <a href="#" id="foo">Link</a> and $('#foo').click(function(){ // Do stuff }); which works well. But, I have always hated using hash in this way. The page flickers and the hash is added to the page url. One alternative is to use <a href="javascript:void(0);" id="foo">Link</a> but I also dislike seeing that piece of code in the browser status bar. It looks tacky. What I'd rather have is an explanatory javascript placeholder that does nothing, like <a href="javascript:zoom();" id="foo">Link</a> which actually works, but throws an ReferenceError in the javascript console since there are no such function. What's the minimum definition of a function that does nothing? Are there any other alternatives? Should I just skip the link and use something like <span id="foo" style="cursor:pointer;cursor:hand;">Link</span> instead?

    Read the article

  • How do I avoid killing the native controls on a html5-video when i've started it programmaticly?

    - by Nils
    OK, so the deal is I've started making a little videoplayer, that works by clicking a div with an image, expanding the div and the image, and then exchanges the image with a html5-videotag. the code is as below. (It's very early on, so i know theres a lot that need improving, as in not using javascript to set styles and so on, but nevertheless, any insigts and tips are welcome, besides the answer to the main question) /*Begin Expander*/ var $videoplayer = $('<video width="640" height="360" preload="none" controls="" tabindex="0" style="position: relative;"><source type="video/mp4" src="/restalive/movies/big_buck_bunny.mp4"></source><source type="video/ogg" src="/restalive/movies/big_buck_bunny.ogv"></source></video>').appendTo('body'); $videoplayer.hide(); $(".ExpandVideo").each(function(i){ var $trigger = $(this); var $image = $trigger.find("img"); $image.css({ "width" : "100%" ,"height" : "auto" }) $trigger.css({ "display" : "block" ,"overflow" : "hidden" ,"width" : "200px" ,"float" : "left" }); $trigger.bind("click", function(e){ $trigger.animate({"width" : "640px"}, "fast", function(){ $image.replaceWith($videoplayer); $videoplayer.show(); $videoplayer.attr("id", "video" + i); var video = document.getElementById("video" + i); video.play(); }) }) }); However, the main problem is that when i've fired of the video like this (video.play()), the native controls stop working, i can no longer pause the video, even though the controls are there, and clickable, the video just starts playing immidiatley again when i trie to pause it. Which is a shame, because i want to use the native controls for simplicity.

    Read the article

  • jQuery Ajax loads URL multiple times, how do I unbind/rebind properly?

    - by gmoz22
    I load a SELECT element via Ajax (list of brands), get its selected value (brand id) and load another SELECT via another Ajax URL (list of templates for currently selected brand). Here's my code: $(document).ready( function() { // DO NOT cache Ajax calls $.ajaxSetup ({ cache: false }); // loader var ajax_load = "Loading..."; // Brands List URL var loadBrandUrl = "getBrandsList.php"; // Templates List URL var loadTemplateUrl = "getTemplatesList.php"; $("#brandslistSelect").html(ajax_load).load(loadBrandUrl) .ajaxComplete(function(){ // Brands select loaded /* Load Templates SELECT the first time since no .change() has happened */ var selectedBrand = $("#brandslistSelect option:selected").attr("value"); // get the value console.log(selectedBrand); // Log selected brand to console // get Templates select, commented for now since it does an infinite loop // $("#templateslistSelect").html(ajax_load).load(loadTemplateUrl, { BrandId: selectedBrand } ); /* End initial load template */ /* On interaction with the Brands SELECT */ $("#brandslistSelect").change(function () { // on interaction with select selectedBrand = $("#brandslistSelect option:selected").attr("value"); // get the value // get Templates SELECT $("#templateslistSelect").html(ajax_load).load(loadTemplateUrl, { BrandId: selectedBrand } ) }); /* End interaction with the Brands SELECT */ }); }); It returns selectedBrand in the console 3 times : selectedBrand = undefined selectedBrand = undefined selectedBrand = 101 Now, if I uncomment the following line, same output as above but it also loads the templates URL indefinitely : // $("#templateslistSelect").html(ajax_load).load(loadTemplateUrl, { BrandId: selectedBrand } ); Any idea how I could modify this code to make it work as intended? Thanks for your help stackOverflow community!

    Read the article

  • Convert enumeration to string

    - by emptyheaded
    I am trying to build a function that converts an item from an enum to its corresponding string. The enums I use are fairly long, so I didn't want to use a switch-case. I found a method using boost::unordered_map very convenient, but I don't know how to make a default return (when there is no item matching the enum). const boost::unordered_map<enum_type, const std::string> enumToString = boost::assign::map_list_of (data_1, "data_1") (data_2, "data_2"); I tried to create an additional function: std::string convert(enum_type entry) { if (enumToString.find(entry)) // not sure what test to place here, return enumToString.at(entry); //because the find method returns an iter else return "invalid_value"; } I even tried something exceedingly wrong: std::string convert(enum_type entry) { try{ return enumToString.at(entry); } catch(...){ return "invalid_value"; } } Result: evil "Debug" runtime error. Can somebody give me a suggestion on how to either 1) find an easier method to convert enum to a string with the same name as the enum item 2) find a way to use already built boost methods to get a default value from a hash map (best option) 3) find what to place in the test to use a function that returns either the pair of the key-value, or a different string if the key is not found in the map. Thank you very much.

    Read the article

  • Noobie Jquery Question

    - by piratebill
    I've been working with Jquery fro a grand total of two hours now. Up until this point I have made this really simple FAQ page. <script type="text/javascript" src="jquery.js"></script> <script type="text/javascript"> $(document).ready(function() { $("#void").click(function(event) { event.preventDefault(); }); $('#faq').find('dd').hide().end().find('dt').click(function() { $(this).next().slideToggle(); }); }); </script> <dl id="faq"> <dt><a href="" id="void">Coffee</a></dt> <dd>- black hot drink</dd> <dt><a href="" id="void">Milk</a></dt> <dd>- white cold drink</dd> </dl> The problem is only the first item is working. My questions are, why is only the first entree working and how do I fix it? I've tried using an each() but I am unsure where to put it.

    Read the article

  • JS: Object itteration fails

    - by Newbie
    Hello! In my JS, I have an object called box_object. It looks like this: ({ id:"3", text:"this is a box object", connection_parent:["1", "2"], connection_child:["5", "6"], connectiondata_child:{ 0:{id:"5", linepoint:"bottom"}, 1:{id:"6", linepoint:"bottom"}}, connectiondata_parent:{ 0:{id:"1", linepoint:"top"}, 1:{id:"2", linepoint:"top"}} }) Now, I want to add some position values to box_object.connectiondata_parent. Using jQuery I can use the .each() method. So I tried it, but it failed. In my function I do the following: $(box_object.connectiondata_parent).each(function(it, obj){ if(typeof(obj[it]) != "undefined" && obj[it].linepoint == "top"){ var point_position_top = new Object(); point_position_top.left = startingpoint_left; point_position_top.top = startingpoint_top; obj[it].position = point_position_top; }else if(typeof(obj[it]) != "undefined" && obj[it].linepoint == "bottom"){ var point_position_bottom = new Object(); point_position_bottom.left = startingpoint_left; point_position_bottom.top = startingpoint_bottom; obj[it].position = point_position_bottom; }else{} }); After the function my box_object looks like this: ({ id:"3", text:"this is third box", connection_parent:["1", "2"], connection_child:["5", "6"], connectiondata_child:{ 0:{id:"5", linepoint:"bottom"}, 1:{id:"6", linepoint:"bottom"}}, connectiondata_parent:{ 0:{id:"1", linepoint:"top", position:{left:500, top:104}}, 1:{id:"2", linepoint:"top"}} }) It seems it only writes the values to the first "value". Any Ideas why?

    Read the article

  • Access is denied. Javascript error on request to secured page

    - by ihorko
    On SomePage.aspx page by javascript (XMLHttpRequest) I call SecuredPage.aspx used next code: var httpRequest = GetXmlHttp(); var url = "https://myhost.com/SecuredPage.aspx"; var params = "param1=" + document.getElementById('param1').value + "&param2=" + document.getElementById('param2').value; httpRequest.open("POST", url, true); httpRequest.setRequestHeader("Content-Type", "application/x-www-form-urlencoded"); httpRequest.onreadystatechange = function() { //Call a function when the state changes. if (httpRequest.readyState == 4 && httpRequest.status == 200) { alert(httpRequest.responseText); } } httpRequest.send(params); // HERE ACCESS IS DENIED //--------------------------------------------- function GetXmlHttp() { var xmlhttp = false; if (window.XMLHttpRequest) { xmlhttp = new XMLHttpRequest(); } else if (window.ActiveXObject) // code for IE { try { xmlhttp = new ActiveXObject("Msxml2.XMLHTTP"); } catch (e) { try { xmlhttp = new ActiveXObject("Microsoft.XMLHTTP"); } catch (E) { xmlhttp = false; } } } return xmlhttp; } It throws Access is denied error. if send to http (http://myhost.com/SecuredPage.aspx), it works fine. How is it possible to resolve that problem. Thanks!

    Read the article

  • Jquery tabs with cookie support restore wrong tab position after page refresh.

    - by zenonych
    Hello, all. I have tricky problem which I can't completely understand... It's jquery tabs with cookie support. I've following code: $(document).ready(function() { var $tabs = $("#tabs").tabs(); $tabs.tabs('select', $.cookie("tabNumber")); $('#tabs ul li a').click(function() { $.cookie("tabNumber", $tabs.tabs('option', 'selected')); }); $('#btnSelect').click(function() { //alert($.cookie("tabNumber")); //$tabs.tabs('select', 2); $tabs.tabs('select', $.cookie("tabNumber")); }); }); So, I've 3 tabs (with positions 0,1,2) inside div named "tabs". When user selects one tab, then tab position stores in cookie. After that if user refresh page, active tab position must be restored. But each time I refresh page I get active tab in previous position (if I select 2nd tab, then after refresh I got active tab in position 1, etc.). I add some test in code (button btnSelect with onclick handler which duplicates load position functionality). So, if I uncomment and use $tabs.tabs('select', 2); Then after I click btnSelect I've got right position. Ok, that's right. Then I comment that line and uncomment next one: alert($.cookie("tabNumber")); So, I select tab, click button, get dialog message "2", and after that tab in position 1 became active. Why?? In both cases I call 'select' method with parameter 2... I know I can use aliases for tabs, but I want to understate why my code doesn't work properly.

    Read the article

  • Manipulating original elements with qTip

    - by pjotr
    I have a bunch of divs on my page and each of them has only the class attribute. In the divs there are some spans, which are set up to display a tooltip with the help of qTip. The tooltip should contain three items: Up: anchor, which should move the OuterDiv up (probably something like this: move up/down in jquery) Down: anchor, which should move the OuterDiv down Delete: anchor, which should remove the calling OuterDiv My code so far: <body> <div class="OuterDiv"> <div class="InnerDiv"> <span class="Position">Position 1</span> </div> </div> <div class="OuterDiv"> <div class="InnerDiv"> <span class="Position">Position 2</span> </div> </div> </body> And scripts: $(document).ready(function () { var qTipContent = '<a href="javascript:void(0)" onclick="">&uarr;</a>&nbsp;&nbsp;&nbsp;'; qTipContent = qTipContent + '<a href="javascript:void(0)" onclick="">&darr;</a>&nbsp;&nbsp;&nbsp;'; qTipContent = qTipContent + '<a href="javascript:void(0)" onclick="">X</a>'; $('.Position').each(function () { $(this).qtip({ content: qTipContent, hide: { fixed: true } }) }); }); How should the onclick function in the qTip content look like?

    Read the article

  • Adding date to multiple fields via datepicker

    - by Andy
    i have a form in drupal with jquery based date module. there are multiple fields with date picker enabled. i want to set the value of all of them (they all have class .date-popup-init) to the value of the first field (#edit-field, the 'from' date) when that field is set. my code so far: <script type="text/javascript"> var DatePicked = function() { var firstdate = $("#edit-field"); var updater = firstdate.datepicker("getDate"); $(".date-popup-init").each(function(){ $(this).datepicker("setDate", updater); }); } $(function() { $("#edit-field").datepicker({ onSelect: DatePicked }); }); </script> this seems to randomly work; it sets the date of some fields to the value of #edit-field, seemingly different fields each time. also, the form adds more datepicker-enabled fields via ajax. is there any way to ensure that all these new fields, when they load, pick up the value of #edit-field as well? disclaimer: last night was my first attempt at javascript of any kind. i have a basic idea now. the above was cobbled through countless google examples.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • drupal hook_menu_alter9) for adding tabs

    - by EricP
    I want to add some tabs in the "node/%/edit" page from my module called "cssswitch". When I click "Rebuild Menus", the two new tabs are displayed, but they are displayed for ALL nodes when editing them, not just for the node "cssswitch". I want these new tabs to be displayed only when editing node of type "cssswitch". The other problem is when I clear all cache, the tabs completely dissapear from all edit pages. Below is the code I wrote. function cssswitch_menu_alter(&$items) { $node = menu_get_object(); //print_r($node); //echo $node->type; //exit(); if ($node->type == 'cssswitch') { $items['node/%/edit/schedulenew'] = array( 'title' => 'Schedule1', 'access callback'=>'user_access', 'access arguments'=>array('view cssswitch'), 'page callback' => 'cssswitch_schedule', 'page arguments' => array(1), 'type' => MENU_LOCAL_TASK, 'weight'=>4, ); $items['node/%/edit/schedulenew2'] = array( 'title' => 'Schedule2', 'access callback'=>'user_access', 'access arguments'=>array('view cssswitch'), 'page callback' => 'cssswitch_test2', 'page arguments' => array(1), 'type' => MENU_LOCAL_TASK, 'weight'=>3, ); } } function cssswitch_test(){ return 'test'; } function cssswitch_test2(){ return 'test2'; } Thanks for any help.

    Read the article

  • c# template member functions

    - by user3730583
    How can I define a template member function in C# For instance I will fill any collection which supports an Add(...) member function, please check out the sample code below public class CInternalCollection { public static void ExternalCollectionTryOne<T<int>>(ref T<int> ext_col, int para_selection = 0) { foreach (int int_value in m_int_col) { if (int_value > para_selection) ext_col.Add(int_value); } } public static void ExternalCollectionTryTwo<T>(ref T ext_col, int para_selection = 0) { foreach (int int_value in m_int_col) { if (int_value > para_selection) ext_col.Add(int_value); } } static int[] m_int_col = { 0, -1, -3, 5, 7, -8 }; } The ExternalCollectionTryOne<...(...) would be the preferred kind, because the int type can be explicit defined, but results in an error: Type parameter declaration must be an identifier not a type The type or namespace name 'T' could not be found (are you missing a using directive or an assembly reference?) The ExternalCollectionTryTwo<...(...) results in an error: 'T' does not contain a definition for 'Add' and no extension method 'Add' accepting a first argument of type 'T' could be found (are you missing a using directive or an assembly reference?)... I hope the problem is clear – any suggestions? ----------------------------- edit -------------------------- The answers with the interface ICollection<.. without a template member works fine and thanks all for this hint, but I still cannot define successfully a member template(generic) function So a more simpler example ... how can I define this public class CAddCollectionValues { public static void AddInt<T>(ref T number, int selection) { T new_T = new T(); //this line is just an easy demonstration to get a compile error with type T foreach (int i_value in m_int_col) { if (i_value > selection) number += i_value; //again the type T cannot be used } } static int[] m_int_col = { 0, -1, -3, 5, 7, -8 }; }

    Read the article

  • Slow Response in checkbox using JQuery

    - by Dean
    Hi to all. I'm trying to optimize a website. The flow is i tried to query a certain table and all of its data entry in a page(w/ toolbars), work fine. When i tried to edit the page the problem is when i click the checkbox button i have to wait 2-5sec just by clicking it. I limit the viewing of entry to 5 only but the response on checkbox doesn't change. The tables have 100 entries in them. function checkAccess(celDiv,id) { var celValue = $(celDiv).html(); if (celValue==1) $(celDiv).html("<input type='checkbox' value='"+$(celDiv).html()+"' checked disabled>") else $(celDiv).html("<input type='checkbox' value='"+$(celDiv).html()+"' disabled>") $(celDiv).click ( function() { $('input',this).each( function(){ tr_idx = $('#detFlex1 tbody tr').index($(this).parent().parent().parent()); td_idx = $('#detFlex1 tbody tr:eq('+tr_idx+') td').index($(this).parent().parent()); td_last = 13; for(var td=td_idx+1; td<=td_last;td++) { if ($(this).attr('checked') == true) { df[0].rows[tr_idx].cell[td_idx] = 1;//index[1] = Full Access if (td_idx==3) { df[0].rows[tr_idx].cell[td] = 1; } df[0].rows[tr_idx].cell[2] = 1; if (td_idx > 3) { df[0].rows[tr_idx].cell[2] = 1; } } else { df[0].rows[tr_idx].cell[td_idx] = 0;//index[0] = With Access if (td_idx==2) { df[0].rows[tr_idx].cell[td] = 0; } else if (td_idx==3) { df[0].rows[tr_idx].cell[td] = 0; } if (td_idx > 3) { df[0].rows[tr_idx].cell[3] = 0; } } } $('#detFlex1').flexAddData(df[0]); $('.toolbar a[title=Edit Item]').trigger('click'); }); } ); } I've thought that the problem is this above code. Could anyone help me simplify this code.?

    Read the article

  • Determining selected state of jQuery Buttons

    - by lloydphillips
    I've got two radio buttons in a .net page which are being transformed to jQuery buttons a la http://jqueryui.com/demos/button/#radio When the page is loaded I have button 2 as checked. When clicking the buttons I'm firing the postback event. Problem is you can click on that button that is selected by default on the initial load i.e. Button 2, the postback is fired but the event handler isn't called in the .net code behind because the radio button is already classed as selected (and in normal circumstances wouldn't allow the postback to fire). To get around this I've added the e.PreventDefault() method BUT this is causing issues when Button 1 is clicked because before the click handler is called the button is set to selected. Therefore, in every case in the following code e.PreventDefault() is called: $(document).ready(function(){ $("[id*='rbPayable']").click(function(e){ if ($("[id*='rbPayable']").attr("checked")) e.preventDefault(); else setTimeout('__doPostBack(\'this.id\',\'\')', 0) }) $("[id*='rbReceivable']").click(function(e){ if ($("[id*='rbReceivable']").attr("checked")) e.preventDefault(); else setTimeout('__doPostBack(\'this.id\',\'\')', 0) }) }); What is the best way for me to load the page and effectively be able to do the following: 'If rbReceivable is checked then don't do anything otherwise do a postback.'

    Read the article

  • CSS class not working as expected [closed]

    - by user1050619
    My HTML codes not implement the CSS styling..The border in the CSS file is not being implemented. I tried both in Firefox & IE. Please provide your inputs. Please find the code below: HTML <html> <head> <link href="file://c:/jquery/chapter-1/begin/styles/my_style.css" rel="stylesheet"> </head> <body> <div id="header" class="no_hover"><h1>Header</h1></div> <button type="button" id="btn1">Click to Add</button> <button type="button" id="btn2">Click to Remove</button> <script src="file://c:/jquery/chapter-1/begin/scripts/jquery.js" type="text/javascript"></script> <script src="file://c:/jquery/chapter-1/begin/scripts/test4.js" type="text/javascript"></script> </body> </html> jS FILE $(document).ready(function() { $("#btn1").click( function(){ $("#header").addClass("hover"); $("#header").removeClass("no_hover"); }); $("#btn2").click( function(){ $("#header").removeClass("hover"); $("#header").addClass("no_hover"); }); }); CSS FILE .hover{ border: solid #f00 3px; } .no_hover{ border: solid #000 3px; }

    Read the article

  • How to use clearInterval() and then make changes to the DOM?

    - by George D.
    I have this code and the problem I have is that I want to stop the loop and then replace the text 'Done!' that comes from the sms-loader.php script with the "textnew" string. Problem is that the loop occurs one more time so the text in the div.checkstatus field is again replaced by the calling php script. The strange thing is that I see the log message and again I get a new (and final) request, although the ordering is the opposite (first stop then replace text()) in my script. I need to understand why this is happening. $(document).ready(function() { var interval = ""; $('.checkstatus').each(function(){ var msgid = $(this).data('msg') $this = $(this), hid = $this.data('history'), textnew = '<a href="sms-dstatus.php?id='+msgid+'&sid=' +hid+ '&amp;keepThis=true&amp;TB_iframe=true&amp;height=430&amp;width=770" title="Delivery Status" class="thickbox"><img src="../template/icons/supermini/chart_curve.png" alt="status" width="16" height="16" /></a>'; interval = setInterval(function() { $this.load('../pages/sms-loader.php?id='+msgid); // stop the loop if($this.text()=='Done!'){ // stop it clearInterval(interval); console.log(textnew); this.html(textnew); /// this line is the problem } }, 5000); // 5 secs }); });

    Read the article

  • Translate Prototype code into Jquery version

    - by user1055495
    I everybody, I'm working on a SaaS application and I need to use Jquery instead of Prototype due to some extra plugins integration. My code that was wotking a charm with Prototype is not running anymore with Jquery and I'm not used to write in this framework... Is there someone to help me in "translating" this one: Thanks a lot for your help. var rates = new Array(); <% for tva_rate in @tva_rates -%> rates.push(new Array(<%= tva_rate.id %>, '<%=h tva_rate.taux %>', '<%=h tva_rate.compte_id %>' )); <% end -%> function tvaSelected() { tva_id = $('journal_tva_id').getValue(); show = 1; if (tva_id > 0){ rates.each(function(rate) { if (rate[0] == tva_id) { $('journal_taux').setValue(rate[1]); $('journal_compte_tva').setValue(rate[2]); show = 2; } }); } if (show == 1) { $('tva_taux_field').hide(); } else { $('tva_taux_field').show(); } } document.observe('dom:loaded', function() { tvaSelected(); $('journal_tva_id').observe('change', tvaSelected); });

    Read the article

  • qTip pop ups come in from top left of screen (on first load)

    - by franko75
    Hi, not sure if i'm set things up incorrectly - I don't seem to see anyone else with this problem, but my qTip popups (all ajax loaded content) are loading quite erratically, in that they are often animating in from off screen before appearing in the correct position. Is there a simple solution to this which I may have missed? Thanks again for your help. HTML markup: <span class="formInfo"> <a href="http://localhost/httpdocs/index.php/help/kc_dob" class="jTip" name="" id="dob_help">?</a> </span> qTip initialisation.. //set up for qtip function initQtip() { $('a.jTip').each(function() { $(this).qtip( { content: { // Set the text to an image HTML string with the correct src URL to the loading image you want to use text: '<img src="/media/images/wait.gif" alt="Loading..." />', url: $(this).attr('href') // Use the rel attribute of each element for the url to load }, position: { adjust: { screen: true // Keep the tooltip on-screen at all times } }, show: { when: 'click', solo: true // Only show one tooltip at a time }, hide: 'unfocus', style: { tip: true, // Apply a speech bubble tip to the tooltip at the designated tooltip corner border: { width: 10, radius: 10 }, width: { min: 200, max: 500 }, name: 'light' // Use the default light style } }); //prevent default event on click }).bind('click', function(event){ event.preventDefault(); return false; }); }

    Read the article

  • Use string to store statement (or part of a statement), and then add it to the code

    - by Dean
    I use multidimensional arrays to store product attributes (well Virtuemart does, to be precise). When I tried to echo the sub-arrays value, if the sub-array did not exist PHP threw: Fatal error: Cannot use string offset as an array To get around this, I attempted to create a function to check on every array level if it is an actual array, and if it is empty (when trying on the whole thing at once such as: is_array($array['level1']['level2']['level3']), I got the same error if level1 or level2 are not actual arrays). This is the function ($array contains the array to check, $array_levels is an array containing the names of the sub-arrays, in the order they should apper): function check_md_array($array,$array_levels){ if(is_array($array)){ $dimension = null; //This will store the dimensions string foreach($array_levels as $level){ $dimension .= "['" . $level . "']"; //Add the current dimension to the dimensions string if(!is_array($array/* THE CONTENT OF $dimension SHOULD BE INSERTED HERE*/)){ return false; } } return true; } } How can I take the string contained in $dimensions, and insert it into the code, to be part of the statement?

    Read the article

  • optimize output value using a class and public member

    - by wiso
    Suppose you have a function, and you call it a lot of times, every time the function return a big object. I've optimized the problem using a functor that return void, and store the returning value in a public member: #include <vector> const int N = 100; std::vector<double> fun(const std::vector<double> & v, const int n) { std::vector<double> output = v; output[n] *= output[n]; return output; } class F { public: F() : output(N) {}; std::vector<double> output; void operator()(const std::vector<double> & v, const int n) { output = v; output[n] *= n; } }; int main() { std::vector<double> start(N,10.); std::vector<double> end(N); double a; // first solution for (unsigned long int i = 0; i != 10000000; ++i) a = fun(start, 2)[3]; // second solution F f; for (unsigned long int i = 0; i != 10000000; ++i) { f(start, 2); a = f.output[3]; } } Yes, I can use inline or optimize in an other way this problem, but here I want to stress on this problem: with the functor I declare and construct the output variable output only one time, using the function I do that every time it is called. The second solution is two time faster than the first with g++ -O1 or g++ -O2. What do you think about it, is it an ugly optimization?

    Read the article

  • Is there a more elegant solution than an if-statement with no else clause?

    - by Jay
    In the following code, if Control (the element that trigers Toggle's first OL) is not Visible it should be set Visible and all other Controls (Controls[i]) so be Hidden. .js function Toggle(Control){ var Controls=document.getElementsByTagName("ol",document.getElementById("Quote_App")); var Control=Control.getElementsByTagName("ol")[0]; if(Control.style.visibility!="visible"){ for(var i=0;i<Controls.length;i++){ if(Controls[i]!=Control){ Reveal("hide",20,0.3,Controls[i]); }else{ Reveal("show",20,0.3,Control); }; }; }else{ Reveal("hide",20,0.3,Control); }; }; Although the function [Toggle] works fine, it is actually setting Controls[i] to Hidden even if it is already. This is easily rectified by adding an If statement as in the code below, surely there is a more elegant solution, maybe a complex If condition? .js function Toggle(Control){ var Controls=document.getElementsByTagName("ol",document.getElementById("Quote_App")); var Control=Control.getElementsByTagName("ol")[0]; if(Control.style.visibility!="visible"){ for(var i=0;i<Controls.length;i++){ if(Controls[i]!=Control){ if(Controls[i].style.visibility=="visible"){ Reveal("hide",20,0.3,Controls[i]); }; }else{ Reveal("show",20,0.3,Control); }; }; }else{ Reveal("hide",20,0.3,Control); }; }; Your help is appreciated always.

    Read the article

  • Why does my JQuery Image swap not work in firefox or chrome, but fine in IE?

    - by Cognize
    Hi, Relatively new to JQuery. I've got some code that does a banner swap with a fade in fade out transition. The images swap as expected in IE8, chrome, and firefox. However, the actual fade, the smooth transition between images only works in IE. Can anyone point me in the right direction for a fix? Javascript: function swapImages() { var $active = $('#transitionImagePlaceHolder .active'); var $next = ($('#transitionImagePlaceHolder .active').next().length > 0) ? $('#transitionImagePlaceHolder .active').next() : $('#transitionImagePlaceHolder img:first'); $active.fadeOut( 'slow', function () { $next.fadeIn('slow').addClass('active'); $active.removeClass('active'); }); } $(document).ready(function () { setInterval('swapImages()', 5000); }); CSS: #transitionImagePlaceHolder { } #transitionImagePlaceHolder { position:relative; left: 26px; } #transitionImagePlaceHolder img { display:none; position:absolute; top:4; left:10; } HTML: <div id="transitionImagePlaceHolder"> <img class="active" src="Images/TransitionImages/Trans_Img_1.jpg" /> <img src="Images/TransitionImages/Trans_Img_2.jpg" /> <img src="Images/TransitionImages/Trans_Img_3.jpg" /> </div>

    Read the article

< Previous Page | 1357 1358 1359 1360 1361 1362 1363 1364 1365 1366 1367 1368  | Next Page >