Search Results

Search found 73059 results on 2923 pages for 'system string'.

Page 14/2923 | < Previous Page | 10 11 12 13 14 15 16 17 18 19 20 21  | Next Page >

  • How to get N random string from a {a1|a2|a3} format string?

    - by Pentium10
    Take this string as input: string s="planets {Sun|Mercury|Venus|Earth|Mars|Jupiter|Saturn|Uranus|Neptune}" How would I choose randomly N from the set, then join them with comma. The set is defined between {} and options are separated with | pipe. The order is maintained. Some output could be: string output1="planets Sun, Venus"; string output2="planets Neptune"; string output3="planets Earth, Saturn, Uranus, Neptune"; string output4="planets Uranus, Saturn";// bad example, order is not correct Java 1.5

    Read the article

  • how to use same string in two java files

    - by Palike
    Sorry for my bad English and for maybe stupid question but I'm new in Java. I need use same string in 2 java files for example: In first java file I've got code for sending emails, I've got string set to default email: public String mail = new String ("[email protected]"); and I use this string in code for send email: email.addTo(mail); In second java file something like set up where can user set new email address I want to have same string, connected with string in first java file. When user put new email String mail will be change to new email address and in email.addTo(mail); will be use this new address How can I do this?

    Read the article

  • Matching String.

    - by Harikrishna
    I have a string String mainString="///BUY/SELL///ORDERTIME///RT///QTY///BROKERAGE///NETRATE///AMOUNTRS///RATE///SCNM///"; Now I have another strings String str1= "RT"; which should be matched only with RT which is substring of string mainString but not with ORDERTIME which is also substring of string mainString. String str2= "RATE" ; And RATE(str2) should be matched with RATE which is substring of string mainString but not with NETRATE which is also substring of string mainString. How can we do that ?

    Read the article

  • XML Serializing a class with a Dictionary<string, List<string>> object

    - by Matt
    Is it possible to implement IXmlSerializable and in my XML file capture an object of type Dictionary ? I have the following public class coolio : IXmlSerializable { private int a; private bool b; private string c; private Dictionary<string, List<string>> coco; public coolio(int _a, bool _b, string _c, Dictionary<string, List<string>> _coco) { a=_a; b=_b; c=_c; coco=_coco; } public System.Xml.Schema.XmlSchema GetSchema() { return null; } public void WriteXml(XmlWriter writer) { const string myType = "coolio"; writer.WriteStartElement(myType); writer.WriteAttributeString("a", a.ToString()); writer.WriteAttributeString("b", b.ToString()); writer.WriteAttributeString("c", c); // How do I add a subelement for Dictionary<string, List<string>> coco? writer.WriteEndElement(); } public void ReadXml(XmlReader reader) { if (reader.MoveToContent() != XmlNodeType.Element || reader.LocalName != "coolio") return; a= int.Parse(reader["a"]); b = bool.Parse(reader["b"]); c= reader["c"]; // How do I read subelement into Dictionary<string, List<string>> coco? } } But I am stumped as to how I could add the Dictionary (XML seriliazed to my XML file)

    Read the article

  • Avoiding resource (localizable string) duplication with String.Format

    - by Hrvoje Prgeša
    I'm working on a application (.NET, but not relevant) where there is large potential for resource/string duplication - most of these strings are simple like: Volume: 33 Volume: 33 (dB) Volume 33 dB Volume (dB) Command - Volume: 33 (dB) where X, Y and unit are the same. Should I define a new resource for each of the string or is it preferable to use String.Format to simplify some of these, eg.: String.Format("{0}: {1}", Resource.Volume, 33) String.Format("{0}: {1} {2}", Resource.Volume, 33, Resource.dB) Resource.Volume String.Format("{0} ({1})", 33, Resource.dB) String.Format("{0} ({1})", Resource.Volume, Resource.dB) String.Format("Command - {0}: {1} {2}", Resource.Volume, 33, Resource.dB) I would also define string formats like "{0}: {1}" in the resources so there would be a possibility of reordering words... I would not use this approach selectivly and not throughout the whole application.. And how about: String.Format("{0}: {1}", Volume, Resource.Muted_Volume) // = Volume: Muted Resource.Muted_Volume String.Format("{0}: {1} (by user {2})", Volume, Resource.Muted_Volume, "xy") // = Volume: Muted (by user xy) The advantage is cutting the number of resource by the factor of 4-5. Are there any hidden dangers of using this approach? Could someone give me an example (language) where this would not work correctly?

    Read the article

  • Optimizing a lot of Scanner.findWithinHorizon(pattern, 0) calls

    - by darvids0n
    I'm building a process which extracts data from 6 csv-style files and two poorly laid out .txt reports and builds output CSVs, and I'm fully aware that there's going to be some overhead searching through all that whitespace thousands of times, but I never anticipated converting about about 50,000 records would take 12 hours. Excerpt of my manual matching code (I know it's horrible that I use lists of tokens like that, but it was the best thing I could think of): public static String lookup(List<String> tokensBefore, List<String> tokensAfter) { String result = null; while(_match(tokensBefore)) { // block until all input is read if(id.hasNext()) { result = id.next(); // capture the next token that matches if(_matchImmediate(tokensAfter)) // try to match tokensAfter to this result return result; } else return null; // end of file; no match } return null; // no matches } private static boolean _match(List<String> tokens) { return _match(tokens, true); } private static boolean _match(List<String> tokens, boolean block) { if(tokens != null && !tokens.isEmpty()) { if(id.findWithinHorizon(tokens.get(0), 0) == null) return false; for(int i = 1; i <= tokens.size(); i++) { if (i == tokens.size()) { // matches all tokens return true; } else if(id.hasNext() && !id.next().matches(tokens.get(i))) { break; // break to blocking behaviour } } } else { return true; // empty list always matches } if(block) return _match(tokens); // loop until we find something or nothing else return false; // return after just one attempted match } private static boolean _matchImmediate(List<String> tokens) { if(tokens != null) { for(int i = 0; i <= tokens.size(); i++) { if (i == tokens.size()) { // matches all tokens return true; } else if(!id.hasNext() || !id.next().matches(tokens.get(i))) { return false; // doesn't match, or end of file } } return false; // we have some serious problems if this ever gets called } else { return true; // empty list always matches } } Basically wondering how I would work in an efficient string search (Boyer-Moore or similar). My Scanner id is scanning a java.util.String, figured buffering it to memory would reduce I/O since the search here is being performed thousands of times on a relatively small file. The performance increase compared to scanning a BufferedReader(FileReader(File)) was probably less than 1%, the process still looks to be taking a LONG time. I've also traced execution and the slowness of my overall conversion process is definitely between the first and last like of the lookup method. In fact, so much so that I ran a shortcut process to count the number of occurrences of various identifiers in the .csv-style files (I use 2 lookup methods, this is just one of them) and the process completed indexing approx 4 different identifiers for 50,000 records in less than a minute. Compared to 12 hours, that's instant. Some notes (updated): I don't necessarily need the pattern-matching behaviour, I only get the first field of a line of text so I need to match line breaks or use Scanner.nextLine(). All ID numbers I need start at position 0 of a line and run through til the first block of whitespace, after which is the name of the corresponding object. I would ideally want to return a String, not an int locating the line number or start position of the result, but if it's faster then it will still work just fine. If an int is being returned, however, then I would now have to seek to that line again just to get the ID; storing the ID of every line that is searched sounds like a way around that. Anything to help me out, even if it saves 1ms per search, will help, so all input is appreciated. Thankyou! Usage scenario 1: I have a list of objects in file A, who in the old-style system have an id number which is not in file A. It is, however, POSSIBLY in another csv-style file (file B) or possibly still in a .txt report (file C) which each also contain a bunch of other information which is not useful here, and so file B needs to be searched through for the object's full name (1 token since it would reside within the second column of any given line), and then the first column should be the ID number. If that doesn't work, we then have to split the search token by whitespace into separate tokens before doing a search of file C for those tokens as well. Generalised code: String field; for (/* each record in file A */) { /* construct the rest of this object from file A info */ // now to find the ID, if we can List<String> objectName = new ArrayList<String>(1); objectName.add(Pattern.quote(thisObject.fullName)); field = lookup(objectSearchToken, objectName); // search file B if(field == null) // not found in file B { lookupReset(false); // initialise scanner to check file C objectName.clear(); // not using the full name String[] tokens = thisObject.fullName.split(id.delimiter().pattern()); for(String s : tokens) objectName.add(Pattern.quote(s)); field = lookup(objectSearchToken, objectName); // search file C lookupReset(true); // back to file B } else { /* found it, file B specific processing here */ } if(field != null) // found it in B or C thisObject.ID = field; } The objectName tokens are all uppercase words with possible hyphens or apostrophes in them, separated by spaces. Much like a person's name. As per a comment, I will pre-compile the regex for my objectSearchToken, which is just [\r\n]+. What's ending up happening in file C is, every single line is being checked, even the 95% of lines which don't contain an ID number and object name at the start. Would it be quicker to use ^[\r\n]+.*(objectname) instead of two separate regexes? It may reduce the number of _match executions. The more general case of that would be, concatenate all tokensBefore with all tokensAfter, and put a .* in the middle. It would need to be matching backwards through the file though, otherwise it would match the correct line but with a huge .* block in the middle with lots of lines. The above situation could be resolved if I could get java.util.Scanner to return the token previous to the current one after a call to findWithinHorizon. I have another usage scenario. Will put it up asap.

    Read the article

  • error in IIS7 but not on IIS6

    - by Brad
    I have a website that is we are now deploying to windows 2008 servers that has worked in the past on IIS6 without a problem. It is using .net 2 framework. Most of the website works. Just when we create a screen report over a certain size on the server we get this error. Event code: 3005 Event message: An unhandled exception has occurred. Event time: 6/2/2010 10:40:17 AM Event time (UTC): 6/2/2010 3:40:17 PM Event ID: 1b719ad45d444f949ecc9cbc23f49720 Event sequence: 10 Event occurrence: 1 Event detail code: 0 Application information: Application domain: /LM/W3SVC/3/ROOT-1-129199668164927170 Trust level: Full Application Virtual Path: / Application Path: c:\web\PatronAccess\ Machine name: WIN2008DEV Process information: Process ID: 4712 Process name: w3wp.exe Account name: NT AUTHORITY\NETWORK SERVICE Exception information: Exception type: HttpException Exception message: Invalid viewstate. Request information: Request URL: http://win2008dev/WebResource.axd?d=xCXKkHAeSYHWbCg.gif Request path: /WebResource.axd User host address: 172.17.2.66 User: Is authenticated: False Authentication Type: Thread account name: NT AUTHORITY\NETWORK SERVICE Thread information: Thread ID: 6 Thread account name: NT AUTHORITY\NETWORK SERVICE Is impersonating: False Stack trace: at System.Web.UI.Page.DecryptStringWithIV(String s, IVType ivType) at System.Web.Handlers.AssemblyResourceLoader.System.Web.IHttpHandler.ProcessRequest(HttpContext context) at System.Web.HttpApplication.CallHandlerExecutionStep.System.Web.HttpApplication.IExecutionStep.Execute() at System.Web.HttpApplication.ExecuteStep(IExecutionStep step, Boolean& completedSynchronously) Custom event details: And this one. A process serving application pool 'PatronAccess' suffered a fatal communication error with the Windows Process Activation Service. The process id was '4596'. The data field contains the error number. I have a debug of the application pool but I don't know where to go from here. * wait with pending attach Symbol search path is: Executable search path is: ModLoad: 00bd0000 00bd8000 c:\windows\system32\inetsrv\w3wp.exe ModLoad: 77380000 774a7000 C:\Windows\system32\ntdll.dll ModLoad: 75cb0000 75d8b000 C:\Windows\system32\kernel32.dll ModLoad: 75b60000 75c26000 C:\Windows\system32\ADVAPI32.dll ModLoad: 75df0000 75eb2000 C:\Windows\system32\RPCRT4.dll ModLoad: 76500000 765aa000 C:\Windows\system32\msvcrt.dll ModLoad: 76250000 762ed000 C:\Windows\system32\USER32.dll ModLoad: 75ae0000 75b2b000 C:\Windows\system32\GDI32.dll ModLoad: 75ec0000 76004000 C:\Windows\system32\ole32.dll ModLoad: 731a0000 731d6000 c:\windows\system32\inetsrv\IISUTIL.dll ModLoad: 75330000 75421000 C:\Windows\system32\CRYPT32.dll ModLoad: 75490000 754a2000 C:\Windows\system32\MSASN1.dll ModLoad: 758e0000 758fe000 C:\Windows\system32\USERENV.dll ModLoad: 758c0000 758d4000 C:\Windows\system32\Secur32.dll ModLoad: 75b30000 75b5d000 C:\Windows\system32\WS2_32.dll ModLoad: 774e0000 774e6000 C:\Windows\system32\NSI.dll ModLoad: 75ac0000 75ade000 C:\Windows\system32\IMM32.DLL ModLoad: 772b0000 77378000 C:\Windows\system32\MSCTF.dll ModLoad: 774f0000 774f9000 C:\Windows\system32\LPK.DLL ModLoad: 75c30000 75cad000 C:\Windows\system32\USP10.dll ModLoad: 74d30000 74d51000 C:\Windows\system32\NTMARTA.DLL ModLoad: 77500000 7754a000 C:\Windows\system32\WLDAP32.dll ModLoad: 75990000 75997000 C:\Windows\system32\PSAPI.DLL ModLoad: 754b0000 754c1000 C:\Windows\system32\SAMLIB.dll ModLoad: 744c0000 744ce000 c:\windows\system32\inetsrv\w3wphost.dll ModLoad: 77550000 775dd000 C:\Windows\system32\OLEAUT32.dll ModLoad: 72ec0000 72f12000 c:\windows\system32\inetsrv\nativerd.dll ModLoad: 742a0000 742cf000 C:\Windows\system32\XmlLite.dll ModLoad: 72e60000 72e90000 c:\windows\system32\inetsrv\IISRES.DLL ModLoad: 74f40000 74f7b000 C:\Windows\system32\rsaenh.dll ModLoad: 72f40000 72f86000 C:\Windows\system32\mscoree.dll ModLoad: 75d90000 75de8000 C:\Windows\system32\SHLWAPI.dll ModLoad: 74600000 7479e000 C:\Windows\WinSxS\x86_microsoft.windows.common-controls_6595b64144ccf1df_6.0.6001.18000_none_5cdbaa5a083979cc\comctl32.dll ModLoad: 72310000 728a0000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\mscorwks.dll ModLoad: 72dc0000 72e5b000 C:\Windows\WinSxS\x86_microsoft.vc80.crt_1fc8b3b9a1e18e3b_8.0.50727.3053_none_d08d7bba442a9b36\MSVCR80.dll ModLoad: 75a30000 75ab4000 C:\Windows\system32\CLBCatQ.DLL ModLoad: 728a0000 728d0000 C:\Windows\system32\mlang.dll ModLoad: 6c7d0000 6c801000 C:\Windows\system32\inetsrv\iiscore.dll ModLoad: 71fd0000 71fd7000 c:\windows\system32\inetsrv\W3TP.dll ModLoad: 74480000 74489000 c:\windows\system32\inetsrv\w3dt.dll ModLoad: 71fb0000 71fbb000 C:\Windows\system32\HTTPAPI.dll ModLoad: 752f0000 7532a000 C:\Windows\system32\slc.dll ModLoad: 6cad0000 6caf8000 C:\Windows\system32\faultrep.dll ModLoad: 75050000 75058000 C:\Windows\system32\VERSION.dll ModLoad: 74b80000 74b8f000 C:\Windows\system32\NLAapi.dll ModLoad: 75290000 752a9000 C:\Windows\system32\IPHLPAPI.DLL ModLoad: 75250000 75285000 C:\Windows\system32\dhcpcsvc.DLL ModLoad: 754d0000 754fc000 C:\Windows\system32\DNSAPI.dll ModLoad: 75240000 75247000 C:\Windows\system32\WINNSI.DLL ModLoad: 75210000 75231000 C:\Windows\system32\dhcpcsvc6.DLL ModLoad: 750b0000 750eb000 C:\Windows\System32\mswsock.dll ModLoad: 73920000 73928000 C:\Windows\System32\winrnr.dll ModLoad: 73720000 7372f000 C:\Windows\system32\napinsp.dll ModLoad: 74d00000 74d05000 C:\Windows\System32\wshtcpip.dll ModLoad: 75140000 75145000 C:\Windows\System32\wship6.dll ModLoad: 73910000 73916000 C:\Windows\system32\rasadhlp.dll ModLoad: 6ca00000 6ca06000 C:\Windows\System32\inetsrv\cachuri.dll ModLoad: 6c9f0000 6c9f8000 C:\Windows\System32\inetsrv\cachfile.dll ModLoad: 6c9e0000 6c9e6000 C:\Windows\System32\inetsrv\cachtokn.dll ModLoad: 6c9d0000 6c9de000 C:\Windows\System32\inetsrv\cachhttp.dll ModLoad: 6c960000 6c96e000 C:\Windows\System32\inetsrv\compstat.dll ModLoad: 6c930000 6c938000 C:\Windows\System32\inetsrv\defdoc.dll ModLoad: 6c910000 6c919000 C:\Windows\System32\inetsrv\dirlist.dll ModLoad: 6c6b0000 6c6b8000 C:\Windows\System32\inetsrv\protsup.dll ModLoad: 6c6a0000 6c6ad000 C:\Windows\System32\inetsrv\static.dll ModLoad: 6c690000 6c69b000 C:\Windows\System32\inetsrv\authanon.dll ModLoad: 6c680000 6c68b000 C:\Windows\System32\inetsrv\authbas.dll ModLoad: 6c630000 6c63e000 C:\Windows\System32\inetsrv\authsspi.dll ModLoad: 755b0000 75625000 C:\Windows\system32\NETAPI32.dll ModLoad: 6c620000 6c62b000 C:\Windows\System32\inetsrv\modrqflt.dll ModLoad: 6c610000 6c61d000 C:\Windows\System32\inetsrv\custerr.dll ModLoad: 6c5c0000 6c5c8000 C:\Windows\System32\inetsrv\loghttp.dll ModLoad: 6c330000 6c337000 C:\Windows\System32\inetsrv\iisreqs.dll ModLoad: 728f0000 728f7000 C:\Windows\system32\WSOCK32.dll ModLoad: 6c1f0000 6c20e000 C:\Windows\System32\inetsrv\isapi.dll ModLoad: 6c000000 6c011000 C:\Windows\System32\inetsrv\filter.dll ModLoad: 6c320000 6c328000 C:\Windows\System32\inetsrv\validcfg.dll ModLoad: 6a2a0000 6a30d000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\webengine.dll ModLoad: 60060000 60067000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\aspnet_filter.dll ModLoad: 6c310000 6c319000 C:\Windows\system32\inetsrv\wbhst_pm.dll ModLoad: 765b0000 770c0000 C:\Windows\system32\shell32.dll ModLoad: 70d10000 71807000 C:\Windows\assembly\NativeImages_v2.0.50727_32\mscorlib\17f572b09facdc5fda9431558eb7a26e\mscorlib.ni.dll ModLoad: 70580000 70d05000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System\52e1ea3c7491e05cda766d7b3ce3d559\System.ni.dll ModLoad: 03990000 044d3000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Web\96071d36e4d44ebb31a3b46f08fdc732\System.Web.ni.dll ModLoad: 75770000 757cf000 C:\Windows\system32\sxs.dll ModLoad: 72ac0000 72bb1000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Configuration\e6001d416f7c468334934a2c6a41c631\System.Configuration.ni.dll ModLoad: 71890000 71dc6000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Xml\7208ffa39630e9b923331f9df0947a12\System.Xml.ni.dll ModLoad: 66580000 667bc000 C:\Windows\assembly\NativeImages_v2.0.50727_32\Microsoft.JScript\1543943b86269c9bebd5cf7a3fe7f55b\Microsoft.JScript.ni.dll ModLoad: 74460000 74468000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\App_global.asax.cyzjkxpg.dll ModLoad: 65d20000 65e7c000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\10097bf6\5f9a08ec_fffcca01\PatronAccess.DLL ModLoad: 72030000 7208b000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\mscorjit.dll ModLoad: 68ab0000 68bca000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Web.Extensio#\3b4cb090536bf6b0dfae8cefaeeadb9f\System.Web.Extensions.ni.dll ModLoad: 64020000 64033000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\mscorsec.dll ModLoad: 73c40000 73c6d000 C:\Windows\system32\WINTRUST.dll ModLoad: 774b0000 774d9000 C:\Windows\system32\imagehlp.dll ModLoad: 73690000 73715000 C:\Windows\WinSxS\x86_microsoft.windows.common-controls_6595b64144ccf1df_5.82.6001.18000_none_886786f450a74a05\COMCTL32.dll ModLoad: 75170000 751a5000 C:\Windows\system32\ncrypt.dll ModLoad: 751b0000 751f5000 C:\Windows\system32\BCRYPT.dll ModLoad: 74d90000 74da5000 C:\Windows\system32\GPAPI.dll ModLoad: 73520000 7353b000 C:\Windows\system32\cryptnet.dll ModLoad: 73440000 73446000 C:\Windows\system32\SensApi.dll ModLoad: 73a50000 73a65000 C:\Windows\system32\Cabinet.dll ModLoad: 6ae30000 6ae3a000 C:\Windows\system32\inetsrv\gzip.dll ModLoad: 69e50000 69e6a000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\App_Web_kal6czmb.dll ModLoad: 69e10000 69e3c000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\App_Web_b1efcjqz.dll ModLoad: 69bd0000 69c26000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\e8a04837\0093847c_5153ca01\Infragistics2.WebUI.UltraWebTab.v9.2.DLL ModLoad: 5e480000 5e95e000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\719ff0ee\00c37169_5153ca01\Infragistics2.Web.v9.2.DLL ModLoad: 67c90000 67d1a000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\ba3b912a\00d19870_5153ca01\Infragistics2.WebUI.Shared.v9.2.DLL ModLoad: 656a0000 6587a000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\6470a692\14d22a05_ef2ac901\AjaxControlToolkit.DLL ModLoad: 66960000 66ae8000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Drawing\6312464f64727a2a50d5ce3fd73ad1bb\System.Drawing.ni.dll ModLoad: 6e690000 6ece3000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Data\813556b5a2722045b0ea14467fd00227\System.Data.ni.dll ModLoad: 64e70000 65144000 C:\Windows\assembly\GAC_32\System.Data\2.0.0.0__b77a5c561934e089\System.Data.dll ModLoad: 69c70000 69ca2000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\App_Web_zwtn5a73.dll ModLoad: 69e70000 69e8e000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\App_Web_qijxg7dv.dll ModLoad: 645a0000 647bf000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Web.Mobile\b472cb382c17ffc3cb1a91ce12d90bf1\System.Web.Mobile.ni.dll ModLoad: 69c30000 69c66000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Web.RegularE#\e6b57c0506ec849c6706cb5617ad7372\System.Web.RegularExpressions.ni.dll ModLoad: 6c300000 6c30a000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\App_Web__hyepzhd.dll ModLoad: 69e00000 69e08000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\5ef208f7\b68a494a_e840c901\SessionTimeoutControl.DLL ModLoad: 69d50000 69d5c000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\619d48f7\0f695f01_fdfcca01\AgNetDataPro.DLL ModLoad: 69cd0000 69ce8000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\dc1703ed\00e1c635_caeaca01\xfnlnet.DLL ModLoad: 73d50000 73efb000 C:\Windows\WinSxS\x86_microsoft.windows.gdiplus_6595b64144ccf1df_1.0.6001.18175_none_9e7bbe54c9c04bca\gdiplus.dll (16cc.14e0): Break instruction exception - code 80000003 (first chance) eax=7ffa6000 ebx=00000000 ecx=00000000 edx=7740d094 esi=00000000 edi=00000000 eip=773c7dfe esp=051ff774 ebp=051ff7a0 iopl=0 nv up ei pl zr na pe nc cs=001b ss=0023 ds=0023 es=0023 fs=003b gs=0000 efl=00000246 ntdll!DbgBreakPoint: 773c7dfe cc int 3 0:021 g (16cc.1454): Access violation - code c0000005 (first chance) First chance exceptions are reported before any exception handling. This exception may be expected and handled. eax=00000000 ebx=00000479 ecx=00000000 edx=019d21f8 esi=019d1f18 edi=019ba74c eip=013849ed esp=0499ea44 ebp=0499f15c iopl=0 nv up ei pl zr na pe nc cs=001b ss=0023 ds=0023 es=0023 fs=003b gs=0000 efl=00010246 013849ed 8b01 mov eax,dword ptr [ecx] ds:0023:00000000=???????? 0:018 g ModLoad: 65890000 65a55000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Web.Services\2fa835ce2dcace4fc7c0009f102efc79\System.Web.Services.ni.dll ModLoad: 6f2b0000 6f34d000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.EnterpriseSe#\ae383808b3f5ee9287358378f9a2cad3\System.EnterpriseServices.ni.dll ModLoad: 10000000 10020000 System.EnterpriseServices.Wrapper.dll ModLoad: 00e50000 00e70000 System.EnterpriseServices.Wrapper.dll ModLoad: 66da0000 66de8000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.EnterpriseSe#\ae383808b3f5ee9287358378f9a2cad3\System.EnterpriseServices.Wrapper.dll ModLoad: 10000000 10020000 C:\Windows\assembly\GAC_32\System.EnterpriseServices\2.0.0.0__b03f5f7f11d50a3a\System.EnterpriseServices.Wrapper.dll ModLoad: 6ab40000 6ab4c000 image6ab40000 ModLoad: 04950000 0495c000 image04950000 ModLoad: 049a0000 049c0000 image049a0000 ModLoad: 049d0000 049f0000 image049d0000 ModLoad: 049a0000 049c0000 image049a0000 ModLoad: 04a40000 04a60000 image04a40000 ModLoad: 049a0000 049c0000 image049a0000 ModLoad: 04a40000 04a60000 image04a40000 ModLoad: 049a0000 049c0000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\da3b70a0\00e9280f_c1f4c201\ICSharpCode.SharpZipLib.DLL ModLoad: 5eb40000 5f01e000 Infragistics2.Web.v9.2.dll ModLoad: 05a00000 05ede000 Infragistics2.Web.v9.2.dll ModLoad: 694d0000 694fa000 image694d0000 ModLoad: 049d0000 049fa000 image049d0000 ModLoad: 68cc0000 68cea000 image68cc0000 ModLoad: 04e40000 04e6a000 image04e40000 ModLoad: 69470000 6949a000 image69470000 ModLoad: 04e40000 04e6a000 image04e40000 ModLoad: 69470000 6949a000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\f77351ae\00582c74_5153ca01\Infragistics2.WebUI.Misc.v9.2.DLL ModLoad: 67d20000 67daa000 image67d20000 ModLoad: 04e70000 04efa000 image04e70000 ModLoad: 643e0000 64598000 Infragistics2.WebUI.UltraWebChart.v9.2.dll ModLoad: 05a00000 05bb8000 Infragistics2.WebUI.UltraWebChart.v9.2.dll ModLoad: 63ac0000 63c78000 Infragistics2.WebUI.UltraWebChart.v9.2.dll ModLoad: 05bc0000 05d78000 Infragistics2.WebUI.UltraWebChart.v9.2.dll ModLoad: 63900000 63ab8000 Infragistics2.WebUI.UltraWebChart.v9.2.dll ModLoad: 05bc0000 05d78000 Infragistics2.WebUI.UltraWebChart.v9.2.dll ModLoad: 63900000 63ab8000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\9acf477c\0030eeb6_5153ca01\Infragistics2.WebUI.UltraWebChart.v9.2.DLL ModLoad: 60570000 607b6000 image60570000 ModLoad: 05d80000 05fc6000 image05d80000 ModLoad: 64350000 64596000 image64350000 ModLoad: 05fd0000 06216000 image05fd0000 ModLoad: 5edd0000 5f016000 image5edd0000 ModLoad: 05fd0000 06216000 image05fd0000 ModLoad: 5edd0000 5f016000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\30e4a2ff\00dfbf77_5153ca01\Infragistics2.WebUI.UltraWebGrid.v9.2.DLL ModLoad: 67d50000 67da6000 image67d50000 ModLoad: 04e70000 04ec6000 image04e70000 ModLoad: 68cb0000 68ce4000 image68cb0000 ModLoad: 04e70000 04ea4000 image04e70000 ModLoad: 68790000 687c4000 image68790000 ModLoad: 04eb0000 04ee4000 image04eb0000 ModLoad: 688f0000 68924000 image688f0000 ModLoad: 04eb0000 04ee4000 image04eb0000 ModLoad: 688f0000 68924000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\2420cb22\00a1ab83_5153ca01\Infragistics2.WebUI.WebCombo.v9.2.DLL ModLoad: 66d50000 66da0000 image66d50000 ModLoad: 04f80000 04fd0000 image04f80000 ModLoad: 67d60000 67db0000 image67d60000 ModLoad: 05a00000 05a50000 image05a00000 ModLoad: 66d00000 66d50000 image66d00000 ModLoad: 05a00000 05a50000 image05a00000 ModLoad: 66d00000 66d50000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\6ceab935\00b28e76_5153ca01\Infragistics2.WebUI.WebDataInput.v9.2.DLL ModLoad: 11000000 1112e000 image11000000 ModLoad: 05a50000 05b7e000 image05a50000 ModLoad: 11000000 1112e000 image11000000 ModLoad: 05d80000 05eae000 image05d80000 ModLoad: 11000000 1112e000 image11000000 ModLoad: 05d80000 05eae000 image05d80000 ModLoad: 11000000 1112e000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\e99fdd05\00c79c09_d868c301\itextsharp.DLL ModLoad: 04df0000 04dfe000 LinkPointAPI-cs.dll ModLoad: 04e70000 04e7e000 LinkPointAPI-cs.dll ModLoad: 04df0000 04dfe000 LinkPointAPI-cs.dll ModLoad: 04e80000 04e8e000 LinkPointAPI-cs.dll ModLoad: 04df0000 04dfe000 LinkPointAPI-cs.dll ModLoad: 04e80000 04e8e000 LinkPointAPI-cs.dll ModLoad: 04df0000 04dfe000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\0e724536\00922343_54dfc701\LinkPointAPI-cs.DLL ModLoad: 04e70000 04e78000 image04e70000 ModLoad: 04e90000 04e98000 image04e90000 ModLoad: 04e70000 04e78000 image04e70000 ModLoad: 04ea0000 04ea8000 image04ea0000 ModLoad: 04e70000 04e78000 image04e70000 ModLoad: 04ea0000 04ea8000 image04ea0000 ModLoad: 04e70000 04e78000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\859797c4\00eb5fc5_bed8c401\LinkPointTransaction.DLL ModLoad: 65e80000 65fdc000 PatronAccess.dll ModLoad: 05a50000 05bac000 PatronAccess.dll ModLoad: 6ab40000 6ab48000 SessionTimeoutControl.dll ModLoad: 04e90000 04e98000 SessionTimeoutControl.dll ModLoad: 6ab80000 6ab8e000 WebServices.dll ModLoad: 04e90000 04e9e000 WebServices.dll ModLoad: 6ab40000 6ab4e000 WebServices.dll ModLoad: 04ef0000 04efe000 WebServices.dll ModLoad: 69d40000 69d4e000 WebServices.dll ModLoad: 04ef0000 04efe000 WebServices.dll ModLoad: 69d40000 69d4e000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\21555aa5\5f498093_fefcca01\WebServices.DLL ModLoad: 694e0000 694f8000 image694e0000 ModLoad: 04f80000 04f98000 image04f80000 ModLoad: 661c0000 6624e000 System.ServiceModel.Web.dll ModLoad: 05a50000 05ade000 System.ServiceModel.Web.dll ModLoad: 5d850000 5ddfc000 System.ServiceModel.dll ModLoad: 06220000 067cc000 System.ServiceModel.dll ModLoad: 65ef0000 65fe0000 System.Runtime.Serialization.dll ModLoad: 05eb0000 05fa0000 System.Runtime.Serialization.dll ModLoad: 694e0000 694fe000 SMDiagnostics.dll ModLoad: 04f80000 04f9e000 SMDiagnostics.dll ModLoad: 65be0000 65d1c000 System.Web.Extensions.dll ModLoad: 067d0000 0690c000 System.Web.Extensions.dll ModLoad: 67d40000 67dac000 System.IdentityModel.dll ModLoad: 05ae0000 05b4c000 System.IdentityModel.dll ModLoad: 687a0000 687c2000 System.IdentityModel.Selectors.dll ModLoad: 04fa0000 04fc2000 System.IdentityModel.Selectors.dll ModLoad: 66c90000 66cf4000 Microsoft.Transactions.Bridge.dll ModLoad: 05b50000 05bb4000 Microsoft.Transactions.Bridge.dll ModLoad: 69130000 69146000 System.Web.Abstractions.dll ModLoad: 051b0000 051c6000 System.Web.Abstractions.dll ModLoad: 65150000 651f6000 System.Core.dll ModLoad: 06910000 069b6000 System.Core.dll ModLoad: 64440000 644ea000 System.Data.Linq.dll ModLoad: 069c0000 06a6a000 System.Data.Linq.dll ModLoad: 66d50000 66d9c000 System.Data.Services.Client.dll ModLoad: 06a70000 06abc000 System.Data.Services.Client.dll ModLoad: 68cd0000 68cf0000 System.Data.Services.Design.dll ModLoad: 05210000 05230000 System.Data.Services.Design.dll ModLoad: 5eb00000 5edc2000 System.Data.Entity.dll ModLoad: 06ac0000 06d82000 System.Data.Entity.dll ModLoad: 66af0000 66b16000 System.Xml.Linq.dll ModLoad: 05fa0000 05fc6000 System.Xml.Linq.dll ModLoad: 661c0000 6624e000 C:\Windows\assembly\GAC_MSIL\System.ServiceModel.Web\3.5.0.0__31bf3856ad364e35\System.ServiceModel.Web.dll ModLoad: 64520000 6459e000 System.WorkflowServices.dll ModLoad: 06d90000 06e0e000 System.WorkflowServices.dll ModLoad: 63af0000 63c80000 System.Workflow.ComponentModel.dll ModLoad: 06e10000 06fa0000 System.Workflow.ComponentModel.dll ModLoad: 64320000 6443a000 System.Workflow.Activities.dll ModLoad: 06fa0000 070ba000 System.Workflow.Activities.dll ModLoad: 62cf0000 62d78000 System.Workflow.Runtime.dll ModLoad: 070c0000 07148000 System.Workflow.Runtime.dll ModLoad: 68cb0000 68cc6000 Microsoft.Build.Utilities.dll ModLoad: 07150000 07166000 Microsoft.Build.Utilities.dll ModLoad: 6ab80000 6ab8c000 Microsoft.Build.Framework.dll ModLoad: 05230000 0523c000 Microsoft.Build.Framework.dll ModLoad: 07170000 07214000 Microsoft.Build.Tasks.dll ModLoad: 07220000 072c4000 Microsoft.Build.Tasks.dll ModLoad: 64520000 6459e000 C:\Windows\assembly\GAC_MSIL\System.WorkflowServices\3.5.0.0__31bf3856ad364e35\System.WorkflowServices.dll ModLoad: 5d610000 5d84e000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Runtime.Seri#\a33b3b88fd575b703ba4212c677880ae\System.Runtime.Serialization.ni.dll ModLoad: 605a0000 606a6000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.IdentityModel\3bfbe737873becead614d1504e7d5684\System.IdentityModel.ni.dll ModLoad: 5ab70000 5bbf7000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.ServiceModel\7115815b53ec561932345e16fbeea968\System.ServiceModel.ni.dll ModLoad: 61440000 6201e000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Windows.Forms\1941d7639299344ae28fb6b23da65247\System.Windows.Forms.ni.dll ModLoad: 5d190000 5d3c4000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Core\a0522cb280c09b3441e1889502ca145a\System.Core.ni.dll ModLoad: 60a00000 61433000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Design\d3fa02f8a34329c8b84c004afaea7054\System.Design.ni.dll (16cc.1454): CLR exception - code e0434f4d (first chance) (16cc.1454): Access violation - code c0000005 (first chance) First chance exceptions are reported before any exception handling. This exception may be expected and handled. eax=00000000 ebx=01776038 ecx=00000000 edx=00000000 esi=017ff314 edi=018907f8 eip=071a62fc esp=0499ee88 ebp=0499eef4 iopl=0 nv up ei pl zr na pe nc cs=001b ss=0023 ds=0023 es=0023 fs=003b gs=0000 efl=00010246 071a62fc 8b01 mov eax,dword ptr [ecx] ds:0023:00000000=???????? 0:018 g (16cc.1454): CLR exception - code e0434f4d (first chance) (16cc.1454): Access violation - code c0000005 (first chance) First chance exceptions are reported before any exception handling. This exception may be expected and handled. eax=00000000 ebx=01776038 ecx=00000000 edx=00000000 esi=017ff200 edi=0186ed04 eip=071a62fc esp=0499ee88 ebp=0499eef4 iopl=0 nv up ei pl zr na pe nc cs=001b ss=0023 ds=0023 es=0023 fs=003b gs=0000 efl=00010246 071a62fc 8b01 mov eax,dword ptr [ecx] ds:0023:00000000=???????? 0:018 g (16cc.1358): Access violation - code c0000005 (first chance) First chance exceptions are reported before any exception handling. This exception may be expected and handled. eax=00000000 ebx=01776038 ecx=00000000 edx=00000000 esi=017ff200 edi=01858380 eip=071a62fc esp=0742ee98 ebp=0742ef04 iopl=0 nv up ei pl zr na pe nc cs=001b ss=0023 ds=0023 es=0023 fs=003b gs=0000 efl=00010246 071a62fc 8b01 mov eax,dword ptr [ecx] ds:0023:00000000=???????? 0:020 g (16cc.1358): Access violation - code c0000005 (first chance) First chance exceptions are reported before any exception handling. This exception may be expected and handled. eax=00000000 ebx=017758a4 ecx=00000000 edx=00000000 esi=017fd078 edi=018b6afc eip=071a62fc esp=0742ee98 ebp=0742ef04 iopl=0 nv up ei pl zr na pe nc cs=001b ss=0023 ds=0023 es=0023 fs=003b gs=0000 efl=00010246 071a62fc 8b01 mov eax,dword ptr [ecx] ds:0023:00000000=???????? 0:020 g (16cc.1358): Stack overflow - code c00000fd (first chance) First chance exceptions are reported before any exception handling. This exception may be expected and handled. eax=00000000 ebx=020504b4 ecx=000001d1 edx=0000001b esi=020503d4 edi=073f2998 eip=6eaf0ed3 esp=073f2980 ebp=073f30ec iopl=0 nv up ei pl zr na pe nc cs=001b ss=0023 ds=0023 es=0023 fs=003b gs=0000 efl=00010246 * WARNING: Unable to verify checksum for C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Data\813556b5a2722045b0ea14467fd00227\System.Data.ni.dll System_Data_ni!_bidW103 (System_Data_ni+0x460ed3): 6eaf0ed3 f3ab rep stos dword ptr es:[edi] Any help would be appricated.

    Read the article

  • error in IIS7 but not on IIS6

    - by Brad
    I have a website that is we are now deploying to windows 2008 servers that has worked in the past on IIS6 without a problem. It is using .net 2 framework. Most of the website works. Just when we create a screen report over a certain size on the server we get this error. Event code: 3005 Event message: An unhandled exception has occurred. Event time: 6/2/2010 10:40:17 AM Event time (UTC): 6/2/2010 3:40:17 PM Event ID: 1b719ad45d444f949ecc9cbc23f49720 Event sequence: 10 Event occurrence: 1 Event detail code: 0 Application information: Application domain: /LM/W3SVC/3/ROOT-1-129199668164927170 Trust level: Full Application Virtual Path: / Application Path: c:\web\PatronAccess\ Machine name: WIN2008DEV Process information: Process ID: 4712 Process name: w3wp.exe Account name: NT AUTHORITY\NETWORK SERVICE Exception information: Exception type: HttpException Exception message: Invalid viewstate. Request information: Request URL: http://win2008dev/WebResource.axd?d=xCXKkHAeSYHWbCg.gif Request path: /WebResource.axd User host address: 172.17.2.66 User: Is authenticated: False Authentication Type: Thread account name: NT AUTHORITY\NETWORK SERVICE Thread information: Thread ID: 6 Thread account name: NT AUTHORITY\NETWORK SERVICE Is impersonating: False Stack trace: at System.Web.UI.Page.DecryptStringWithIV(String s, IVType ivType) at System.Web.Handlers.AssemblyResourceLoader.System.Web.IHttpHandler.ProcessRequest(HttpContext context) at System.Web.HttpApplication.CallHandlerExecutionStep.System.Web.HttpApplication.IExecutionStep.Execute() at System.Web.HttpApplication.ExecuteStep(IExecutionStep step, Boolean& completedSynchronously) Custom event details: And this one. A process serving application pool 'PatronAccess' suffered a fatal communication error with the Windows Process Activation Service. The process id was '4596'. The data field contains the error number. I have a debug of the application pool but I don't know where to go from here. * wait with pending attach Symbol search path is: Executable search path is: ModLoad: 00bd0000 00bd8000 c:\windows\system32\inetsrv\w3wp.exe ModLoad: 77380000 774a7000 C:\Windows\system32\ntdll.dll ModLoad: 75cb0000 75d8b000 C:\Windows\system32\kernel32.dll ModLoad: 75b60000 75c26000 C:\Windows\system32\ADVAPI32.dll ModLoad: 75df0000 75eb2000 C:\Windows\system32\RPCRT4.dll ModLoad: 76500000 765aa000 C:\Windows\system32\msvcrt.dll ModLoad: 76250000 762ed000 C:\Windows\system32\USER32.dll ModLoad: 75ae0000 75b2b000 C:\Windows\system32\GDI32.dll ModLoad: 75ec0000 76004000 C:\Windows\system32\ole32.dll ModLoad: 731a0000 731d6000 c:\windows\system32\inetsrv\IISUTIL.dll ModLoad: 75330000 75421000 C:\Windows\system32\CRYPT32.dll ModLoad: 75490000 754a2000 C:\Windows\system32\MSASN1.dll ModLoad: 758e0000 758fe000 C:\Windows\system32\USERENV.dll ModLoad: 758c0000 758d4000 C:\Windows\system32\Secur32.dll ModLoad: 75b30000 75b5d000 C:\Windows\system32\WS2_32.dll ModLoad: 774e0000 774e6000 C:\Windows\system32\NSI.dll ModLoad: 75ac0000 75ade000 C:\Windows\system32\IMM32.DLL ModLoad: 772b0000 77378000 C:\Windows\system32\MSCTF.dll ModLoad: 774f0000 774f9000 C:\Windows\system32\LPK.DLL ModLoad: 75c30000 75cad000 C:\Windows\system32\USP10.dll ModLoad: 74d30000 74d51000 C:\Windows\system32\NTMARTA.DLL ModLoad: 77500000 7754a000 C:\Windows\system32\WLDAP32.dll ModLoad: 75990000 75997000 C:\Windows\system32\PSAPI.DLL ModLoad: 754b0000 754c1000 C:\Windows\system32\SAMLIB.dll ModLoad: 744c0000 744ce000 c:\windows\system32\inetsrv\w3wphost.dll ModLoad: 77550000 775dd000 C:\Windows\system32\OLEAUT32.dll ModLoad: 72ec0000 72f12000 c:\windows\system32\inetsrv\nativerd.dll ModLoad: 742a0000 742cf000 C:\Windows\system32\XmlLite.dll ModLoad: 72e60000 72e90000 c:\windows\system32\inetsrv\IISRES.DLL ModLoad: 74f40000 74f7b000 C:\Windows\system32\rsaenh.dll ModLoad: 72f40000 72f86000 C:\Windows\system32\mscoree.dll ModLoad: 75d90000 75de8000 C:\Windows\system32\SHLWAPI.dll ModLoad: 74600000 7479e000 C:\Windows\WinSxS\x86_microsoft.windows.common-controls_6595b64144ccf1df_6.0.6001.18000_none_5cdbaa5a083979cc\comctl32.dll ModLoad: 72310000 728a0000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\mscorwks.dll ModLoad: 72dc0000 72e5b000 C:\Windows\WinSxS\x86_microsoft.vc80.crt_1fc8b3b9a1e18e3b_8.0.50727.3053_none_d08d7bba442a9b36\MSVCR80.dll ModLoad: 75a30000 75ab4000 C:\Windows\system32\CLBCatQ.DLL ModLoad: 728a0000 728d0000 C:\Windows\system32\mlang.dll ModLoad: 6c7d0000 6c801000 C:\Windows\system32\inetsrv\iiscore.dll ModLoad: 71fd0000 71fd7000 c:\windows\system32\inetsrv\W3TP.dll ModLoad: 74480000 74489000 c:\windows\system32\inetsrv\w3dt.dll ModLoad: 71fb0000 71fbb000 C:\Windows\system32\HTTPAPI.dll ModLoad: 752f0000 7532a000 C:\Windows\system32\slc.dll ModLoad: 6cad0000 6caf8000 C:\Windows\system32\faultrep.dll ModLoad: 75050000 75058000 C:\Windows\system32\VERSION.dll ModLoad: 74b80000 74b8f000 C:\Windows\system32\NLAapi.dll ModLoad: 75290000 752a9000 C:\Windows\system32\IPHLPAPI.DLL ModLoad: 75250000 75285000 C:\Windows\system32\dhcpcsvc.DLL ModLoad: 754d0000 754fc000 C:\Windows\system32\DNSAPI.dll ModLoad: 75240000 75247000 C:\Windows\system32\WINNSI.DLL ModLoad: 75210000 75231000 C:\Windows\system32\dhcpcsvc6.DLL ModLoad: 750b0000 750eb000 C:\Windows\System32\mswsock.dll ModLoad: 73920000 73928000 C:\Windows\System32\winrnr.dll ModLoad: 73720000 7372f000 C:\Windows\system32\napinsp.dll ModLoad: 74d00000 74d05000 C:\Windows\System32\wshtcpip.dll ModLoad: 75140000 75145000 C:\Windows\System32\wship6.dll ModLoad: 73910000 73916000 C:\Windows\system32\rasadhlp.dll ModLoad: 6ca00000 6ca06000 C:\Windows\System32\inetsrv\cachuri.dll ModLoad: 6c9f0000 6c9f8000 C:\Windows\System32\inetsrv\cachfile.dll ModLoad: 6c9e0000 6c9e6000 C:\Windows\System32\inetsrv\cachtokn.dll ModLoad: 6c9d0000 6c9de000 C:\Windows\System32\inetsrv\cachhttp.dll ModLoad: 6c960000 6c96e000 C:\Windows\System32\inetsrv\compstat.dll ModLoad: 6c930000 6c938000 C:\Windows\System32\inetsrv\defdoc.dll ModLoad: 6c910000 6c919000 C:\Windows\System32\inetsrv\dirlist.dll ModLoad: 6c6b0000 6c6b8000 C:\Windows\System32\inetsrv\protsup.dll ModLoad: 6c6a0000 6c6ad000 C:\Windows\System32\inetsrv\static.dll ModLoad: 6c690000 6c69b000 C:\Windows\System32\inetsrv\authanon.dll ModLoad: 6c680000 6c68b000 C:\Windows\System32\inetsrv\authbas.dll ModLoad: 6c630000 6c63e000 C:\Windows\System32\inetsrv\authsspi.dll ModLoad: 755b0000 75625000 C:\Windows\system32\NETAPI32.dll ModLoad: 6c620000 6c62b000 C:\Windows\System32\inetsrv\modrqflt.dll ModLoad: 6c610000 6c61d000 C:\Windows\System32\inetsrv\custerr.dll ModLoad: 6c5c0000 6c5c8000 C:\Windows\System32\inetsrv\loghttp.dll ModLoad: 6c330000 6c337000 C:\Windows\System32\inetsrv\iisreqs.dll ModLoad: 728f0000 728f7000 C:\Windows\system32\WSOCK32.dll ModLoad: 6c1f0000 6c20e000 C:\Windows\System32\inetsrv\isapi.dll ModLoad: 6c000000 6c011000 C:\Windows\System32\inetsrv\filter.dll ModLoad: 6c320000 6c328000 C:\Windows\System32\inetsrv\validcfg.dll ModLoad: 6a2a0000 6a30d000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\webengine.dll ModLoad: 60060000 60067000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\aspnet_filter.dll ModLoad: 6c310000 6c319000 C:\Windows\system32\inetsrv\wbhst_pm.dll ModLoad: 765b0000 770c0000 C:\Windows\system32\shell32.dll ModLoad: 70d10000 71807000 C:\Windows\assembly\NativeImages_v2.0.50727_32\mscorlib\17f572b09facdc5fda9431558eb7a26e\mscorlib.ni.dll ModLoad: 70580000 70d05000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System\52e1ea3c7491e05cda766d7b3ce3d559\System.ni.dll ModLoad: 03990000 044d3000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Web\96071d36e4d44ebb31a3b46f08fdc732\System.Web.ni.dll ModLoad: 75770000 757cf000 C:\Windows\system32\sxs.dll ModLoad: 72ac0000 72bb1000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Configuration\e6001d416f7c468334934a2c6a41c631\System.Configuration.ni.dll ModLoad: 71890000 71dc6000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Xml\7208ffa39630e9b923331f9df0947a12\System.Xml.ni.dll ModLoad: 66580000 667bc000 C:\Windows\assembly\NativeImages_v2.0.50727_32\Microsoft.JScript\1543943b86269c9bebd5cf7a3fe7f55b\Microsoft.JScript.ni.dll ModLoad: 74460000 74468000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\App_global.asax.cyzjkxpg.dll ModLoad: 65d20000 65e7c000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\10097bf6\5f9a08ec_fffcca01\PatronAccess.DLL ModLoad: 72030000 7208b000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\mscorjit.dll ModLoad: 68ab0000 68bca000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Web.Extensio#\3b4cb090536bf6b0dfae8cefaeeadb9f\System.Web.Extensions.ni.dll ModLoad: 64020000 64033000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\mscorsec.dll ModLoad: 73c40000 73c6d000 C:\Windows\system32\WINTRUST.dll ModLoad: 774b0000 774d9000 C:\Windows\system32\imagehlp.dll ModLoad: 73690000 73715000 C:\Windows\WinSxS\x86_microsoft.windows.common-controls_6595b64144ccf1df_5.82.6001.18000_none_886786f450a74a05\COMCTL32.dll ModLoad: 75170000 751a5000 C:\Windows\system32\ncrypt.dll ModLoad: 751b0000 751f5000 C:\Windows\system32\BCRYPT.dll ModLoad: 74d90000 74da5000 C:\Windows\system32\GPAPI.dll ModLoad: 73520000 7353b000 C:\Windows\system32\cryptnet.dll ModLoad: 73440000 73446000 C:\Windows\system32\SensApi.dll ModLoad: 73a50000 73a65000 C:\Windows\system32\Cabinet.dll ModLoad: 6ae30000 6ae3a000 C:\Windows\system32\inetsrv\gzip.dll ModLoad: 69e50000 69e6a000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\App_Web_kal6czmb.dll ModLoad: 69e10000 69e3c000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\App_Web_b1efcjqz.dll ModLoad: 69bd0000 69c26000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\e8a04837\0093847c_5153ca01\Infragistics2.WebUI.UltraWebTab.v9.2.DLL ModLoad: 5e480000 5e95e000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\719ff0ee\00c37169_5153ca01\Infragistics2.Web.v9.2.DLL ModLoad: 67c90000 67d1a000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\ba3b912a\00d19870_5153ca01\Infragistics2.WebUI.Shared.v9.2.DLL ModLoad: 656a0000 6587a000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\6470a692\14d22a05_ef2ac901\AjaxControlToolkit.DLL ModLoad: 66960000 66ae8000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Drawing\6312464f64727a2a50d5ce3fd73ad1bb\System.Drawing.ni.dll ModLoad: 6e690000 6ece3000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Data\813556b5a2722045b0ea14467fd00227\System.Data.ni.dll ModLoad: 64e70000 65144000 C:\Windows\assembly\GAC_32\System.Data\2.0.0.0__b77a5c561934e089\System.Data.dll ModLoad: 69c70000 69ca2000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\App_Web_zwtn5a73.dll ModLoad: 69e70000 69e8e000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\App_Web_qijxg7dv.dll ModLoad: 645a0000 647bf000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Web.Mobile\b472cb382c17ffc3cb1a91ce12d90bf1\System.Web.Mobile.ni.dll ModLoad: 69c30000 69c66000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Web.RegularE#\e6b57c0506ec849c6706cb5617ad7372\System.Web.RegularExpressions.ni.dll ModLoad: 6c300000 6c30a000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\App_Web__hyepzhd.dll ModLoad: 69e00000 69e08000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\5ef208f7\b68a494a_e840c901\SessionTimeoutControl.DLL ModLoad: 69d50000 69d5c000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\619d48f7\0f695f01_fdfcca01\AgNetDataPro.DLL ModLoad: 69cd0000 69ce8000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\dc1703ed\00e1c635_caeaca01\xfnlnet.DLL ModLoad: 73d50000 73efb000 C:\Windows\WinSxS\x86_microsoft.windows.gdiplus_6595b64144ccf1df_1.0.6001.18175_none_9e7bbe54c9c04bca\gdiplus.dll (16cc.14e0): Break instruction exception - code 80000003 (first chance) eax=7ffa6000 ebx=00000000 ecx=00000000 edx=7740d094 esi=00000000 edi=00000000 eip=773c7dfe esp=051ff774 ebp=051ff7a0 iopl=0 nv up ei pl zr na pe nc cs=001b ss=0023 ds=0023 es=0023 fs=003b gs=0000 efl=00000246 ntdll!DbgBreakPoint: 773c7dfe cc int 3 0:021 g (16cc.1454): Access violation - code c0000005 (first chance) First chance exceptions are reported before any exception handling. This exception may be expected and handled. eax=00000000 ebx=00000479 ecx=00000000 edx=019d21f8 esi=019d1f18 edi=019ba74c eip=013849ed esp=0499ea44 ebp=0499f15c iopl=0 nv up ei pl zr na pe nc cs=001b ss=0023 ds=0023 es=0023 fs=003b gs=0000 efl=00010246 013849ed 8b01 mov eax,dword ptr [ecx] ds:0023:00000000=???????? 0:018 g ModLoad: 65890000 65a55000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Web.Services\2fa835ce2dcace4fc7c0009f102efc79\System.Web.Services.ni.dll ModLoad: 6f2b0000 6f34d000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.EnterpriseSe#\ae383808b3f5ee9287358378f9a2cad3\System.EnterpriseServices.ni.dll ModLoad: 10000000 10020000 System.EnterpriseServices.Wrapper.dll ModLoad: 00e50000 00e70000 System.EnterpriseServices.Wrapper.dll ModLoad: 66da0000 66de8000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.EnterpriseSe#\ae383808b3f5ee9287358378f9a2cad3\System.EnterpriseServices.Wrapper.dll ModLoad: 10000000 10020000 C:\Windows\assembly\GAC_32\System.EnterpriseServices\2.0.0.0__b03f5f7f11d50a3a\System.EnterpriseServices.Wrapper.dll ModLoad: 6ab40000 6ab4c000 image6ab40000 ModLoad: 04950000 0495c000 image04950000 ModLoad: 049a0000 049c0000 image049a0000 ModLoad: 049d0000 049f0000 image049d0000 ModLoad: 049a0000 049c0000 image049a0000 ModLoad: 04a40000 04a60000 image04a40000 ModLoad: 049a0000 049c0000 image049a0000 ModLoad: 04a40000 04a60000 image04a40000 ModLoad: 049a0000 049c0000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\da3b70a0\00e9280f_c1f4c201\ICSharpCode.SharpZipLib.DLL ModLoad: 5eb40000 5f01e000 Infragistics2.Web.v9.2.dll ModLoad: 05a00000 05ede000 Infragistics2.Web.v9.2.dll ModLoad: 694d0000 694fa000 image694d0000 ModLoad: 049d0000 049fa000 image049d0000 ModLoad: 68cc0000 68cea000 image68cc0000 ModLoad: 04e40000 04e6a000 image04e40000 ModLoad: 69470000 6949a000 image69470000 ModLoad: 04e40000 04e6a000 image04e40000 ModLoad: 69470000 6949a000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\f77351ae\00582c74_5153ca01\Infragistics2.WebUI.Misc.v9.2.DLL ModLoad: 67d20000 67daa000 image67d20000 ModLoad: 04e70000 04efa000 image04e70000 ModLoad: 643e0000 64598000 Infragistics2.WebUI.UltraWebChart.v9.2.dll ModLoad: 05a00000 05bb8000 Infragistics2.WebUI.UltraWebChart.v9.2.dll ModLoad: 63ac0000 63c78000 Infragistics2.WebUI.UltraWebChart.v9.2.dll ModLoad: 05bc0000 05d78000 Infragistics2.WebUI.UltraWebChart.v9.2.dll ModLoad: 63900000 63ab8000 Infragistics2.WebUI.UltraWebChart.v9.2.dll ModLoad: 05bc0000 05d78000 Infragistics2.WebUI.UltraWebChart.v9.2.dll ModLoad: 63900000 63ab8000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\9acf477c\0030eeb6_5153ca01\Infragistics2.WebUI.UltraWebChart.v9.2.DLL ModLoad: 60570000 607b6000 image60570000 ModLoad: 05d80000 05fc6000 image05d80000 ModLoad: 64350000 64596000 image64350000 ModLoad: 05fd0000 06216000 image05fd0000 ModLoad: 5edd0000 5f016000 image5edd0000 ModLoad: 05fd0000 06216000 image05fd0000 ModLoad: 5edd0000 5f016000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\30e4a2ff\00dfbf77_5153ca01\Infragistics2.WebUI.UltraWebGrid.v9.2.DLL ModLoad: 67d50000 67da6000 image67d50000 ModLoad: 04e70000 04ec6000 image04e70000 ModLoad: 68cb0000 68ce4000 image68cb0000 ModLoad: 04e70000 04ea4000 image04e70000 ModLoad: 68790000 687c4000 image68790000 ModLoad: 04eb0000 04ee4000 image04eb0000 ModLoad: 688f0000 68924000 image688f0000 ModLoad: 04eb0000 04ee4000 image04eb0000 ModLoad: 688f0000 68924000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\2420cb22\00a1ab83_5153ca01\Infragistics2.WebUI.WebCombo.v9.2.DLL ModLoad: 66d50000 66da0000 image66d50000 ModLoad: 04f80000 04fd0000 image04f80000 ModLoad: 67d60000 67db0000 image67d60000 ModLoad: 05a00000 05a50000 image05a00000 ModLoad: 66d00000 66d50000 image66d00000 ModLoad: 05a00000 05a50000 image05a00000 ModLoad: 66d00000 66d50000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\6ceab935\00b28e76_5153ca01\Infragistics2.WebUI.WebDataInput.v9.2.DLL ModLoad: 11000000 1112e000 image11000000 ModLoad: 05a50000 05b7e000 image05a50000 ModLoad: 11000000 1112e000 image11000000 ModLoad: 05d80000 05eae000 image05d80000 ModLoad: 11000000 1112e000 image11000000 ModLoad: 05d80000 05eae000 image05d80000 ModLoad: 11000000 1112e000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\e99fdd05\00c79c09_d868c301\itextsharp.DLL ModLoad: 04df0000 04dfe000 LinkPointAPI-cs.dll ModLoad: 04e70000 04e7e000 LinkPointAPI-cs.dll ModLoad: 04df0000 04dfe000 LinkPointAPI-cs.dll ModLoad: 04e80000 04e8e000 LinkPointAPI-cs.dll ModLoad: 04df0000 04dfe000 LinkPointAPI-cs.dll ModLoad: 04e80000 04e8e000 LinkPointAPI-cs.dll ModLoad: 04df0000 04dfe000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\0e724536\00922343_54dfc701\LinkPointAPI-cs.DLL ModLoad: 04e70000 04e78000 image04e70000 ModLoad: 04e90000 04e98000 image04e90000 ModLoad: 04e70000 04e78000 image04e70000 ModLoad: 04ea0000 04ea8000 image04ea0000 ModLoad: 04e70000 04e78000 image04e70000 ModLoad: 04ea0000 04ea8000 image04ea0000 ModLoad: 04e70000 04e78000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\859797c4\00eb5fc5_bed8c401\LinkPointTransaction.DLL ModLoad: 65e80000 65fdc000 PatronAccess.dll ModLoad: 05a50000 05bac000 PatronAccess.dll ModLoad: 6ab40000 6ab48000 SessionTimeoutControl.dll ModLoad: 04e90000 04e98000 SessionTimeoutControl.dll ModLoad: 6ab80000 6ab8e000 WebServices.dll ModLoad: 04e90000 04e9e000 WebServices.dll ModLoad: 6ab40000 6ab4e000 WebServices.dll ModLoad: 04ef0000 04efe000 WebServices.dll ModLoad: 69d40000 69d4e000 WebServices.dll ModLoad: 04ef0000 04efe000 WebServices.dll ModLoad: 69d40000 69d4e000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\21555aa5\5f498093_fefcca01\WebServices.DLL ModLoad: 694e0000 694f8000 image694e0000 ModLoad: 04f80000 04f98000 image04f80000 ModLoad: 661c0000 6624e000 System.ServiceModel.Web.dll ModLoad: 05a50000 05ade000 System.ServiceModel.Web.dll ModLoad: 5d850000 5ddfc000 System.ServiceModel.dll ModLoad: 06220000 067cc000 System.ServiceModel.dll ModLoad: 65ef0000 65fe0000 System.Runtime.Serialization.dll ModLoad: 05eb0000 05fa0000 System.Runtime.Serialization.dll ModLoad: 694e0000 694fe000 SMDiagnostics.dll ModLoad: 04f80000 04f9e000 SMDiagnostics.dll ModLoad: 65be0000 65d1c000 System.Web.Extensions.dll ModLoad: 067d0000 0690c000 System.Web.Extensions.dll ModLoad: 67d40000 67dac000 System.IdentityModel.dll ModLoad: 05ae0000 05b4c000 System.IdentityModel.dll ModLoad: 687a0000 687c2000 System.IdentityModel.Selectors.dll ModLoad: 04fa0000 04fc2000 System.IdentityModel.Selectors.dll ModLoad: 66c90000 66cf4000 Microsoft.Transactions.Bridge.dll ModLoad: 05b50000 05bb4000 Microsoft.Transactions.Bridge.dll ModLoad: 69130000 69146000 System.Web.Abstractions.dll ModLoad: 051b0000 051c6000 System.Web.Abstractions.dll ModLoad: 65150000 651f6000 System.Core.dll ModLoad: 06910000 069b6000 System.Core.dll ModLoad: 64440000 644ea000 System.Data.Linq.dll ModLoad: 069c0000 06a6a000 System.Data.Linq.dll ModLoad: 66d50000 66d9c000 System.Data.Services.Client.dll ModLoad: 06a70000 06abc000 System.Data.Services.Client.dll ModLoad: 68cd0000 68cf0000 System.Data.Services.Design.dll ModLoad: 05210000 05230000 System.Data.Services.Design.dll ModLoad: 5eb00000 5edc2000 System.Data.Entity.dll ModLoad: 06ac0000 06d82000 System.Data.Entity.dll ModLoad: 66af0000 66b16000 System.Xml.Linq.dll ModLoad: 05fa0000 05fc6000 System.Xml.Linq.dll ModLoad: 661c0000 6624e000 C:\Windows\assembly\GAC_MSIL\System.ServiceModel.Web\3.5.0.0__31bf3856ad364e35\System.ServiceModel.Web.dll ModLoad: 64520000 6459e000 System.WorkflowServices.dll ModLoad: 06d90000 06e0e000 System.WorkflowServices.dll ModLoad: 63af0000 63c80000 System.Workflow.ComponentModel.dll ModLoad: 06e10000 06fa0000 System.Workflow.ComponentModel.dll ModLoad: 64320000 6443a000 System.Workflow.Activities.dll ModLoad: 06fa0000 070ba000 System.Workflow.Activities.dll ModLoad: 62cf0000 62d78000 System.Workflow.Runtime.dll ModLoad: 070c0000 07148000 System.Workflow.Runtime.dll ModLoad: 68cb0000 68cc6000 Microsoft.Build.Utilities.dll ModLoad: 07150000 07166000 Microsoft.Build.Utilities.dll ModLoad: 6ab80000 6ab8c000 Microsoft.Build.Framework.dll ModLoad: 05230000 0523c000 Microsoft.Build.Framework.dll ModLoad: 07170000 07214000 Microsoft.Build.Tasks.dll ModLoad: 07220000 072c4000 Microsoft.Build.Tasks.dll ModLoad: 64520000 6459e000 C:\Windows\assembly\GAC_MSIL\System.WorkflowServices\3.5.0.0__31bf3856ad364e35\System.WorkflowServices.dll ModLoad: 5d610000 5d84e000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Runtime.Seri#\a33b3b88fd575b703ba4212c677880ae\System.Runtime.Serialization.ni.dll ModLoad: 605a0000 606a6000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.IdentityModel\3bfbe737873becead614d1504e7d5684\System.IdentityModel.ni.dll ModLoad: 5ab70000 5bbf7000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.ServiceModel\7115815b53ec561932345e16fbeea968\System.ServiceModel.ni.dll ModLoad: 61440000 6201e000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Windows.Forms\1941d7639299344ae28fb6b23da65247\System.Windows.Forms.ni.dll ModLoad: 5d190000 5d3c4000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Core\a0522cb280c09b3441e1889502ca145a\System.Core.ni.dll ModLoad: 60a00000 61433000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Design\d3fa02f8a34329c8b84c004afaea7054\System.Design.ni.dll (16cc.1454): CLR exception - code e0434f4d (first chance) (16cc.1454): Access violation - code c0000005 (first chance) First chance exceptions are reported before any exception handling. This exception may be expected and handled. eax=00000000 ebx=01776038 ecx=00000000 edx=00000000 esi=017ff314 edi=018907f8 eip=071a62fc esp=0499ee88 ebp=0499eef4 iopl=0 nv up ei pl zr na pe nc cs=001b ss=0023 ds=0023 es=0023 fs=003b gs=0000 efl=00010246 071a62fc 8b01 mov eax,dword ptr [ecx] ds:0023:00000000=???????? 0:018 g (16cc.1454): CLR exception - code e0434f4d (first chance) (16cc.1454): Access violation - code c0000005 (first chance) First chance exceptions are reported before any exception handling. This exception may be expected and handled. eax=00000000 ebx=01776038 ecx=00000000 edx=00000000 esi=017ff200 edi=0186ed04 eip=071a62fc esp=0499ee88 ebp=0499eef4 iopl=0 nv up ei pl zr na pe nc cs=001b ss=0023 ds=0023 es=0023 fs=003b gs=0000 efl=00010246 071a62fc 8b01 mov eax,dword ptr [ecx] ds:0023:00000000=???????? 0:018 g (16cc.1358): Access violation - code c0000005 (first chance) First chance exceptions are reported before any exception handling. This exception may be expected and handled. eax=00000000 ebx=01776038 ecx=00000000 edx=00000000 esi=017ff200 edi=01858380 eip=071a62fc esp=0742ee98 ebp=0742ef04 iopl=0 nv up ei pl zr na pe nc cs=001b ss=0023 ds=0023 es=0023 fs=003b gs=0000 efl=00010246 071a62fc 8b01 mov eax,dword ptr [ecx] ds:0023:00000000=???????? 0:020 g (16cc.1358): Access violation - code c0000005 (first chance) First chance exceptions are reported before any exception handling. This exception may be expected and handled. eax=00000000 ebx=017758a4 ecx=00000000 edx=00000000 esi=017fd078 edi=018b6afc eip=071a62fc esp=0742ee98 ebp=0742ef04 iopl=0 nv up ei pl zr na pe nc cs=001b ss=0023 ds=0023 es=0023 fs=003b gs=0000 efl=00010246 071a62fc 8b01 mov eax,dword ptr [ecx] ds:0023:00000000=???????? 0:020 g (16cc.1358): Stack overflow - code c00000fd (first chance) First chance exceptions are reported before any exception handling. This exception may be expected and handled. eax=00000000 ebx=020504b4 ecx=000001d1 edx=0000001b esi=020503d4 edi=073f2998 eip=6eaf0ed3 esp=073f2980 ebp=073f30ec iopl=0 nv up ei pl zr na pe nc cs=001b ss=0023 ds=0023 es=0023 fs=003b gs=0000 efl=00010246 * WARNING: Unable to verify checksum for C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Data\813556b5a2722045b0ea14467fd00227\System.Data.ni.dll System_Data_ni!_bidW103 (System_Data_ni+0x460ed3): 6eaf0ed3 f3ab rep stos dword ptr es:[edi] Any help would be appricated.

    Read the article

  • Windows 7 system drive says it is raw, but System Recovery starts without issues

    - by iulianchira
    I have been running Windows 7 RC1 since it was available a couple of months ago and had no issues whatsoever until today. When I start my laptop, Windows does not boot but instead Windows System Recovery starts. I've used diskpart to list the partitions on the drive and my system partition (c:) has a RAW filesystem. I really need to save all data on the disk as fast as I cant and I would really like not to have to reinstall my system.

    Read the article

  • Windows 7 system drive says it is raw, but System Recovery starts without issues

    - by Iulian Chira
    I have been running Windows 7 RC1 since it was available a couple of months ago and had no issues whatsoever until today. When I start my laptop, Windows does not boot but instead Windows System Recovery starts. I've used diskpart to list the partitions on the drive and my system partition (c:) has a RAW filesystem. I really need to save all data on the disk as fast as I cant and I would really like not to have to reinstall my system.

    Read the article

  • High system cpu load (%sys), system locks

    - by Mark
    For the last two weeks we are having intermittent severe spikes in system cpu usage (shown as %sys), which last for maybe half a minute, locking most processes, including ssh. I've been trying to figure this out, but atop doesn't show anything relevant (system usage for processes it shows is insignificant), spikes are intermittent and I could not reproduce the spike using any workload for the web application this webserver hosts. If you have any ideas on how to debug high %sys and (sometimes) %si CPU usage, please share them. System specs (don't know if any of this is relevant): Dedicated server, CentOS 6, core i7 950, consistent 4 to 8 GB RAM free at any time, hard drives are in RAID-1. Additional info: dmesg output doesn't change between spikes /var/log/messages doesn't change between spikes Here is cat /proc/vmstat Here is output of mpstat 1 during a typical spike Add 07.11.11: looks like simple reboot restored system state, and we might never know what caused the disturbance in first place.

    Read the article

  • AdvancedFormatProvider: Making string.format do more

    - by plblum
    When I have an integer that I want to format within the String.Format() and ToString(format) methods, I’m always forgetting the format symbol to use with it. That’s probably because its not very intuitive. Use {0:N0} if you want it with group (thousands) separators. text = String.Format("{0:N0}", 1000); // returns "1,000"   int value1 = 1000; text = value1.ToString("N0"); Use {0:D} or {0:G} if you want it without group separators. text = String.Format("{0:D}", 1000); // returns "1000"   int value2 = 1000; text2 = value2.ToString("D"); The {0:D} is especially confusing because Microsoft gives the token the name “Decimal”. I thought it reasonable to have a new format symbol for String.Format, "I" for integer, and the ability to tell it whether it shows the group separators. Along the same lines, why not expand the format symbols for currency ({0:C}) and percent ({0:P}) to let you omit the currency or percent symbol, omit the group separator, and even to drop the decimal part when the value is equal to the whole number? My solution is an open source project called AdvancedFormatProvider, a group of classes that provide the new format symbols, continue to support the rest of the native symbols and makes it easy to plug in additional format symbols. Please visit https://github.com/plblum/AdvancedFormatProvider to learn about it in detail and explore how its implemented. The rest of this post will explore some of the concepts it takes to expand String.Format() and ToString(format). AdvancedFormatProvider benefits: Supports {0:I} token for integers. It offers the {0:I-,} option to omit the group separator. Supports {0:C} token with several options. {0:C-$} omits the currency symbol. {0:C-,} omits group separators, and {0:C-0} hides the decimal part when the value would show “.00”. For example, 1000.0 becomes “$1000” while 1000.12 becomes “$1000.12”. Supports {0:P} token with several options. {0:P-%} omits the percent symbol. {0:P-,} omits group separators, and {0:P-0} hides the decimal part when the value would show “.00”. For example, 1 becomes “100 %” while 1.1223 becomes “112.23 %”. Provides a plug in framework that lets you create new formatters to handle specific format symbols. You register them globally so you can just pass the AdvancedFormatProvider object into String.Format and ToString(format) without having to figure out which plug ins to add. text = String.Format(AdvancedFormatProvider.Current, "{0:I}", 1000); // returns "1,000" text2 = String.Format(AdvancedFormatProvider.Current, "{0:I-,}", 1000); // returns "1000" text3 = String.Format(AdvancedFormatProvider.Current, "{0:C-$-,}", 1000.0); // returns "1000.00" The IFormatProvider parameter Microsoft has made String.Format() and ToString(format) format expandable. They each take an additional parameter that takes an object that implements System.IFormatProvider. This interface has a single member, the GetFormat() method, which returns an object that knows how to convert the format symbol and value into the desired string. There are already a number of web-based resources to teach you about IFormatProvider and the companion interface ICustomFormatter. I’ll defer to them if you want to dig more into the topic. The only thing I want to point out is what I think are implementation considerations. Why GetFormat() always tests for ICustomFormatter When you see examples of implementing IFormatProviders, the GetFormat() method always tests the parameter against the ICustomFormatter type. Why is that? public object GetFormat(Type formatType) { if (formatType == typeof(ICustomFormatter)) return this; else return null; } The value of formatType is already predetermined by the .net framework. String.Format() uses the StringBuilder.AppendFormat() method to parse the string, extracting the tokens and calling GetFormat() with the ICustomFormatter type. (The .net framework also calls GetFormat() with the types of System.Globalization.NumberFormatInfo and System.Globalization.DateTimeFormatInfo but these are exclusive to how the System.Globalization.CultureInfo class handles its implementation of IFormatProvider.) Your code replaces instead of expands I would have expected the caller to pass in the format string to GetFormat() to allow your code to determine if it handles the request. My vision would be to return null when the format string is not supported. The caller would iterate through IFormatProviders until it finds one that handles the format string. Unfortunatley that is not the case. The reason you write GetFormat() as above is because the caller is expecting an object that handles all formatting cases. You are effectively supposed to write enough code in your formatter to handle your new cases and call .net functions (like String.Format() and ToString(format)) to handle the original cases. Its not hard to support the native functions from within your ICustomFormatter.Format function. Just test the format string to see if it applies to you. If not, call String.Format() with a token using the format passed in. public string Format(string format, object arg, IFormatProvider formatProvider) { if (format.StartsWith("I")) { // handle "I" formatter } else return String.Format(formatProvider, "{0:" + format + "}", arg); } Formatters are only used by explicit request Each time you write a custom formatter (implementer of ICustomFormatter), it is not used unless you explicitly passed an IFormatProvider object that supports your formatter into String.Format() or ToString(). This has several disadvantages: Suppose you have several ICustomFormatters. In order to have all available to String.Format() and ToString(format), you have to merge their code and create an IFormatProvider to return an instance of your new class. You have to remember to utilize the IFormatProvider parameter. Its easy to overlook, especially when you have existing code that calls String.Format() without using it. Some APIs may call String.Format() themselves. If those APIs do not offer an IFormatProvider parameter, your ICustomFormatter will not be available to them. The AdvancedFormatProvider solves the first two of these problems by providing a plug-in architecture.

    Read the article

  • How To Create Your Own x86 Operating System for Modern PC Computers

    - by mudge
    I'd like to create a new operating system for x86 PC computers. I'd like it to be 64-bit but possibly run as 32-bit as well. I have these kinds of questions: What kinds of things do you start working on first? Knowing where to start in writing your own operating system seems to me to be a tricky subject, so I am interested in your input. Generally how to go about making your own 32-bit/64-bit operating system, or good resources that mention useful information about going about writing your own operating system for x86 computers. I don't care how old sources are as long as they are still relevant and useful to what I am doing. I know that I will want it to have kernel drivers that access peripheral hardware directly. Where should I look for advice and documentation for programming and understanding the interface to peripheral hardware the operating system will communicate with? I will need to understand how the operating system will receive input and interact with keyboards, mice, computer monitors, hard drives, USB, etc. etc. This is probably the area I know least about. I have the Intel instruction set manuals and have been getting more familiar with assembly programming, so the CPU side of things is what I know the most about. At this point I'm thinking that I'd like to implement the Linux system calls within my operating system so that programs that run on Linux can run on my operating system. I want my operating system to use the ELF binary format. I wonder what obstacles I have to overcome to achieve this Linux compatibility. Are the main things implementing the system calls that Linux provides, and using the ELF format? What else? I am also interested in people's thoughts about why it might not be a good idea to make your own operating system, and why it is a good idea to make your own operating system. Thank you for any input.

    Read the article

  • loading xml into SQL Server 2008 using sqlbulkload component

    - by mohamed
    "Error: Schema: relationship expected on 'headerRecord'." I get the above error while load xml file to SQL Server 2008 using SQLXMLBulkLoad4 Component , the xml file contains Call Detail records, I have generated schema file from xml file using both , Dataset and XSD.exe tool, but the error remains same., if there is another way to imports xml file with multiple tables that have relationship in each file into SQL Server 2008? . Here the xml file: <CallEventDataFile> <headerRecord> <productionDateTime>0912021247482B0300</productionDateTime> <recordingEntity>00</recordingEntity> <extensions/> </headerRecord> <callEventRecords> <mtSMSRecord> <recordType>7</recordType> <serviceCentre>91521230</serviceCentre> <servedIMSI>36570000031728F2</servedIMSI> <servedIMEI>53886000707896F0</servedIMEI> <servedMSISDN>915212454503F2</servedMSISDN> <msClassmark>3319A1</msClassmark> <recordingEntity>915212110100</recordingEntity> <location> <locationAreaCode>0006</locationAreaCode> <cellIdentifier>0C6E</cellIdentifier> </location> <deliveryTime>0912021535412B0300</deliveryTime> <systemType> <gERAN/> </systemType> <basicService> <teleservice>21</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <chargedParty> <calledParty/> </chargedParty> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F70500060C6E</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <smsUserDataType>FF</smsUserDataType> <origination>8191F2</origination> <callReference>1605EB2FE1</callReference> </mtSMSRecord> <moSMSRecord> <recordType>6</recordType> <servedIMSI>36570000238707F9</servedIMSI> <servedIMEI>53928320195925F0</servedIMEI> <servedMSISDN>915212159430F2</servedMSISDN> <msClassmark>3319A2</msClassmark> <serviceCentre>91521230</serviceCentre> <recordingEntity>915212110100</recordingEntity> <location> <locationAreaCode>001B</locationAreaCode> <cellIdentifier>6983</cellIdentifier> </location> <messageReference>01</messageReference> <originationTime>0912021535412B0300</originationTime> <destinationNumber>8111F1</destinationNumber> <systemType> <gERAN/> </systemType> <basicService> <teleservice>22</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <chargedParty> <callingParty/> </chargedParty> <orgRNCorBSCId>8F1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F705001B6983</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <smsUserDataType>FF</smsUserDataType> <callReference>1701BED4FF</callReference> </moSMSRecord> <ssActionRecord> <recordType>10</recordType> <servedIMSI>36570000636448F8</servedIMSI> <servedIMEI>53246030714961F0</servedIMEI> <servedMSISDN>915212056928F8</servedMSISDN> <msClassmark>3018A1</msClassmark> <recordingEntity>915212110100</recordingEntity> <location> <locationAreaCode>000C</locationAreaCode> <cellIdentifier>05A5</cellIdentifier> </location> <supplService>FF</supplService> <ssAction> <ussdInvocation/> </ssAction> <ssActionTime>0912021535412B0300</ssActionTime> <ssParameters> <unstructuredData>AA5C2E3702</unstructuredData> </ssParameters> <callReference>1701BED500</callReference> <systemType> <gERAN/> </systemType> <ussdCodingScheme>0F</ussdCodingScheme> <ussdString> <UssdString>AA5C2E3702</UssdString> </ussdString> <ussdRequestCounter>1</ussdRequestCounter> <additionalChgInfo> <chargeIndicator>1</chargeIndicator> </additionalChgInfo> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F705000C05A5</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> </ssActionRecord> <moCallRecord> <recordType>0</recordType> <servedIMSI>36570000807501F5</servedIMSI> <servedIMEI>53246030713955F0</servedIMEI> <servedMSISDN>915212157901F0</servedMSISDN> <callingNumber>A151911700</callingNumber> <calledNumber>8151677589</calledNumber> <roamingNumber>A111113850</roamingNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscOutgoingROUTE> <location> <locationAreaCode>0006</locationAreaCode> <cellIdentifier>0C2F</cellIdentifier> </location> <basicService> <teleservice>11</teleservice> </basicService> <msClassmark>3319A1</msClassmark> <answerTime>0912021535382B0300</answerTime> <releaseTime>0912021535422B0300</releaseTime> <callDuration>4</callDuration> <radioChanRequested> <dualFullRatePreferred/> </radioChanRequested> <radioChanUsed> <halfRate/> </radioChanUsed> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>1701BED501</callReference> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <gsm-SCFAddress>915212110130</gsm-SCFAddress> <serviceKey>1</serviceKey> <networkCallReference>171D555132</networkCallReference> <mSCAddress>915212110100</mSCAddress> <speechVersionSupported>25</speechVersionSupported> <speechVersionUsed>21</speechVersionUsed> <numberOfDPEncountered>3</numberOfDPEncountered> <levelOfCAMELService>01</levelOfCAMELService> <freeFormatData>800130</freeFormatData> <systemType> <gERAN/> </systemType> <classmark3>C000</classmark3> <chargedParty> <callingParty/> </chargedParty> <mscOutgoingCircuit>1051</mscOutgoingCircuit> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <calledIMSI>36570000635618F8</calledIMSI> <globalAreaID>36F70500060C2F</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <lastmccmnc>36F705</lastmccmnc> </moCallRecord> <mtCallRecord> <recordType>1</recordType> <servedIMSI>36570000635618F8</servedIMSI> <servedIMEI>53464010474309F0</servedIMEI> <servedMSISDN>915212755697F8</servedMSISDN> <callingNumber>A151911700</callingNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscOutgoingROUTE> <location> <locationAreaCode>0006</locationAreaCode> <cellIdentifier>0C2D</cellIdentifier> </location> <basicService> <teleservice>11</teleservice> </basicService> <supplServicesUsed> <SuppServiceUsedid> <ssCode>11</ssCode> <ssTime>0912021535382B0300</ssTime> </SuppServiceUsedid> </supplServicesUsed> <msClassmark>331981</msClassmark> <answerTime>0912021535382B0300</answerTime> <releaseTime>0912021535422B0300</releaseTime> <callDuration>4</callDuration> <radioChanRequested> <dualFullRatePreferred/> </radioChanRequested> <radioChanUsed> <halfRate/> </radioChanUsed> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>1701BED502</callReference> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <networkCallReference>171D555132</networkCallReference> <mSCAddress>915212110100</mSCAddress> <speechVersionSupported>25</speechVersionSupported> <speechVersionUsed>21</speechVersionUsed> <systemType> <gERAN/> </systemType> <classmark3>C000</classmark3> <chargedParty> <calledParty/> </chargedParty> <roamingNumber>A111113850</roamingNumber> <mscIncomingCircuit>9119</mscIncomingCircuit> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F70500060C2D</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <lastmccmnc>36F705</lastmccmnc> </mtCallRecord> <incGatewayRecord> <recordType>3</recordType> <callingNumber>A17005991565</callingNumber> <calledNumber>A1853643F7</calledNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>ZPSTN</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>ZTEBSC3</rOUTEName> </mscOutgoingROUTE> <answerTime>0912021535302B0300</answerTime> <releaseTime>0912021535422B0300</releaseTime> <callDuration>12</callDuration> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>2203AFBF84</callReference> <basicService> <teleservice>11</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <roamingNumber>A111111980</roamingNumber> <mscIncomingCircuit>934</mscIncomingCircuit> <orgMSCId>921A</orgMSCId> <mscIncomingRouteAttribute> <isup/> </mscIncomingRouteAttribute> <networkCallReference>22432B5132</networkCallReference> </incGatewayRecord> <outGatewayRecord> <recordType>4</recordType> <callingNumber>A151012431</callingNumber> <calledNumber>817026936873</calledNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>HWBSC</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>ZPSTN</rOUTEName> </mscOutgoingROUTE> <answerTime>0912021535192B0300</answerTime> <releaseTime>0912021535432B0300</releaseTime> <callDuration>24</callDuration> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>2303B19880</callReference> <basicService> <teleservice>11</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <mscOutgoingCircuit>398</mscOutgoingCircuit> <orgMSCId>921A</orgMSCId> <mscOutgoingRouteAttribute> <isup/> </mscOutgoingRouteAttribute> <networkCallReference>238BE55132</networkCallReference> </outGatewayRecord> </callEventRecords> <trailerRecord> <productionDateTime>0912021247512B0300</productionDateTime> <recordingEntity>00</recordingEntity> <firstCallDateTime>000000000000000000</firstCallDateTime> <lastCallDateTime>000000000000000000</lastCallDateTime> <noOfRecords>521</noOfRecords> <extensions/> </trailerRecord> <extensions/> </CallEventDataFile> Schema File generated by Dataset: <?xml version="1.0" standalone="yes"?> <xs:schema id="NewDataSet" xmlns="" xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:msdata="urn:schemas-microsoft-com:xml-msdata"> <xs:element name="location"> <xs:complexType> <xs:sequence> <xs:element name="locationAreaCode" type="xs:string" minOccurs="0" /> <xs:element name="cellIdentifier" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="systemType"> <xs:complexType> <xs:sequence> <xs:element name="gERAN" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="basicService"> <xs:complexType> <xs:sequence> <xs:element name="teleservice" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="additionalChgInfo"> <xs:complexType> <xs:sequence> <xs:element name="chargeIndicator" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="chargedParty"> <xs:complexType> <xs:sequence> <xs:element name="calledParty" type="xs:string" minOccurs="0" /> <xs:element name="callingParty" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="mscIncomingROUTE"> <xs:complexType> <xs:sequence> <xs:element name="rOUTEName" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="mscOutgoingROUTE"> <xs:complexType> <xs:sequence> <xs:element name="rOUTEName" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="radioChanRequested"> <xs:complexType> <xs:sequence> <xs:element name="dualFullRatePreferred" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="radioChanUsed"> <xs:complexType> <xs:sequence> <xs:element name="halfRate" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="diagnostics"> <xs:complexType> <xs:sequence> <xs:element name="gsm0408Cause" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="CallEventDataFile"> <xs:complexType> <xs:sequence> <xs:element name="extensions" type="xs:string" minOccurs="0" /> <xs:element name="headerRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="productionDateTime" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="extensions" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="callEventRecords" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="mtSMSRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="serviceCentre" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="deliveryTime" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="smsUserDataType" type="xs:string" minOccurs="0" /> <xs:element name="origination" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="chargedParty" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="moSMSRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="serviceCentre" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="messageReference" type="xs:string" minOccurs="0" /> <xs:element name="originationTime" type="xs:string" minOccurs="0" /> <xs:element name="destinationNumber" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="smsUserDataType" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="chargedParty" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="ssActionRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="supplService" type="xs:string" minOccurs="0" /> <xs:element name="ssActionTime" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element name="ussdCodingScheme" type="xs:string" minOccurs="0" /> <xs:element name="ussdRequestCounter" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element name="ssAction" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="ussdInvocation" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="ssParameters" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="unstructuredData" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element name="ussdString" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="UssdString" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="moCallRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="callingNumber" type="xs:string" minOccurs="0" /> <xs:element name="calledNumber" type="xs:string" minOccurs="0" /> <xs:element name="roamingNumber" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="answerTime" type="xs:string" minOccurs="0" /> <xs:element name="releaseTime" type="xs:string" minOccurs="0" /> <xs:element name="callDuration" type="xs:string" minOccurs="0" /> <xs:element name="causeForTerm" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element name="gsm-SCFAddress" type="xs:string" minOccurs="0" /> <xs:element name="serviceKey" type="xs:string" minOccurs="0" /> <xs:element name="networkCallReference" type="xs:string" minOccurs="0" /> <xs:element name="mSCAddress" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionSupported" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionUsed" type="xs:string" minOccurs="0" /> <xs:element name="numberOfDPEncountered" type="xs:string" minOccurs="0" /> <xs:element name="levelOfCAMELService" type="xs:string" minOccurs="0" /> <xs:element name="freeFormatData" type="xs:string" minOccurs="0" /> <xs:element name="classmark3" type="xs:string" minOccurs="0" /> <xs:element name="mscOutgoingCircuit" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="calledIMSI" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="lastmccmnc" type="xs:string" minOccurs="0" /> <xs:element ref="mscIncomingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="mscOutgoingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="radioChanRequested" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="radioChanUsed" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="diagnostics" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="chargedParty" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="mtCallRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="callingNumber" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="answerTime" type="xs:string" minOccurs="0" /> <xs:element name="releaseTime" type="xs:string" minOccurs="0" /> <xs:element name="callDuration" type="xs:string" minOccurs="0" /> <xs:element name="causeForTerm" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element name="networkCallReference" type="xs:string" minOccurs="0" /> <xs:element name="mSCAddress" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionSupported" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionUsed" type="xs:string" minOccurs="0" /> <xs:element name="classmark3" type="xs:string" minOccurs="0" /> <xs:element name="roamingNumber" type="xs:string" minOccurs="0" /> <xs:element name="mscIncomingCircuit" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="lastmccmnc" type="xs:string" minOccurs="0" /> <xs:element ref="mscIncomingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="mscOutgoingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element name="supplServicesUsed" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="SuppServiceUsedid" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="ssCode" type="xs:string" minOccurs="0" /> <xs:element name="ssTime" type="xs:string" minOccurs="0" /> </xs:sequence>

    Read the article

  • How to restrict a content of string to less than 4MB and save that string in DB using C#

    - by Pranay B
    I'm working on a project where I need to get the Text data from pdf files and dump the whole text in a DB column. With the help of iTextsharp, I got the data and referred it String. But now I need to check whether the string exceeds the 4MB limit or not and if it is exceeding then accept the string data which is less than 4MB in size. This is my code: internal string ReadPdfFiles() { // variable to store file path string filePath = null; // open dialog box to select file OpenFileDialog file = new OpenFileDialog(); // dilog box title name file.Title = "Select Pdf File"; //files to be accepted by the user. file.Filter = "Pdf file (*.pdf)|*.pdf|All files (*.*)|*.*"; // set initial directory of computer system file.InitialDirectory = Environment.GetFolderPath(Environment.SpecialFolder.Desktop); // set restore directory file.RestoreDirectory = true; // execute if block when dialog result box click ok button if (file.ShowDialog() == DialogResult.OK) { // store selected file path filePath = file.FileName.ToString(); } //file path /// use a string array and pass all the pdf for searching //String filePath = @"D:\Pranay\Documentation\Working on SSAS.pdf"; try { //creating an instance of PdfReader class using (PdfReader reader = new PdfReader(filePath)) { //creating an instance of StringBuilder class StringBuilder text = new StringBuilder(); //use loop to specify how many pages to read. //I started from 5th page as Piyush told for (int i = 5; i <= reader.NumberOfPages; i++) { //Read the pdf text.Append(PdfTextExtractor.GetTextFromPage(reader, i)); }//end of for(i) int k = 4096000; //Test whether the string exceeds the 4MB if (text.Length < k) { //return the string text1 = text.ToString(); } //end of if } //end of using } //end try catch (Exception ex) { MessageBox.Show(ex.Message, "Please Do select a pdf file!!", MessageBoxButtons.OK, MessageBoxIcon.Warning); } //end of catch return text1; } //end of ReadPdfFiles() method Do help me!

    Read the article

  • C++ Check Substring of a String

    - by user69514
    I'm trying to check whether or not the second argument in my program is a substring of the first argument. The problem is that it only work if the substring starts with the same letter of the string. .i.e Michigan - Mich (this works) Michigan - Mi (this works) Michigan - igan (this doesn't work) #include <stdio.h> #include <string.h> #include <string> using namespace std; bool my_strstr( string str, string sub ) { bool flag = true; int startPosition = -1; char subStart = str.at(0); char strStart; //find starting position for(int i=0; i<str.length(); i++){ if(str.at(i) == subStart){ startPosition = i; break; } } for(int i=0; i<sub.size(); i++){ if(sub.at(i) != str.at(startPosition)){ flag = false; break; } startPosition++; } return flag; } int main(int argc, char **argv){ if (argc != 3) { printf ("Usage: check <string one> <string two>\n"); } string str1 = argv[1]; string str2 = argv[2]; bool result = my_strstr(str1, str2); if(result == 1){ printf("%s is a substring of %s\n", argv[2], argv[1]); } else{ printf("%s is not a substring of %s\n", argv[2], argv[1]); } return 0; }

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Get context for search string in text in C#

    - by soundslike
    Given a string text which contains newline there is a search keyword which matches an item within the text. How do I implement the following in C#: searchIdx = search index (starting with 0, then 1, etc. for each successive call to GetSearchContext. Initially start with 0. contextsTxt = string data to search in searchTxt = keyword to search for in contextsTxt numLines = number of lines to return surrounding the searchTxt found (ie. 1 = the line the searchTxt is found on, 2 = the line the searchTxt is found on, 3 = the line above the searchTxt is found on, the line the searchTxt is found on, and the line below the searchTxt is found on) returns the "context" based on the parameters string GetSearchContext(int searchIdx, string contentsTxt, string searchTxt, int numLines); If there's a better function interface to accomplish this feel free to suggest that as well. I tried the following but doesn't seem to work properly all the time: private string GetSearchContext(string contentValue, string search, int numLines) { int searchIdx = contentValue.IndexOf(search); int startIdx = 0; int lastIdx = 0; while (startIdx != -1 && (startIdx = contentValue.IndexOf('\n', startIdx+1)) < searchIdx) { lastIdx = startIdx; } startIdx = lastIdx; if (startIdx < 0) startIdx = 0; int endIdx = searchIdx; int lineCnt = 0; while (endIdx != -1 && lineCnt++ < numLines) { endIdx = contentValue.IndexOf('\n', endIdx + 1); } if (endIdx == -1 || endIdx > contentValue.Length - 1) endIdx = contentValue.Length - 1; string lines = contentValue.Substring(startIdx, endIdx - startIdx + 1); if (lines[0] == '\n') lines = lines.Substring(1); if (lines[lines.Length - 1] == '\n') { lines = lines.Substring(0, lines.Length - 1); } if (lines[lines.Length - 1] == '\r') { lines = lines.Substring(0, lines.Length - 1); } return lines; }

    Read the article

  • Change the contrast of Image like Adobe Photoshop in ASP.net C#

    - by Hoque
    While I was trying to change the brightness and contrast of Image using C#, but I could not get success in changing the contrast of the Image. May I expect any support from here. I am using ColorMatrix to do that. Here are the code that I am using for brightness(works fine) and contrast(does not work properly). public static ColorMatrix CreateBrightnessMatrix(float Brightness) { if (Brightness < -1 || Brightness > 1) throw new ArgumentOutOfRangeException("Brightness value is out of range"); ColorMatrix cm = new ColorMatrix(new float[][]{ new float[] { 1f, 0, 0, 0, 0}, new float[] { 0, 1f, 0, 0, 0}, new float[] { 0, 0, 1f, 0, 0}, new float[] { 0, 0, 0, 1f, 0}, new float[] {Brightness, Brightness, Brightness, 1f, 1f}}); return cm; } public static ColorMatrix CreateContrastMatrix(float Contrast) { if (Contrast < 0 || Contrast > 3) throw new ArgumentOutOfRangeException("Contrast value is out of range"); float Trans = (1f - Contrast) / 2f; ColorMatrix cm = new ColorMatrix(new float[][]{ new float[] {Contrast, 0f, 0f, 0f, 0f}, new float[] { 0f, Contrast, 0f, 0f, 0f}, new float[] { 0f, 0f, Contrast, 0f, 0f}, new float[] { 0f, 0f, 0f, 1f, 0f}, new float[] { Trans, Trans, Trans, 0f, 1f}}); return cm; } Thanks.

    Read the article

  • java: decoding URI query string

    - by Jason S
    I need to decode a URI that contains a query string; expected input/output behavior is something like the following: abstract class URIParser { /** example input: * something?alias=pos&FirstName=Foo+A%26B%3DC&LastName=Bar */ URIParser(String input) { ... } /** should return "something" for the example input */ public String getPath(); /** should return a map * {alias: "pos", FirstName: "Foo+A&B=C", LastName: "Bar"} */ public Map<String,String> getQuery(); } I've tried using java.net.URI, but it seems to decode the query string so in the above example I'm left with "alias=pos&FirstName=Foo+A&B=C&LastName=Bar" so there is ambiguity whether a "&" is a query separator or is a character in a query component. edit: just tried URI.getRawQuery() and it doesn't do the encoding, so I can split the query string with a "&", but then what do I do? Any suggestions?

    Read the article

  • Mono ASP.NET Oracle Connection

    - by bladepit
    Hello to everybody, if i want to connect to orcale i became the following error: libclntsh.so Description: HTTP 500. Error processing request. Stack Trace: System.DllNotFoundException: libclntsh.so at (wrapper managed-to-native) System.Data.OracleClient.Oci.OciCalls/OciNativeCalls.OCIEnvCreate (intptr&,System.Data.OracleClient.Oci.OciEnvironmentMode,intptr,intptr,intptr,intptr,int,intptr) <0x0005d at System.Data.OracleClient.Oci.OciCalls.OCIEnvCreate (intptr&,System.Data.OracleClient.Oci.OciEnvironmentMode,intptr,intptr,intptr,intptr,int,intptr) [0x00000] in /src/monoscript/mono-2.4.2.3/mcs/class/System.Data.OracleClient/System.Data.OracleClient.Oci/OciCalls.cs:738 at System.Data.OracleClient.Oci.OciEnvironmentHandle..ctor (System.Data.OracleClient.Oci.OciEnvironmentMode) [0x00013] in /src/monoscript/mono-2.4.2.3/mcs/class/System.Data.OracleClient/System.Data.OracleClient.Oci/OciEnvironmentHandle.cs:35 at System.Data.OracleClient.Oci.OciGlue.CreateConnection (System.Data.OracleClient.OracleConnectionInfo) [0x00000] in /src/monoscript/mono-2.4.2.3/mcs/class/System.Data.OracleClient/System.Data.OracleClient/OciGlue.cs:86 at System.Data.OracleClient.OracleConnectionPoolManager.CreateConnection (System.Data.OracleClient.OracleConnectionInfo) [0x00006] in /src/monoscript/mono-2.4.2.3/mcs/class/System.Data.OracleClient/System.Data.OracleClient/OracleConnectionPoolManager.cs:57 at System.Data.OracleClient.OracleConnectionPool.CreateConnection () [0x0000e] in /src/monoscript/mono-2.4.2.3/mcs/class/System.Data.OracleClient/System.Data.OracleClient/OracleConnectionPool.cs:97 at System.Data.OracleClient.OracleConnectionPool.GetConnection () [0x000ba] in /src/monoscript/mono-2.4.2.3/mcs/class/System.Data.OracleClient/System.Data.OracleClient/OracleConnectionPool.cs:74 at System.Data.OracleClient.OracleConnection.Open () [0x00061] in /src/monoscript/mono-2.4.2.3/mcs/class/System.Data.OracleClient/System.Data.OracleClient/OracleConnection.cs:410 at WebServer.Controllers.HomeController.Index () [0x00006] in /home/bhcweb/Projects/Controllers/HomeController.cs:19 at (wrapper dynamic-method) System.Runtime.CompilerServices.ExecutionScope.lambda_method (System.Runtime.CompilerServices.ExecutionScope,System.Web.Mvc.ControllerBase,object[]) <0x00080 at System.Web.Mvc.ActionMethodDispatcher.Execute (System.Web.Mvc.ControllerBase,object[]) <0x0001b at System.Web.Mvc.ReflectedActionDescriptor.Execute (System.Web.Mvc.ControllerContext,System.Collections.Generic.IDictionary2<string, object>) <0x000fd> at System.Web.Mvc.ControllerActionInvoker.InvokeActionMethod (System.Web.Mvc.ControllerContext,System.Web.Mvc.ActionDescriptor,System.Collections.Generic.IDictionary2) <0x0001c at System.Web.Mvc.ControllerActionInvoker/c_AnonStoreyB.<m_E () <0x00067 at System.Web.Mvc.ControllerActionInvoker.InvokeActionMethodFilter (System.Web.Mvc.IActionFilter,System.Web.Mvc.ActionExecutingContext,System.Func`1) <0x000c4 What is my Problem there? I have read that i have to set my ORACLE_HOME AND LD_LIBRARY_PATH. If i do echo $ORACLE_HOME and $LD_LIBRARY_PATH the path which i have set is coming out: /usr/lib/oracle/xe/app/oracle/product/10.2.0/client/lib This is the path where the libclntsh.so is in. Is this right? Best regards bladepit

    Read the article

  • return new string vs .ToString()

    - by Leroy Jenkins
    Take the following code: public static string ReverseIt(string myString) { char[] foo = myString.ToCharArray(); Array.Reverse(foo); return new string(foo); } I understand that strings are immutable, but what I dont understand is why a new string needs to be called return new string(foo); instead of return foo.ToString(); I have to assume it has something to do with reassembling the CharArray (but thats just a guess). Whats the difference between the two and how do you know when to return a new string as opposed to returning a System.String that represents the current object?

    Read the article

  • Java: Print and access List <String[]>

    - by battousai622
    Im reading in a file and storing it in t1. How do i access the elements in t1? When i try to print it i get addresses instead of values. Also whats the dif between string and string[]? CSVReader reader = new CSVReader(new FileReader("src/new_acquisitions.csv")); List <String[]> t1 = reader.readAll(); int i = 0 while(i < t1.size()) { System.out.println(t1.get(i)); i++; } output: [Ljava.lang.String;@9304b1 [Ljava.lang.String;@190d11 [Ljava.lang.String;@a90653 [Ljava.lang.String;@de6ced

    Read the article

< Previous Page | 10 11 12 13 14 15 16 17 18 19 20 21  | Next Page >