Search Results

Search found 59543 results on 2382 pages for 'solution files'.

Page 137/2382 | < Previous Page | 133 134 135 136 137 138 139 140 141 142 143 144  | Next Page >

• Cannot chown my own files from NFS

  - by valpa

  We have a NFS server provide home directory for many account, which provided by a NIS server. I have account A and B. In /home/A, I try to copy "cp -a /home/B/somedir ~/". Then I found in /home/A/somedir, all files are owned by user A. Then if I do "chown -R B:B somedir", I got "Operation not permitted" error. I am user A, "cp -a" didn't preserve the original user (B). Then I cannot chown my own files. Any suggestion? I fix my own issue by "chmod 777 /home/A", "su - B" and "cp -a somedir /home/A/", and "su - A", then "chmod 755 /home/A". But it is not a good solution.

  Read the article

• $_POST goes empty after adding a new input type "file"

  - by heldrida

  Hi, I'm not finding a way to understand and fix this and I've done a lot. I've got a script, wish is a simple form, that sends a file trough POST. The second file, process the info. By default, I give to the user a few fields, one of them being a input field of type "file" and there's also, a few "hidden" one's, that gives me values to work with on POST. I found that, when adding a new input of type "file", the $_POST returns array 0, even $_FILES returns nothing. I have no idea how to fix this, and it works just fine when keeping the default input box of type "file". This is the form http://pastie.org/872488 This only happens when: Exists! var_dump( $_POST ), or $_FILES, print_r(), etc Returns nothing. I've tryed to create a array on the input of type "files", like img_p_child[], but nothing. How to solve this ? Thanks for taking your time!

  Read the article

• Windows 7 Locking Executable Files

  - by James Burgess

  Since I've been using Windows 7 RTM (as opposed to the Beta and RCs), I've been having a peculiar issue with executable files. I first noticed it whilst using Visual Studio, in that when building a project, it would often fail saying that the output file was locked - but the problem has stemmed further. When I've executed an application, closed it (cleanly), and attempted to delete/move/rename/overwrite said file, Windows 7 tells me that the file is locked/access is denied. I've made use of software like LockHunter/Unlocker but it is seemingly unable to remove these locks (most of the time, it shows no locks at all). After about 5-10 minutes, the respective files are unlocked again, but needless to say this is a bit of a workflow-breaker (as it's not simply constrained to VS). I've done the usual tasks of virus/malware scanning, and turned up with absolutely nothing. I've got no peculiar services running, and the problem was not present before I installed a Windows 7 RTM version. Any help is greatly appreciated.

  Read the article

• Encrypt shared files on AD Domain.

  - by Walter

  Can I encrypt shared files on windows server and allow only authenticated domain users have access to these files? The scenario as follows: I have a software development company, and I would like to protect my source code from being copied by my programmers. One problem is that some programmers use their own laptops to developing the company's software. In this scenario it's impossible to prevent developers from copying the source code for their laptops. In this case I thought about the following solution, but i don't know if it's possible to implement. The idea is to encrypt the source code and they are accessible (decrypted) only when developers are logged into the AD domain, ie if they are not logged into the AD domain, the source code would be encrypted be useless. Can be implemented this ? What technology should be used?

  Read the article

• Encrypt shared files on AD Domain.

  - by Walter

  Can I encrypt shared files on windows server and allow only authenticated domain users have access to these files? The scenario as follows: I have a software development company, and I would like to protect my source code from being copied by my programmers. One problem is that some programmers use their own laptops to developing the company's software. In this scenario it's impossible to prevent developers from copying the source code for their laptops. In this case I thought about the following solution, but i don't know if it's possible to implement. The idea is to encrypt the source code and they are accessible (decrypted) only when developers are logged into the AD domain, ie if they are not logged into the AD domain, the source code would be encrypted be useless. How can be implemented this using EFS?

  Read the article

• puppet agent doesn't retrieve files from master

  - by nicmon

  I have a very basic question regarding to Puppet 3.0.1 configuration. I setup a puppet master server (CentOS) with 2 agents (CentOS and Windows 7), all 3 can ping and access each other. There is no error at all. I have copied a file under /etc/puppet/files/test2.txt my site.pp (/etc/puppet/manifests) contains these lines: node default { include test file { "/tmp/testmaster.txt": owner => root, group => root, mode => 644, source => "puppet:///files/test2.txt" } } but there will no file be created on agent servers under /tmp/ once I run "puppet agent --test" here is the output: [root@agent1 ~]# puppet agent --test Info: Retrieving plugin Info: Caching catalog for agent1.mydomain.com Info: Applying configuration version '1354267916' Finished catalog run in 0.02 seconds "puppet apply /etc/puppet/manifests/site.pp" creates the testmaster.txt under /tmp/ on master.

  Read the article

• Bash or python for changing spacing in files

  - by Werner

  Hi, I have a set of 10000 files. In all of them, the second line, looks like: AAA 3.429 3.84 so there is just one space (requirement) between AAA and the two other columns. The rest of lines on each file are completely different and correspond to 10 columns of numbers. Randomly, in around 20% of the files, and due to some errors, one gets BBB 3.429 3.84 so now there are two spaces between the first and second column. This is a big error so I need to fix it, changing from 2 to 1 space in the files where the error takes place. The first approach I thought of was to write a bash script that for each file reads the 3 values of the second line and then prints them with just one space, doing it for all the files. I wonder what do oyu think about this approach and if you could suggest something better, bashm python or someother approach. Thanks

  Read the article

• Looping through a directory on the web and displaying its contents (files and other directories) via

  - by al jaffe

  In the same vein as http://stackoverflow.com/questions/2593399/process-a-set-of-files-from-a-source-directory-to-a-destination-directory-in-pyth I'm wondering if it is possible to create a function that when given a web directory it will list out the files in said directory. Something like... files[] for file in urllib.listdir(dir): if file.isdir: # handle this as directory else: # handle as file I assume I would need to use the urllib library, but there doesn't seem to be an easy way of doing this, that I've seen at least.

  Read the article

• EF 4.x generated entity classes (POCO) and Map files

  - by JBeckton

  I have an MVC 4 app that I am working on and using the code first implementation except I cheated a bit and created my database first then generated my entity classes (poco) from my database using the EF power tools (reverse engineer). I guess you can say I did database first method but I have no edmx file just the context class and my entity classes (poco) I have a few projects in the works using MVC and EF with pocos but just the one project I used the tool to generate my pocos from the database. My question is about the mapping files that get created when I generate my pocos using the tool. What is the purpose of these Map files? I figured the map files are needed when generating the db from the model like with the true code first method, in my case where I am using a tool to generate my model from the database do the map files have any influence on how my app uses the entity classes?

  Read the article

• Replace files with symlink

  - by soandos

  This question is intended to be the inverse of Replace Symbolic Links with Files, but for windows. I have started running out of space on my SSD drive, and I found that about 12% of used space is in my installer folder (holds the .msi files for all the programs that I have installed) I am looking for two things: A way to move this (or any) folder via symlink. Ideally, some powershell function that I could use to just designate a folder, a destination, and the symlink would be created in the original (pointing to the destination) In this particular case, a registry change that would allow the location to be move would also be helpful, but I would still prefer solution 1. How can this be done?

  Read the article

• Haskell lazy I/O and closing files

  - by Jesse

  I've written a small Haskell program to print the MD5 checksums of all files in the current directory (searched recursively). Basically a Haskell version of md5deep. All is fine and dandy except if the current directory has a very large number of files, in which case I get an error like: <program>: <currentFile>: openBinaryFile: resource exhausted (Too many open files) It seems Haskell's laziness is causing it not to close files, even after its corresponding line of output has been completed. The relevant code is below. The function of interest is getList. import qualified Data.ByteString.Lazy as BS main :: IO () main = putStr . unlines =<< getList "." getList :: FilePath -> IO [String] getList p = let getFileLine path = liftM (\c -> (hex $ hash $ BS.unpack c) ++ " " ++ path) (BS.readFile path) in mapM getFileLine =<< getRecursiveContents p hex :: [Word8] -> String hex = concatMap (\x -> printf "%0.2x" (toInteger x)) getRecursiveContents :: FilePath -> IO [FilePath] -- ^ Just gets the paths to all the files in the given directory. Are there any ideas on how I could solve this problem? The entire program is available here: http://haskell.pastebin.com/PAZm0Dcb

  Read the article

• Seemingly random 404's for static files in Pyramid project

  - by seth

  I'm running a Pyramid project with mod_wsgi. Some of the files in my static directory (images, stylesheets, javascript) load fine, but others are coming up as not found. The files that are not working are all web fonts (otf, svg, woff and eot). I tried adding a text file into the static directory where the fonts are to see if I could access it, but it also came back with 404. The same text file also can't be accessed when put in the images folder. From what I'm looking at, it doesn't seem to be a permissions issue. Any ideas?

  Read the article

• get a set of files that have been modified after a certain date

  - by jcollum

  Does anyone have a handy powershell script that gets a set of files from TFS based on a modification date? I'd like to say "give me all the files in this folder (or subfolder) that were modified after X/Y/ZZZZ" and dump those files to a folder other than the folder they would normally go to. I know enough powershell to hack about and get this done, eventually, but I'm hoping to avoid that.

  Read the article

• tool for advanced ID3 tags handling and audio files ordering

  - by Juhele

  I have following problem – some of my files do not have complete ID3 tags and some have typos or small differences in writing - so finally, my portable player sees “Mr. President” as different artist from “Mr President” and so on. I would need some tool which could search similar tags and then allow me to correct the typos or for example override “artist” in all selected files by manually entered text. The same with empty tag items – sometimes, the track name, album etc. is OK, but artist is missing etc. Without touching the audio quality, of course (but this should be no problem, I think). I already tried tools in Winamp, Songbird and other players and currently most advanced free tool I tried is Tagscanner. However, it is not able to to solve the problem with similar tags. Do you know such tool? Preferably free and for Windows, if possible. However, if you know some commercial app able to do this, please let me know.

  Read the article

• Combine and compress script files in asp.net mvc

  - by victor_foster

  I am working in Visual Studio 2008, IIS7 and using asp.net MVC. I would like to know the best way to combine all of my Javascript files into one file to reduce the number of HTTP requests to the server. I have seen many articles on this subject but I'm not sure which one I should look at first (many of them are over a year old). Here are the things I would like to do: Combine my Javascript and css files Safely compress my Javascript files when I publish, but keep them uncompressed while I am debugging Cache my Css and Javascript files but allow them to refreshed with a hard refresh when they are updated without having to rename them.

  Read the article

• CakePHP: Interaction between different files/classes

  - by Alexx Hardt

  Hey, I'm cloning a commercial student management system. Students use the frontend to apply for lectures, uni staff can modify events (time, room, etc). The core of the app will be the algortihm which distributes the seats to students. I already asked about it here: How to implement a seat distribution algorithm for uni lectures Now, I found a class for that algorithm here: http://www.phpclasses.org/browse/file/10779.html I put the 'class GA' into app/vendors. I need to write a 'class Solution', which represents one object (a child, and later a parent for the evolutionary process). I'll also have to write functions mutate(), crossover() and fitness(). fitness calculates a score of a solution, based on if there are overbooked courses etc; crossover() is the crazy monkey sex function which produces a child from two parents, and mutate() modifies a child after crossover. Now, the fitness()-function needs to access a few related models, and their find()-functions. It evaluates a solution's fitness by checking e.g. if there are overbooked courses, or unfulfilled wishes, and penalizes that. Where would I put the ga.php, solution.php and the three functions? ga.php has to access the functions, but the functions have to access the models. I also don't want to call any App::import()'s from within the fitness()-function, because it gets called many thousand times when the algorithm runs. Hope someone can help me. Thanks in advance =)

  Read the article

• Checking installed files in OpenSUSE

  - by petersohn

  How to check what files are installed by an installed package under OpenSUSE?

  Read the article

• Getting data from closed files with concatenate formula

  - by Pav

  Each day a program is creating an excel file for me with some data for the current day. Like what is the price for products, how many people are available today and things like that. Based on all this I need to make some forecasts and workplace allocations for workers. The problem is, that I need to drag all this information manually all the time. So to make it automatic I placed the formula in cells like: ='c:\ABC\[ABC 29-01-14.xlsx]sheet'!a1 Everything works fine, but next day I have to change file name for "ABC 30-01-14" for each cell, what is the same as entering the data manually. So I used "concatenate" formula to change date according to today's date automatically. I used "indirect" formula to turn it in to a real formula, not text string, and realized that it is working only for open files, not closed. Is there any way to do this for closed files without VBA, because I don't know it, or with VBA but explained for an idiot.

  Read the article

• multiple FileSystemWatchers to monitor files on local system?

  - by Jason Crowes

  We're writing a text editor like tool for our internal accounting package system that has actions that can be done by our own Xml language specs. These macro commands are specified in Xml files and we need the ability to monitor if files openned have bean modified externally. The only problem is that there maybe 20-30 files with different paths openned at any one time. Would it be good to use multiple FileSystemWatchers for this scenario? Or would it be better to monitor the root drive and catch specific events that match an open file in the editor (though lots of events could be raised). Some are local drives (C,D,E) others are their network drives (U,X,G,H). Files are quite chunky too about 300-400Kb.

  Read the article

• best way to record local modifications to an application's configuration files

  - by Menelaos Perdikeas

  I often install applications in Linux which don't come in package form but rather one just downloads a tarball, unpacks it, and runs the app out of the exploded folder. To adjust the application to my environment I need to modify the default configuration files, perhaps add an odd script of my own and I would like to have a way to record all these modifications automatically so I can apply them to another environment. Clearly, the modifications can not be reproduced verbatim as things like IP addresses or username need to change from system to system; still an exhaustive record to what was changed and added would be useful. My solution is to use a pattern involving git. Basically after I explode the tarball I do a git init and an initial commit and then I can save to a file the output of git diff and a cat of all files appearing as new in the git status -s. But I am sure there are more efficient ways. ???

  Read the article

• CVS list of files only in working directories

  - by Joshua Berry

  Is it possible to get a list of files that are in the working directory tree, but not in the current branch/tag? I currently diff the working copy with another directory updated to the same module and tag/branch but without the local non-repo files. It works, but doesn't honor the .cvsignore files. I figure there must be an option using a variation of 'cvs diff'. Thanks in advance.

  Read the article

• Search Files (Preferably with index) on Windows 2000 Server

  - by ThinkBohemian

  I have many files on a windows server 2000 machine that is setup to act as a networked disk drive, is there anyway I can index the files and make that index available as a search to more people than just me? Bonus if the index can look inside of documents such as readme.txt? If there is no easy way to do this globaly (for all users) Is there a way I could generate and store an index locally on my computer? If this is the wrong place to ask this question, any advice on community more suited?

  Read the article

• multiple definition in header file

  - by Jérôme

  Here is a small code-example from which I'd like to ask a question : complex.h : #ifndef COMPLEX_H #define COMPLEX_H #include <iostream> class Complex { public: Complex(float Real, float Imaginary); float real() const { return m_Real; }; private: friend std::ostream& operator<<(std::ostream& o, const Complex& Cplx); float m_Real; float m_Imaginary; }; std::ostream& operator<<(std::ostream& o, const Complex& Cplx) { return o << Cplx.m_Real << " i" << Cplx.m_Imaginary; } #endif // COMPLEX_H complex.cpp : #include "complex.h" Complex::Complex(float Real, float Imaginary) { m_Real = Real; m_Imaginary = Imaginary; } main.cpp : #include "complex.h" #include <iostream> int main() { Complex Foo(3.4, 4.5); std::cout << Foo << "\n"; return 0; } When compiling this code, I get the following error : multiple definition of operator<<(std::ostream&, Complex const&) I've found that making this fonction inline solves the problem, but I don't understand why. Why does the compiler complain about multiple definition ? My header file is guarded (with #define COMPLEX_H). And, if complaining about the operator<< fonction, why not complain about the public real() fonction, which is defined in the header as well ? And is there another solution as using the inline keyword ?

  Read the article

• Using rsync to synchronise folders without overwriting files of same name on Mac OS X

  - by Adam

  I would like to synchronise the contents of two directories. Without overwriting but to create a copy if two files have the same name, but different sizes Without duplicating if two files have the same name and size. To work recursively So far I have found the following command which might work $ rsync -varE --progress ~/folder /volumes/server/folder But I'm not entirely sure what the -E flag does. It was suggested by a user on bananica.com but couldn't see a description for it in the manual. Would this do what I require successfully? Thanks

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

< Previous Page | 133 134 135 136 137 138 139 140 141 142 143 144  | Next Page >