Search Results

Search found 35604 results on 1425 pages for 'text align'.

Page 1367/1425 | < Previous Page | 1363 1364 1365 1366 1367 1368 1369 1370 1371 1372 1373 1374  | Next Page >

  • Objective-C Basic class related question, retaining the value of a specific object using a class fil

    - by von steiner
    Members, scholars, code gurus. My background is far from any computer programming thus my question may seems basic and somewhat trivial to you. Nevertheless it seems that I can't put my head around it. I have googled and searched for the answer, just to get myself confused even more. With that, I would kindly ask for a simple explanation suitable for a non technical person such as myself and for other alike arriving to this thread. I have left a comment with the text "Here is the issue" below, referring to my question. // character.h #import <Foundation/Foundation.h> @interface character : NSObject { NSString *name; int hitPoints; int armorClass; } @property (nonatomic,retain) NSString *name; @property int hitPoints,armorClass; -(void)giveCharacterInfo; @end // character.m #import "character.h" @implementation character @synthesize name,hitPoints,armorClass; -(void)giveCharacterInfo{ NSLog(@"name:%@ HP:%i AC:%i",name,hitPoints,armorClass); } @end // ClassAtLastViewController.h #import <UIKit/UIKit.h> @interface ClassAtLastViewController : UIViewController { } -(void)callAgain; @end // ClassAtLastViewController.m #import "ClassAtLastViewController.h" #import "character.h" @implementation ClassAtLastViewController - (void)viewDidLoad { //[super viewDidLoad]; character *player = [[character alloc]init]; player.name = @"Minsc"; player.hitPoints = 140; player.armorClass = 10; [player giveCharacterInfo]; [player release]; // Up until here, All peachy! [self performSelector:@selector(callAgain) withObject:nil afterDelay:2.0]; } -(void)callAgain{ // Here is the issue, I assume that since I init the player again I loss everything // Q1. I loss all the data I set above, where is it than? // Q2. What is the proper way to implement this character *player = [[character alloc]init]; [player giveCharacterInfo]; } Many thanks in advance, Kindly remember that my background is more related to Salmons breeding than to computer code, try and lower your answer to my level if it's all the same to you.

    Read the article

  • WebServices does not interact with App

    - by daemonfire300
    I got a Silverlight App with-in a Web Project Web Silverlight The web contains a service: [WebService(Namespace = "svChat")] [WebServiceBinding(ConformsTo = WsiProfiles.BasicProfile1_1)] // To allow this Web Service to be called from script, using ASP.NET AJAX, uncomment the following line. //[System.Web.Script.Services.ScriptService] public class GetIPService : System.Web.Services.WebService { public GetIPService () { //Uncomment the following line if using designed components //InitializeComponent(); } [WebMethod] public string GetIp() { return HttpContext.Current.Request.ServerVariables["HTTP_X_FORWARDED_FOR"]; } } And I got a class in my Silverlight App using the Service: public class Client { private string ip; private string created; #region Properties public string Ip { get { return ip; } set { ip = value; } } public string Created { get { return created; } set { created = value; } } #endregion public Client() { } public void SetIp() { ServiceReference1.GetIPServiceSoapClient scIpClient = new svChat.ServiceReference1.GetIPServiceSoapClient(); scIpClient.GetIpCompleted += new EventHandler<svChat.ServiceReference1.GetIpCompletedEventArgs>(IpService_Completed); scIpClient.GetIpAsync(); } private void IpService_Completed(object sender, ServiceReference1.GetIpCompletedEventArgs e) { this.ip = e.Result; } } After Client is created, SetIp() is called, and Client.Ip is added to a text box. Nothing happens. Ip = null. Service itselfs works, tested it. Getting Ip by the above code works. Gettings Ip via service through Silverlight App does not work. <configuration> <system.serviceModel> <bindings> <basicHttpBinding> <binding name="GetIPServiceSoap" maxBufferSize="2147483647" maxReceivedMessageSize="2147483647"> <security mode="None" /> </binding> </basicHttpBinding> </bindings> <client> <endpoint address="http://localhost:2090/svChat.Web/GetIPService.asmx" binding="basicHttpBinding" bindingConfiguration="GetIPServiceSoap" contract="ServiceReference1.GetIPServiceSoap" name="GetIPServiceSoap" /> </client> </system.serviceModel> </configuration> Any ideas? regards,

    Read the article

  • using LoadControl with object initializer to create properties

    - by lloydphillips
    In the past I've used UserControls to create email templates which I can fill properties on and then use LoadControl and then RenderControl to get the html for which to use for the body text of my email. This was within asp.net webforms. I'm in the throws of building an mvc website and wanted to do something similar. I've actually considered putting this functionality in a seperate class library and am looking into how I can do this so that in my web layer I can just call EmailTemplate.SubscriptionEmail() which will then generate the html from my template with properties in relevant places (obviously there needs to be parameters for email address etc in there). I wanted to create a single Render control method for which I can pass a string to the path of the UserControl which is my template. I've come across this on the web that kind of suits my needs: public static string RenderUserControl(string path, string propertyName, object propertyValue) { Page pageHolder = new Page(); UserControl viewControl = (UserControl)pageHolder.LoadControl(path); if (propertyValue != null) { Type viewControlType = viewControl.GetType(); PropertyInfo property = viewControlType.GetProperty(propertyName); if (property != null) property.SetValue(viewControl, propertyValue, null); else { throw new Exception(string.Format( "UserControl: {0} does not have a public {1} property.", path, propertyName)); } } pageHolder.Controls.Add(viewControl); StringWriter output = new StringWriter(); HttpContext.Current.Server.Execute(pageHolder, output, false); return output.ToString(); } My issue is that my UserControl(s) may have multiple and differing properties. So SubscribeEmail may require FirstName and EmailAddress where another email template UserControl (lets call it DummyEmail) would require FirstName, EmailAddress and DateOfBirth. The method above only appears to carry one parameter for propertyName and propertyValue. I considered an array of strings that I could put the varying properties into but then I thought it'd be cool to have an object intialiser so I could call the method like this: RenderUserControl("EmailTemplates/SubscribeEmail.ascs", new object() { Firstname="Lloyd", Email="[email protected]" }) Does that make sense? I was just wondering if this is at all possible in the first place and how I'd implement it? I'm not sure if it would be possible to map the properties set on 'object' to properties on the loaded user control and if it is possible where to start in doing this? Has anyone done something like this before? Can anyone help? Lloyd

    Read the article

  • Dynamic positioning inside relative div

    - by ian
    I'm trying to get a color picker javascript widget working in a page with a bunch of "stuff" in it that I can't change. Some of the "stuff" is causing the color picker to appear well below the link when clicked. I've reduced it to a simple example below. <html> <head> <script type="text/javascript"> function setPos(aname,dname) { var o=document.getElementById(aname); var ol=o.offsetLeft; while ((o=o.offsetParent) != null) { ol += o.offsetLeft; } o=document.getElementById(aname); var ot=o.offsetTop + 25; while((o=o.offsetParent) != null) { ot += o.offsetTop; } document.getElementById(dname).style.left = ol + "px"; document.getElementById(dname).style.top = ot + "px"; } </script> <style> h1 {height: 50px;} #divMain {position: relative;} </style> </head> <body> <h1></h1> <div id="divMain"> <a href="#" onClick="setPos('link1','div1');return false;" name="link1" id="link1">link 1</a> <div id="div1" style="position:absolute;border-style:solid;left:200px;top:200px;">div 1</div> </div> </body> </html> What's supposed to happen is when you click "link 1", "div1" should move directly below "link 1". What actually happens is that "div 1" appears well below "link 1". If you remove position: relative; from the CSS definition for divMain, "div 1" is positioned correctly. How can I position "div 1" directly beneath "link 1" without removing position: relative;?

    Read the article

  • how to fix protocol violation in c#

    - by Jeremy Styers
    I have a c# "client" and a Java "server". The java server has a wsdl it serves to the client. So far it works for c# to make a request for the server to perform a soap action. My server gets the soap request executes the method and tries to return the result back to the client. When I send the response to c# however, I get "The server committed a protocol violation. Section=ResponseStatusLine". I have spent all day trying to fix this and have come up with nothing that works. If I explain what i did, this post would be very long, so I'll keep it brief. i Googled for hours and everything tells me my "response line" is correct. I tried shutting down Skype, rearranging the response line, adding things, taking things away, etc, etc. All to no avail. This is for a class assignment so no, I can not use apis to help. I must do everything manually on the server side. That means parsing by hand, creating the soap response and the http response by hand. Just thought you'd like to know that before you say to use something that does it for me. I even tried making sure my server was sending the correct header by creating a java client that "mimicked" the c# one so I could see what the server returned. However, it's returning exactly what i told it to send. I tried telling my java client to do the same thing but to an actuall running c# service, to see what a real service returns, and it returned basically the same thing. To be safe, I copied it's response and tried sending it to the c# client and it still threw the error. Can anyone help? I've tried all i can think of, including adding the useUnsafeHeaderParsing to my app config. Nothing is working though. I send it exactly what a real service sends it and it yells at me. I send it what i want and it yells. I'm sending this: "200 OK HTTP/1.0\r\n" + "Content-Length: 201\r\n" + "Cache-Control: private\r\n" + "Content-Type: text/xml; charset=utf-8\r\n\r\n";

    Read the article

  • div "top" bug IE and everything else. Big problem

    - by Victor
    Hi everyone. I am new in CSS so please help me in this problem. I hope to describe it wright. I am making div named content where my site content is. I made it with z-index:-1; so an image to be over this div. But in Chrome, FF and safari, content became inactive. I cant select text , click on link and write in the forms. So I tried with positive states in the z-index but IE don't know what this means. Damn. So I decided to make conditional div. Here is the code: .content { background:#FFF; width:990px; position:relative; float:left; top:50px; } .content_IE { background:#FFF; width:990px; position:relative; float:left; top: 50px; z-index:-1; } and here is the HTML: <!--[if IE 7]> <div class="content_IE" style="height:750px;"> <![endif]--> <div class="content" style="height:550px;"> Everything is fine with the z-index but the problem is that if there is no top in .content class everything looks fine in IE but there is no space in the other browsers. If i put back the top:50px; there onother 50px like padding in the .content_IE class. I mean that the page looks like I've put top:50px; and padding-top=50px;. I've try everything like margin-top:-50px; padding-top:-50px; and stuff like this but I am still in the circle. It look fine only if there is no top option in .content class. Please help.

    Read the article

  • Methodology for a Rails app

    - by Aaron Vegh
    I'm undertaking a rather large conversion from a legacy database-driven Windows app to a Rails app. Because of the large number of forms and database tables involved, I want to make sure I've got the right methodology before getting too far. My chief concern is minimizing the amount of code I have to write. There are many models that interact together, and I want to make sure I'm using them correctly. Here's a simplified set of models: class Patient < ActiveRecord::Base has_many :PatientAddresses has_many :PatientFileStatuses end class PatientAddress < ActiveRecord::Base belongs_to :Patient end class PatientFileStatus < ActiveRecord::Base belongs_to :Patient end The controller determines if there's a Patient selected; everything else is based on that. In the view, I will be needing data from each of these models. But it seems like I have to write an instance variable in my controller for every attribute that I want to use. So I start writing code like this: @patient = Patient.find(session[:patient]) @patient_addresses = @patient.PatientAddresses @patient_file_statuses = @patient.PatientFileStatuses @enrollment_received_when = @patient_file_statuses[0].EnrollmentReceivedWhen @consent_received = @patient_file_statuses[0].ConsentReceived @consent_received_when = @patient_file_statuses[0].ConsentReceivedWhen The first three lines grab the Patient model and its relations. The next three lines are examples of my providing values to the view from one of those relations. The view has a combination of text fields and select fields to show the data above. For example: <%= select("patientfilestatus", "ConsentReceived", {"val1"="val1", "val2"="val2", "Written"="Written"}, :include_blank=true )% <%= calendar_date_select_tag "patient_file_statuses[EnrollmentReceivedWhen]", @enrollment_complete_when, :popup=:force % (BTW, the select tag isn't really working; I think I have to use collection_select?) My questions are: Do I have to manually declare the value of every instance variable in the controller, or can/should I do it within the view? What is the proper technique for displaying a select tag for data that's not the primary model? When I go to save changes to this form, will I have to manually pick out the attributes for each model and save them individually? Or is there a way to name the fields such that ActiveRecord does the right thing? Thanks in advance, Aaron.

    Read the article

  • Why is this simple Mobile Form not closed when using the player

    - by ajhvdb
    Hi, I created this simple sample Form with the close button. Everything is working as expected when NOT using the Interop.WMPLib.dll I've seen other applications using this without problems but why isn't the Form process closed when I just add the line: SoundPlayer myPlayer = new SoundPlayer(); and of course dispose it: if (myPlayer != null) { myPlayer.Dispose(); myPlayer = null; } The Form closes but the debugger VS2008 is still active. The Form project and the dll are still active. If you send me an email to [email protected], I can send you the zipped project. Below is the class for the dll: using System; using System.Collections.Generic; using System.Text; using System.Threading; using System.Runtime.InteropServices; using WMPLib; namespace WindowsMobile.Utilities { public delegate void SoundPlayerStateChanged(SoundPlayer sender, SoundPlayerState newState); public enum SoundPlayerState { Stopped, Playing, Paused, } public class SoundPlayer : IDisposable { [DllImport("coredll")] public extern static int waveOutSetVolume(int hwo, uint dwVolume); [DllImport("coredll")] public extern static int waveOutGetVolume(int hwo, out uint dwVolume); WindowsMediaPlayer myPlayer = new WindowsMediaPlayer(); public SoundPlayer() { myPlayer.uiMode = "invisible"; myPlayer.settings.volume = 100; } string mySoundLocation = string.Empty; public string SoundLocation { get { return mySoundLocation; } set { mySoundLocation = value; } } public void Pause() { myPlayer.controls.pause(); } public void PlayLooping() { Stop(); myPlayer.URL = mySoundLocation; myPlayer.settings.setMode("loop", true); } public int Volume { get { return myPlayer.settings.volume; } set { myPlayer.settings.volume = value; } } public void Play() { Stop(); myPlayer.URL = mySoundLocation; myPlayer.controls.play(); } public void Stop() { myPlayer.controls.stop(); myPlayer.close(); } #region IDisposable Members public void Dispose() { try { Stop(); } catch (Exception) { } // need this otherwise the process won't exit?! try { int ret = Marshal.FinalReleaseComObject(myPlayer); } catch (Exception) { } myPlayer = null; GC.Collect(); } #endregion } }

    Read the article

  • WPF data templates

    - by imekon
    I'm getting started with WPF and trying to get my head around connecting data to the UI. I've managed to connect to a class without any issues, but what I really want to do is connect to a property of the main window. Here's the XAML: <Window x:Class="test3.MainWindow" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" xmlns:custom="clr-namespace:test3" Title="MainWindow" Height="350" Width="525"> <Window.Resources> <CollectionViewSource Source="{Binding Source={x:Static Application.Current}, Path=Platforms}" x:Key="platforms"/> <DataTemplate DataType="{x:Type custom:Platform}"> <StackPanel> <CheckBox IsChecked="{Binding Path=Selected}"/> <TextBlock Text="{Binding Path=Name}"/> </StackPanel> </DataTemplate> </Window.Resources> <Grid> <ListBox ItemsSource="{Binding Source={StaticResource platforms}}"/> </Grid> Here's the code for the main window: public partial class MainWindow : Window { ObservableCollection<Platform> m_platforms; public MainWindow() { m_platforms = new ObservableCollection<Platform>(); m_platforms.Add(new Platform("PC")); InitializeComponent(); } public ObservableCollection<Platform> Platforms { get { return m_platforms; } set { m_platforms = value; } } } Here's the Platform class: public class Platform { private string m_name; private bool m_selected; public Platform(string name) { m_name = name; m_selected = false; } public string Name { get { return m_name; } set { m_name = value; } } public bool Selected { get { return m_selected; } set { m_selected = value; } } } This all compiles and runs fine but the list box displays with nothing in it. If I put a breakpoint on the get method of Platforms, it doesn't get called. I don't understand as Platforms is what the XAML should be connecting to!

    Read the article

  • why this sql code dont work

    - by magy
    <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <meta http-equiv="Content-Type" content="text/html; charset=windows-1256"> <title>??? ?????? ???? ????</title> </head> <body> <table width="100%" border="1"> <tr> <td>name</td> <td>number</td> <td>math</td> <td>arab</td> <td>history</td> <td>geo</td> </tr> <?php require_once "conf.php"; $sql2=("SELECT * FROM student WHERE snum = $ss"); $rs2 = mysql_query($sql2) or die(mysql_error()); $num = mysql_num_rows($rs2); $ss= $_POST["ss"]; if (empty($ss)) { echo "please write your search words";} else if ($num < 1 ) { echo "not found any like "; }else { $sql=("SELECT * FROM student WHERE snum = $ss "); $rs = mysql_query($sql) or die(mysql_error()); while($data=mysql_fetch_array($rs)){ $name=$data["sname"]; $number=$data["snum"]; $math=$data["math"]; $arab=$data["arab"]; $history=$data["history"]; $geo=$data["geo"]; echo" <tr> <td>$name</td> <td>$number</td> <td>$math</td> <td>$arab</td> <td>$history</td> <td>$geo</td> </tr> "; } }; ?> </table> </body> </html>

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • jQuery to hide and show divs with an indicator

    - by songdogtech
    Using the jQuery below to toggle the hiding and showing of divs of text: how would I add some sort of indicator - like an up and down arrow as a graphic - to the titles when the divs are either open and closed? What's the best way to do that? Two images? A CSS sprite? And most importantly: how would that be integrated into the JS? I've looked at other jQuery that assigns a random number to each div and then determines which are open and which are closed and toggles one of two images. But I'm using php in a WordPress loop to show a posts, and that gives problems with incrementing in the loop, so there must be an easier way that doesn't require changes in the name of the title div. Thanks.... This JS fires the showing and hiding. Each div can be expanded and collapsed independently. $(document).ready(function() { $('div.demo-show:eq(0)> div').hide(); $('div.demo-show:eq(0)> h3').click(function() { $(this).next().slideToggle('fast'); }); }); This is the HTML it works with: <div class="collapser"> <p class="title">Header-1 </p> <div class="contents">Lorem ipsum</div> <p class="title">Header-2</p> <div class="contents">Lorem ipsum </div> <p class="title">Header-3</p> <div class="contents">Lorem ipsum</div> </div> The CSS is arbitrary: .collapser { margin: 0; padding: 0; width: 500px; } .title { margin: 1px; color: #fff; padding: 3px 10px; cursor: pointer; position: relative; background-color:#c30; } .contents { padding: 5px 10px; background-color:#fafafa; }

    Read the article

  • jQuery AJAX POST gives undefined index

    - by Sebastian
    My eventinfo.php is giving the following output: <br /> <b>Notice</b>: Undefined index: club in <b>/homepages/19/d361310357/htdocs/guestvibe/wp-content/themes/yasmin/guestvibe/eventinfo.php</b> on line <b>11</b><br /> [] HTML (index.php): <select name="club" class="dropdown" id="club"> <?php getClubs(); ?> </select> jQuery (index.php): <script type="text/javascript"> $(document).ready(function() { $.ajax({ type: "POST", url: "http://www.guestvibe.com/wp-content/themes/yasmin/guestvibe/eventinfo.php", data: $('#club').serialize(), success: function(data) { $('#rightbox_inside').html('<h2>' + $('#club').val() + '<span style="font-size: 14px"> (' + data[0].day + ')</h2><hr><p><b>Entry:</b> ' + data[0].entry + '</p><p><b>Queue jump:</b> ' + data[0].queuejump + '</p><br><p><i>Guestlist closes at ' + data[0].closing + '</i></p>'); }, dataType: "json" }); }); $('#club').change(function(event) { $.ajax({ type: "POST", url: "http://www.guestvibe.com/wp-content/themes/yasmin/guestvibe/eventinfo.php", data: $(this).serialize(), success: function(data) { $('#rightbox_inside').hide().html('<h2>' + $('#club').val() + '<span style="font-size: 14px"> (' + data[0].day + ')</h2><hr><p><b>Entry:</b> ' + data[0].entry + '</p><p><b>Queue jump:</b> ' + data[0].queuejump + '</p><br><p><i>Guestlist closes at ' + data[0].closing + '</i></p>').fadeIn('500'); }, dataType: "json" }); }); </script> I can run alerts from the jQuery, so it is active. I've copied this as is from an old version of the website, but I've changed the file structure (through to move to WordPress) so I suspect the variables might not even be reaching eventinfo.php in the first place... index.php is in wp-content/themes/cambridge and eventinfo.php is in wp-content/themes/yasmin/guestvibe but I've tried to avoid structuring issues by referencing the URL in full. Any ideas?

    Read the article

  • JSon/Jquery request with a setTimeout always returns a "null" result? (for Twitter Search API)

    - by supermogx
    I make a call to the twitter API. 100 posts are retreived + a properties that tells me what the next page to call is. So I wait 5 sec. and call that next page, but the JSon results in the callback function is always null the second time... I think it's probably a JQuery problem... Here's a complete sample HTML code : <html> <head> <script type="text/javascript" src="./jquery-1.4.2.min.js"></script> <script> function test() { var rqUrl = "http://search.twitter.com/search.json?q=%23apple+OR+%23ipad&rpp=100&callback=?" callTwitterSearchApi(rqUrl); } function callTwitterSearchApi(tiwtterRequestUrl) { debug("request to twitter : " + tiwtterRequestUrl); // *** FIRST CALL WORKS GREAT... *** $.getJSON(tiwtterRequestUrl, callTwitterSearchApi_callback); } function callTwitterSearchApi_callback(jsonPostsResults) { debug("callback"); if (jsonPostsResults == null) { debug("Why is jsonPostsResults null? If I copy paste the request inside a browser, I get something =("); return; } if (jsonPostsResults.error != undefined && jsonPostsResults.error != "") { debug("twitter api error"); } var posts = new Array(); $(jsonPostsResults.results).each(function() { posts.push(this); }); debug("Number of posts : " + posts.length); if (jsonPostsResults.next_page != undefined && jsonPostsResults.next_page.trim() != "") { debug("calling next request in 5 sec..."); // *** WHEN COMMING BACK FROM THAT LINE, JSON RESULTS == NULL?! **** setTimeout("callTwitterSearchApi(\"http://search.twitter.com/search.json" + jsonPostsResults.next_page + "\")", 5000); } } function debug(message) { document.getElementById('debug').innerHTML = message + "\n" + document.getElementById('debug').innerHTML; } </script> </head> <body> <input type="button" onclick="test();" value="test" /><br /> <textarea id="debug" cols="80" rows="20"></textarea> </body> </html> at line 18, at the second callback (back from the setTimeout), the parameter "jsonPostsResults" is always returned as null... I have no idea why. If I copy paste that 2nd request in a browser, it returns 100 results. Anybody had a problem like that with the Ajax JQuery functions when calling it with a setTimeout?

    Read the article

  • disable dates using jquery inside gridview control

    - by bladerunner
    Hi there, I have a gridview which contains a textbox control. I need to show the calendar for the user to pick the date and certain dates are to be disabled using jquery. I found a post on stackoverflow that talked about how to disable certain dates. I am done with that part, except not sure how to pass the textbox control to this jquery function. Here is the code. <script type="text/javascript" language="javascript"> function pageLoad(sender, args) { var enabledDays = ['09/21/2011', '10/05/2011', '10/19/2011', '11/02/2011', '11/16/2011']; /* utility functions */ function editDays(date) { for (var i = 0; i < enabledDays.length; i++) { if (new Date(enabledDays[i]).toString() == date.toString()) { return [true]; } } return [false]; } /* create datepicker */ $(document).ready(function() { $('#<%= txtInHomeDate.ClientID %>').datepicker({ beforeShow: springDate, beforeShowDay: editDays, dateFormat: 'mm/dd/yy', buttonImage: 'images/cal.gif', buttonText: 'Choose date', firstDay: 1, buttonImageOnly: true, showOn: 'both', showAnim: 'fadeIn', onSelect: function() { $(this).trigger("onchange", null); } }); function springDate() { var defaultMin = new Date(); var defaultMax = new Date(); var Min = defaultMin; var Max = defaultMax; // make valid date from hiddenfied value format is MM/dd/yyyy dateMin = $('#<%= hfStDate.ClientID %>').val(); dateMin = new Date(dateMin); dateMax = $('#<%= hfEndDate.ClientID %>').val(); dateMax = new Date(dateMax); if (dateMin && dateMax) { Min = new Date(dateMin.getFullYear(), dateMin.getMonth(), dateMin.getDate()); Max = new Date(dateMax.getFullYear(), dateMax.getMonth(), dateMax.getDate()); } return { minDate: Min, maxDate: Max }; } }); } <.... <asp:TemplateField HeaderText="In-Home Date"> <ItemStyle HorizontalAlign="Center" /> <ItemTemplate> <asp:HiddenField ID="hfStDate" runat="server" Value="09/01/2011" /> <asp:HiddenField ID="hfEndDate" runat="server" Value="11/30/2011" /> <asp:TextBox ID="txtInHomeDate" runat="server" /> </ItemTemplate> </asp:TemplateField> Currently, it errors out since the jquery function won't find the txtInHomeDate. Could I get some help as I am pretty close to get this done? Thanks!!

    Read the article

  • Where can I find sample XHTML5 source codes?

    - by Bytecode Ninja
    Where can I find sample *X*HTML 5 pages? I mainly want to know if it is possible to mix and match XHTML 5 with other XML languages just like XHTML 1 or not. For example is something like this valid in XHTML 5? <!DOCTYPE html PUBLIC "WHAT SHOULD BE HERE?" "WHAT SHOULD BE HERE?"> <html xmlns="WHAT SHOULD BE HERE?" xmlns:ui="http://java.sun.com/jsf/facelets"> <head> <title><ui:insert name="title">Default title</ui:insert></title> <link rel="stylesheet" type="text/css" href="./css/main.css"/> </head> <body> <div id="header"> <ui:insert name="header"> <ui:include src="header.xhtml"/> </ui:insert> </div> <div id="left"> <ui:insert name="navigation" > <ui:include src="navigation.xhtml"/> </ui:insert> </div> <div id="center"> <br /> <span class="titleText"> <ui:insert name="title" /> </span> <hr /> <ui:insert name="content"> <div> <ui:include src="content.xhtml"/> </div> </ui:insert> </div> <div id="right"> <ui:insert name="news"> <ui:include src="news.xhtml"/> </ui:insert> </div> <div id="footer"> <ui:insert name="footer"> <ui:include src="footer.xhtml"/> </ui:insert> </div> </body> </html> Thanks in advance.

    Read the article

  • Rails populate edit form for non-column attributes

    - by Rabbott
    I have the following form: <% form_for(@account, :url => admin_accounts_path) do |f| %> <%= f.error_messages %> <%= render :partial => 'form', :locals => {:f => f} %> <h2>Account Details</h2> <% f.fields_for :customer do |customer_fields| %> <p> <%= customer_fields.label :company %><br /> <%= customer_fields.text_field :company %> </p> <p> <%= customer_fields.label :first_name %><br /> <%= customer_fields.text_field :first_name %> </p> <p> <%= customer_fields.label :last_name %><br /> <%= customer_fields.text_field :last_name %> </p> <p> <%= customer_fields.label :phone %><br /> <%= customer_fields.text_field :phone %> </p> <% end %> <p> <%= f.submit 'Create' %> </p> <% end %> As well as attr_accessor :customer And I have a before_create method for the account model which does not store the customer_fields, but instead uses them to submit data to an API.. The only thing I store are in the form partial.. The problem I'm running into is that when a validation error gets thrown, the page renders the new action (expected) but none of the non-column attributes within the Account Detail form will show? Any ideas as to how I can change this code around a bit to make this work me?? This same solution may be the help I need for the edit form, I have a getter for the data which it asks the API for, but without place a :value = "asdf" within each text box, it doesn't populate the fields either..

    Read the article

  • jQuery mobile ajax login form authentication

    - by Jakub Zak
    I know i already asked simillar question, but now when I work with jQuery Mobile I can't figure it out. So I have this form: <div data-role="page" data-theme="a" id="login_page"> <div data-role="header" data-position="fixed"> <h1>****</h1> </div> <div data-role="content"> <form id="login_form" method="POST" data-ajax="false"> <label for="basic">Username:</label> <input type="text" name="name" id="username" value=""/> <label for="basic">Password:</label> <input type="password" name="password" id="password" value=""/> <input type="submit" value="Login" id="login" name="login"/> </form> </div> <div data-role="footer" data-position="fixed"> <div data-role="navbar"></div> </div> </div> And I need to submit Username and Password to php script, where php replies and send "success" or "failed". Here is php: <?php session_start(); $username = $_POST["name"]; $password = $_POST["password"]; include('mysql_connection.php'); mysql_select_db("jzperson_imesUsers", $con); $res1 = mysql_query("SELECT * FROM temp_login WHERE username='$username' AND password='$password'"); $count=mysql_num_rows($res1); if($count==1){ echo "success"; }else{ echo "failed"; } ?> And to do all this I want to use this script: $(document).ready(function() { $("form").submit(function(){ $.mobile.showPageLoadingMsg(); $.ajax({ url: "http://imes.jzpersonal.com/login_control.php", type: "POST", dataType: "jsonp", jsonp: "jsoncallback", data: $("form#login_form").serialize(), success: function( response ){ $.mobile.changePage( "http://imes.jzpersonal.com/user_panel.html"); } }); return false; }); }); But I can't make it work, I know I must have mistakes in there, I just can't find them, or better way to do it. Thank you in advance for any help.

    Read the article

  • RadioButton checkedchanged event firing multiple times

    - by kash3
    Hi, I am trying to add multiple radiobutton columns to my gridview dynamically in the code and i want to implement some logic which involves database fetch in the checkedchanged event of radiobuttons but some how the checked changed event is being fired multiple times for each row. Following is the code: aspx: <asp:GridView ID="GridView1" runat="server" AutoGenerateColumns="False" BackColor="White" BorderColor="#CC9966" BorderStyle="None" EnableViewState="true" BorderWidth="1px" CellPadding="4" Font-Names="Verdana"> <FooterStyle BackColor="#FFFFCC" ForeColor="#330099" /> <Columns> <asp:TemplateField HeaderText="Select One"> <ItemTemplate> </ItemTemplate> </asp:TemplateField> <asp:TemplateField HeaderText="Select Two"> <ItemTemplate> </ItemTemplate> </asp:TemplateField> <asp:TemplateField> <ItemTemplate> <asp:Label ID="lblval" runat="server" Text="!" ForeColor="Red" Visible="false"/> </ItemTemplate> </asp:TemplateField> </Columns> **code behind** void GridView1_RowDataBound(object sender, GridViewRowEventArgs e) { if (e.Row.DataItem != null) { DataRowView dvRowview = (DataRowView)e.Row.DataItem; int currentRow = GridView1.Rows.Count; RadioButton rdoSelect1 = new RadioButton(); rdoSelect1.GroupName = "Select" + currentRow; rdoSelect1.ID = string.Concat("rdoSelect1", currentRow); rdoSelect1.AutoPostBack = true; rdoSelect1.CheckedChanged += new EventHandler(rdoSelect_CheckedChanged); e.Row.Cells[0].Controls.Add(rdoSelect1); RadioButton rdoSelect2 = new RadioButton(); rdoSelect2.GroupName = "Select" + currentRow; rdoSelect2.ID = string.Concat("rdoSelect2", currentRow); rdoSelect2.AutoPostBack = true; rdoSelect2.CheckedChanged += new EventHandler(rdoSelect_CheckedChanged); e.Row.Cells[1].Controls.Add(rdoSelect2); if (!IsPostBack) { e.Row.Cells[e.Row.Cells.Count - 1].Controls[1].Visible = false; if (e.Row.Cells[0] != null && Convert.ToBoolean(dvRowview["Select1"]) == true) rdoSelect1.Checked = true; else rdoSelect1.Checked = false; if (e.Row.Cells[0] != null && Convert.ToBoolean(dvRowview["Select2"]) == true) rdoSelect2.Checked = true; else rdoSelect2.Checked = false; } } } void rdoSelect_CheckedChanged(object sender, EventArgs e) { RadioButton rdoSelectedOption = (RadioButton)sender; GridViewRow selRow = rdoSelectedOption.NamingContainer as GridViewRow; if (rdoSelectedOption.Checked) selRow.Cells[selRow.Cells.Count - 1].Controls[1].Visible = true; else selRow.Cells[selRow.Cells.Count - 1].Controls[1].Visible = false; } i want the checkedchanged event to fire only once for a group name and row.

    Read the article

  • Getting key/value pairs from plist-style xml using simplexml in php

    - by Anthony
    Here is an example bit from the xml file: <array> <dict> <key>Name</key> <string>Joe Smith</string> <key>Type</key> <string>Profile</string> <key>Role</key> <string>User</string> <key>Some Number</key> <integer>1</integer> <key>Some Boolean</key> <true/> </dict> </array> I have two separate goals. The first is to extract an array from the dictnode that would look like: [Name] => Joe Smith [Type] => Profile [Role] => User [Some Number] => 1 [Some Boolean] => true It's not crucial that the boolean be included, so if that adds too much complexity, I'd rather just know how to deal with the others for now. The second goal is to be able to select the value node (<string>, <integer>,etc) so that I can change the value. I would need to select it based on the text value of the preceding key element. I think the following XPath should work: //key[.=$keyname]/following-sibling[1] But I'm not sure. Basically, this whole system that Apple uses seems logical, but totally contrary to the XML is supposed to work. If I ran the world, the original XML would look more like: <dict type="array"> <value key="Name" type="string">Joe Smith</value> <value key="Type" type="string">Profile</value> <value key="Role type="string">User</value> <value key="Some Number" type="integer">1</value> <value key="Some Boolean" type="boolean">true</value> </dict> But since it is fairly logical, I am wondering if I'm missing some obvious way of handling it.

    Read the article

  • Sliding panel in the middle of the page. Z-index given not working

    - by Nehal Rupani
    Hi all, I am implementing sliding panel element but problem is when i slide out other div element is floating down. I guess and tried to give z-index to element which i am sliding but it doesn't seems to work. Let me put code for both div. <div class="vrcontrol"> <div class="slide-out-div"> <a class="handle" href="http://link-for-non-js-users.html">Content</a> <h3>Contact me</h3> <p>Thanks for checking out my jQuery plugin, I hope you find this useful. </p> <p>This can be a form to submit feedback, or contact info</p> </div> This is div which i am sliding in and out and beneath is code of effective div. <div class="askform"> <p class="titletext">Ask an Expert Trade Forum</p> <p class="detailtext">WD-40’s leading source for DIY tips and tricks.</p> <span> <form id="askform" name="askform" action="" method="post"> <span class="left"><input name="input" type="text" class="askinputbox"/></span><span class="marginleft"><input type="image" src="images/search_icon.gif" /></span> </form> </span> <div class="followus"> <span class="followtext">Follow us on</span><span class="right"><img src="images/bookmark.jpg" width="121" height="45" alt="Bookmark" /></span> </div> </div> Sliding div is in left portion of the page and effective div is in right portion of the page. I guess something with z-index, positioning element and overflow properties will do something.

    Read the article

  • How do you remind your Scrum Product Owner about his promises/actions?

    - by Felix Ogg
    ** EDIT: Rephrased the question to re-focus ** Our Scrum team meets as seldomly as possible, but we meet with the product owner every chance we get. We track everyone's agreed action points (particularly theirs). We are 100% agile, but our product owner lives in traditional world, we remain off-site. We facilitate him in crossing over to our fast-paced world. There's not much wrong. The team and the PO are in good spirits. PO is present at every meeting and positively energized. Just imagine this person as a 70 year old, slow grandpa, who is forgetful, yet kind. In reality he isn't, but he is used to a working environment (public servants) that is much slooooower. Manyana-manyana etc. It is frustrating for my team to cooperate: PO lives in a non-prioritized environment, and everyone in it has learned the productivity-technique of NGTD (Not Getting Things Done). He WANTS to, it's just that he forgets or 'sinks' somewhere along the away. We have experimented with a text file, maintained by the Scrum master (low-tech), which he broadcasts by e-mail every day JIRA, our issue tracker. Turns out this is nice for programmers, but too steep for 'regular people' I Googled for Issue tracking webtools but came up empty handed: All tools are aimed at IT issue tracking, instead of meeting action point tracking/planning for mere mortals. I did find TODO-lists like RememberTheMilk, but they don't track comments, and - to be honest - I doubt we could get our product owner to use it (too complicated). We have three requirements: Register action points, assign to a team member and a deadline Offer anyone to 'comment' on progress of any action point Do not build our own tool from scratch We do not need: - impressive authorization models, - multi-project, - workflow, - crosslinking. Is there any trick/tool you use to assist your product owner 'fly' like the rest of the rest of the team? Communication before tools I agree with the general consensus that one should not try to apply technology to a communication problem, however in this case I am merely looking for a tool to save me time in setting up prioritized lists. I found www.thymer.com today, may be what I am looking for. The guys are cool. It is getting rather feature-bloated though.

    Read the article

  • sed - trying to replace first occurrence after a match

    - by wakkaluba
    I am facing a situation that drives me nuts. I am setting up an update server which uses a json file. Don't ask why or how, it sucks and is my only possibility to achieve it. I have been trying and researching for HOURS (many) because I went ballistic and wanted to crack this on my own. But I have to realize I got stuck and need help. So sorry for this chunk but I think it is somewhat important to see... The file is a one liner and repeating the following sequence with changing values (of course). "plugin_name_foo_bar": {"buildDate": "bla", "dependencies": [{"name": "bla", "optional": true, "version": "1.00"}], "developers": [{"developerId": "bla", "email": "[email protected]", "name": "Bla bla2nd"}], "excerpt": "some text {excerpt} !bla.png|thumbnail,border=1! ", "gav": "bla", "labels": ["report", "scm-related"], "name": "plugin_name_foo_bar", "previousTimestamp": "bla", "previousVersion": "1.0", "releaseTimestamp": "bla", "requiredCore": "1", "scm": "github.com", "sha1": "ynnBM2jWo25ZLDdP3ybBOnV/Pio=", "title": "bla", "url": "http://bla.org", "version": "1.0", "wiki": "https://bla.org"}, "Exclusion": {"buildDate": "bla", "dependencies": [], and the next plugin block is glued straight afterwards. What I now want to do is to search for "plugin_foo_bar": {" as this is the unique identifier for a new plugin description block. I want to replace the first sha1 value occuring afterwards. That's where I keep failing. I always grab the first,last or any occurrence in the entire file and not the block :( "title" is the unique identifier after the sha1 value. So I tried to make the .* less greedy but it ain't working out. last attempt was heading towards: sed -i 's/("name": "plugin_name_foo_bar.*sha1": ")([a-zA-Z0-9!@#\$%^&*()\[\]]*)(", "title"\)/\1blablabla\2/1' default.json to find the sha1 value of that plugin but still no joy. I hope someone knows - preferably a simpler approach - before I now continue with trial and error until I have to puke and freakout. I am working with SED on Windows, so Unix approach might help me to figure out how to achieve this in batch but please make it as one-liner if possible. Scripts are a real pain to convert. And I just need SED and no other solution with other tools like AWK. That is absolutely out of discussion. Any help is appreciated :) Cheers Jan

    Read the article

  • on click button disabled click ent is working? using jquery

    - by kumar
    <div> <input id="PbtnSelectAll" type="button" class="button" value="Select All" /> <input id="PbtnSubmit" type="submit" class="button" value="Save" /> <input id="PbtnCancel" type="button" class="button" value="Cancel" /> </div> </fieldset> <% } %> <script type="text/javascript"> $(document).ready(function() { $('#PbtnSubmit').attr('disabled', 'disabled'); $('#PbtnCancel').attr('disabled', 'disabled'); $('#PbtnSelectAll').click(function() { $('#PricingEditExceptions input[type=checkbox]').attr('checked', 'checked'); $('#PbtnSubmit').attr('disabled', false); $('#PbtnCancel').attr('disabled', false); $('fieldset').find("input:not(:checkbox),select,textarea").attr('disabled', 'disabled'); $('#genericfieldset').find("input,select,textarea").removeAttr('disabled'); }); $('#PbtnCancel').click(function() { $('#PricingEditExceptions input[name=PMchk]').attr('checked', false); $('#PbtnSubmit').attr('disabled', 'disabled'); $('#PbtnCancel').attr('disabled', 'disabled'); $('#exc-flwup').val(''); $('#Inquiry').val(''); $('#comments').val(''); $('#ResolutionCode option:eq(0)').attr('selected', 'selected'); $('#ReasonCode option:eq(0)').attr('selected', 'selected'); $('#ActionCode option:eq(0)').attr('selected', 'selected'); $('fieldset').find("input,select,textarea").removeAttr('disabled'); }); $('#PbtnSubmit').click(function(event) { $('#PricingEditExceptions input[name=PMchk]').each(function() { if ($("#PricingEditExceptions input:checkbox:checked").length > 0) { var checked = $('#PricingEditExceptions input[type=checkbox]:checked'); var PMstrIDs = checked.map(function() { return $(this).val(); }).get().join(','); $('#1_exceptiontypes').attr('value', exceptiontypes) $('#1_PMstrIDs').attr('value', PMstrIDs); } else { alert("Please select atleast one exception"); event.preventDefault(); } }); }); function validate_excpt(formData, jqForm, options) { var form = jqForm[0]; } // post-submit callback function showResponse(responseText, statusText, xhr, $form) { if (responseText[0].substring(0, 16) != "System.Exception") { $('#error-msg-ID span:last').html('<strong>Update successful.</strong>'); } else { $('#error-msg-ID span:last').html('<strong>Update failed.</strong> ' + responseText[0].substring(0, 48)); } $('#error-msg-ID').removeClass('hide'); } $('#exc-').ajaxForm({ target: '#error-msg-ID', beforeSubmit: validate_excpt, success: showResponse, dataType: 'json' }); $('.button').button(); }); </script> this on begin form submit if I click Disabled Save and Cancel buttong still working after disabling also? i can see button is disbled but its working on click? when I click cancel its and not enabling back? still the button shows disbaled/ thanks

    Read the article

  • devise register confirmation

    - by mattherick
    hello! i have a user and an admin role in my project. i created my authentification with devise, really nice and goot tool for handling the authentification. in my admin role i don´t have any confirmation or something like that. it is really simple and doesn´t make problems. but in my user model i have following things: model: devise :database_authenticatable, :confirmable, :recoverable, :rememberable, :trackable, :validatable, :timeoutable, :registerable # Setup accessible (or protected) attributes for your model attr_accessible :email, :username, :prename, :surname, :phone, :street, :number, :location, :password, :password_confirmation and few validations, but they aren´t relevant this time. my migration looks like following one: class DeviseCreateUsers < ActiveRecord::Migration def self.up create_table(:users) do |t| t.database_authenticatable :null = false t.confirmable t.recoverable t.rememberable t.trackable t.timeoutable t.validateable t.string :username t.string :prename t.string :surname t.string :phone t.string :street t.integer :number t.string :location t.timestamps end add_index :users, :email, :unique => true add_index :users, :confirmation_token, :unique => true add_index :users, :reset_password_token, :unique => true add_index :users, :username, :unique => true add_index :users, :prename, :unique => false add_index :users, :surname, :unique => false add_index :users, :phone, :unique => false add_index :users, :street, :unique => false add_index :users, :number, :unique => false add_index :users, :location, :unique => false end def self.down drop_table :users end end into my route.rb I added following statements: map.devise_for :admins map.devise_for :users, :path_names = { :sign_up = "register", :sign_in = "login" } map.root :controller = "main" and now my problem.. if I register a new user, I fill in all my data in the register form and submit it. After that I get redirected to the controller main with the flash-notice "You have signed up successfully." And I am logged in. But I don´t want to be logged in, because I don´t have confirmed my new user account yet. If I open the console I see the last things in the logs and there I see the confirmation-mail and the text and all stuff, but I am already logged in... I can´t explain why, ... does somebody of you have an idea? If I copy out the confirmation-token from the logs and confirm my account, I can log in, but if I don´t confirm, I also can log in..

    Read the article

< Previous Page | 1363 1364 1365 1366 1367 1368 1369 1370 1371 1372 1373 1374  | Next Page >