Search Results

Search found 3874 results on 155 pages for 'differed execution'.

Page 140/155 | < Previous Page | 136 137 138 139 140 141 142 143 144 145 146 147  | Next Page >

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • php connecting to mysql server(localhost) very slow

    - by Ahmad
    actually its little complicated: summary: the connection to DB is very slow. the page rendering takes around 10 seconds but the last statement on the page is an echo and i can see its output while the page is loading in firefox (IE is same). in google chrome the output becomes visible only when the loading finishes. loading time is approximately the same across browsers. on debugging i found out that its the DB connectivity that is creating problem. the DB was on another machine. to debug further. i deployed the DB on my local machine .. so now the DB connection is at 127.0.0.1 but the connectivity still takes long time. this means that the issue is with APACHE/PHP and not with mysql. but then i deployed my code on another machine which connects to DB remotely.and everything seems fine. basically the application uses couple of mod_rewrite.. but i removed all the .htaccess files and the slow connectivity issue remains.. i installed another APACHE on my machine and used default settings. the connection was still very slow. i added following statements to measure the execution time $stime = microtime(); $stime = explode(" ",$stime); $stime = $stime[1] + $stime[0]; // my code -- it involves connection to DB $mtime = microtime(); $mtime = explode(" ",$mtime); $mtime = $mtime[1] + $mtime[0]; $totaltime = ($mtime - $stime); echo $totaltime; the output is 0.0631899833679 but firebug Net panel shows total loading time of 10-11 seconds. same is the case with google chrome i tried to turn off windows firewall.. connectivity is still slow and i just can't quite find the reason.. i've tried multiple DB servers.. multiple apaches.. nothing seems to be working.. any idea of what might be the problem?

    Read the article

  • How can a C/C++ program put itself into background?

    - by Larry Gritz
    What's the best way for a running C or C++ program that's been launched from the command line to put itself into the background, equivalent to if the user had launched from the unix shell with '&' at the end of the command? (But the user didn't.) It's a GUI app and doesn't need any shell I/O, so there's no reason to tie up the shell after launch. But I want a shell command launch to be auto-backgrounded without the '&' (or on Windows). Ideally, I want a solution that would work on any of Linux, OS X, and Windows. (Or separate solutions that I can select with #ifdef.) It's ok to assume that this should be done right at the beginning of execution, as opposed to somewhere in the middle. One solution is to have the main program be a script that launches the real binary, carefully putting it into the background. But it seems unsatisfying to need these coupled shell/binary pairs. Another solution is to immediately launch another executed version (with 'system' or CreateProcess), with the same command line arguments, but putting the child in the background and then having the parent exit. But this seems clunky compared to the process putting itself into background. Edited after a few answers: Yes, a fork() (or system(), or CreateProcess on Windows) is one way to sort of do this, that I hinted at in my original question. But all of these solutions make a SECOND process that is backgrounded, and then terminate the original process. I was wondering if there was a way to put the EXISTING process into the background. One difference is that if the app was launched from a script that recorded its process id (perhaps for later killing or other purpose), the newly forked or created process will have a different id and so will not be controllable by any launching script, if you see what I'm getting at. Edit #2: fork() isn't a good solution for OS X, where the man page for 'fork' says that it's unsafe if certain frameworks or libraries are being used. I tried it, and my app complains loudly at runtime: "The process has forked and you cannot use this CoreFoundation functionality safely. You MUST exec()." I was intrigued by daemon(), but when I tried it on OS X, it gave the same error message, so I assume that it's just a fancy wrapper for fork() and has the same restrictions. Excuse the OS X centrism, it just happens to be the system in front of me at the moment. But I am indeed looking for a solution to all three platforms.

    Read the article

  • How can I improve the recursion capabilities of my ECMAScript implementation?

    - by ChaosPandion
    After some resent tests I have found my implementation cannot handle very much recursion. Although after I ran a few tests in Firefox I found that this may be more common than I originally thought. I believe the basic problem is that my implementation requires 3 calls to make a function call. The first call is made to a method named Call that makes sure the call is being made to a callable object and gets the value of any arguments that are references. The second call is made to a method named Call which is defined in the ICallable interface. This method creates the new execution context and builds the lambda expression if it has not been created. The final call is made to the lambda that the function object encapsulates. Clearly making a function call is quite heavy but I am sure that with a little bit of tweaking I can make recursion a viable tool when using this implementation. public static object Call(ExecutionContext context, object value, object[] args) { var func = Reference.GetValue(value) as ICallable; if (func == null) { throw new TypeException(); } if (args != null && args.Length > 0) { for (int i = 0; i < args.Length; i++) { args[i] = Reference.GetValue(args[i]); } } var reference = value as Reference; if (reference != null) { if (reference.IsProperty) { return func.Call(reference.Value, args); } else { return func.Call(((EnviromentRecord)reference.Value).ImplicitThisValue(), args); } } return func.Call(Undefined.Value, args); } public object Call(object thisObject, object[] arguments) { var lexicalEnviroment = Scope.NewDeclarativeEnviroment(); var variableEnviroment = Scope.NewDeclarativeEnviroment(); var thisBinding = thisObject ?? Engine.GlobalEnviroment.GlobalObject; var newContext = new ExecutionContext(Engine, lexicalEnviroment, variableEnviroment, thisBinding); Engine.EnterContext(newContext); var result = Function.Value(newContext, arguments); Engine.LeaveContext(); return result; }

    Read the article

  • small scale web site - global javascript file style/format/pattern - improving maintainability

    - by yaya3
    I frequently create (and inherit) small to medium websites where I have the following sort of code in a single file (normally named global.js or application.js or projectname.js). If functions get big, I normally put them in a seperate file, and call them at the bottom of the file below in the $(document).ready() section. If I have a few functions that are unique to certain pages, I normally have another switch statement for the body class inside the $(document).ready() section. How could I restructure this code to make it more maintainable? Note: I am less interested in the functions innards, more so the structure, and how different types of functions should be dealt with. I've also posted the code here - http://pastie.org/999932 in case it makes it any easier var ProjectNameEnvironment = {}; function someFunctionUniqueToTheHomepageNotWorthMakingConfigurable () { $('.foo').hide(); $('.bar').click(function(){ $('.foo').show(); }); } function functionThatIsWorthMakingConfigurable(config) { var foo = config.foo || 700; var bar = 200; return foo * bar; } function globallyRequiredJqueryPluginTrigger (tooltip_string) { var tooltipTrigger = $(tooltip_string); tooltipTrigger.tooltip({ showURL: false ... }); } function minorUtilityOneLiner (selector) { $(selector).find('li:even').not('li ul li').addClass('even'); } var Lightbox = {}; Lightbox.setup = function(){ $('li#foo a').attr('href','#alpha'); $('li#bar a').attr('href','#beta'); } Lightbox.init = function (config){ if (typeof $.fn.fancybox =='function') { Lightbox.setup(); var fade_in_speed = config.fade_in_speed || 1000; var frame_height = config.frame_height || 1700; $(config.selector).fancybox({ frameHeight : frame_height, callbackOnShow: function() { var content_to_load = config.content_to_load; ... }, callbackOnClose : function(){ $('body').height($('body').height()); } }); } else { if (ProjectNameEnvironment.debug) { alert('the fancybox plugin has not been loaded'); } } } // ---------- order of execution ----------- $(document).ready(function () { urls = urlConfig(); (function globalFunctions() { $('.tooltip-trigger').each(function(){ globallyRequiredJqueryPluginTrigger(this); }); minorUtilityOneLiner('ul.foo') Lightbox.init({ selector : 'a#a-lightbox-trigger-js', ... }); Lightbox.init({ selector : 'a#another-lightbox-trigger-js', ... }); })(); if ( $('body').attr('id') == 'home-page' ) { (function homeFunctions() { someFunctionUniqueToTheHomepageNotWorthMakingConfigurable (); })(); } });

    Read the article

  • What common routines do you put in your Program.cs for C#

    - by Rick
    I'm interested in any common routine/procedures/methods that you might use in you Program.cs when creating a .NET project. For instance I commonly use the following code in my desktop applications to allow easy upgrades, single instance execution and friendly and simple reporting of uncaught system application errors. using System; using System.Diagnostics; using System.Threading; using System.Windows.Forms; namespace NameoftheAssembly { internal static class Program { /// <summary> /// The main entry point for the application. Modified to check for another running instance on the same computer and to catch and report any errors not explicitly checked for. /// </summary> [STAThread] private static void Main() { //for upgrading and installing newer versions string[] arguments = Environment.GetCommandLineArgs(); if (arguments.GetUpperBound(0) > 0) { foreach (string argument in arguments) { if (argument.Split('=')[0].ToLower().Equals("/u")) { string guid = argument.Split('=')[1]; string path = Environment.GetFolderPath(Environment.SpecialFolder.System); var si = new ProcessStartInfo(path + "\\msiexec.exe", "/x" + guid); Process.Start(si); Application.Exit(); } } //end of upgrade } else { bool onlyInstance = false; var mutex = new Mutex(true, Application.ProductName, out onlyInstance); if (!onlyInstance) { MessageBox.Show("Another copy of this running"); return; } AppDomain.CurrentDomain.UnhandledException += CurrentDomain_UnhandledException; Application.ThreadException += ApplicationThreadException; Application.EnableVisualStyles(); Application.SetCompatibleTextRenderingDefault(false); Application.Run(new Form1()); } } private static void CurrentDomain_UnhandledException(object sender, UnhandledExceptionEventArgs e) { try { var ex = (Exception) e.ExceptionObject; MessageBox.Show("Whoops! Please contact the developers with the following" + " information:\n\n" + ex.Message + ex.StackTrace, " Fatal Error", MessageBoxButtons.OK, MessageBoxIcon.Stop); } catch (Exception) { //do nothing - Another Exception! Wow not a good thing. } finally { Application.Exit(); } } public static void ApplicationThreadException(object sender, ThreadExceptionEventArgs e) { try { MessageBox.Show("Whoops! Please contact the developers with the following" + " information:\n\n" + e.Exception.Message + e.Exception.StackTrace, " Error", MessageBoxButtons.OK, MessageBoxIcon.Stop); } catch (Exception) { //do nothing - Another Exception! Wow not a good thing. } } } } I find these routines to be very helpful. What methods have you found helpful in Program.cs?

    Read the article

  • Jumping into argv?

    - by jth
    Hi, I`am experimenting with shellcode and stumbled upon the nop-slide technique. I wrote a little tool that takes buffer-size as a parameter and constructs a buffer like this: [ NOP | SC | RET ], with NOP taking half of the buffer, followed by the shellcode and the rest filled with the (guessed) return address. Its very similar to the tool aleph1 described in his famous paper. My vulnerable test-app is the same as in his paper: int main(int argc, char **argv) { char little_array[512]; if(argc>1) strcpy(little_array,argv[1]); return 0; } I tested it and well, it works: jth@insecure:~/no_nx_no_aslr$ ./victim $(./exploit 604 0) $ exit But honestly, I have no idea why. Okay, the saved eip was overwritten as intended, but instead of jumping somewhere into the buffer, it jumped into argv, I think. gdb showed up the following addresses before strcpy() was called: (gdb) i f Stack level 0, frame at 0xbffff1f0: eip = 0x80483ed in main (victim.c:7); saved eip 0x154b56 source language c. Arglist at 0xbffff1e8, args: argc=2, argv=0xbffff294 Locals at 0xbffff1e8, Previous frame's sp is 0xbffff1f0 Saved registers: ebp at 0xbffff1e8, eip at 0xbffff1ec Address of little_array: (gdb) print &little_array[0] $1 = 0xbfffefe8 "\020" After strcpy(): (gdb) i f Stack level 0, frame at 0xbffff1f0: eip = 0x804840d in main (victim.c:10); saved eip 0xbffff458 source language c. Arglist at 0xbffff1e8, args: argc=-1073744808, argv=0xbffff458 Locals at 0xbffff1e8, Previous frame's sp is 0xbffff1f0 Saved registers: ebp at 0xbffff1e8, eip at 0xbffff1ec So, what happened here? I used a 604 byte buffer to overflow little_array, so he certainly overwrote saved ebp, saved eip and argc and also argv with the guessed address 0xbffff458. Then, after returning, EIP pointed at 0xbffff458. But little_buffer resides at 0xbfffefe8, that`s a difference of 1136 byte, so he certainly isn't executing little_array. I followed execution with the stepi command and well, at 0xbffff458 and onwards, he executes NOPs and reaches the shellcode. I'am not quite sure why this is happening. First of all, am I correct that he executes my shellcode in argv, not little_array? And where does the loader(?) place argv onto the stack? I thought it follows immediately after argc, but between argc and 0xbffff458, there is a gap of 620 bytes. How is it possible that he successfully "lands" in the NOP-Pad at Address 0xbffff458, which is way above the saved eip at 0xbffff1ec? Can someone clarify this? I have actually no idea why this is working. My test-machine is an Ubuntu 9.10 32-Bit Machine without ASLR. victim has an executable stack, set with execstack -s. Thanks in advance.

    Read the article

  • run shell command from java

    - by Aykut
    Hi, I am working on an application an have an issue about running shell command from java application. here is the code: public String execRuntime(String cmd) { Process proc = null; int inBuffer, errBuffer; int result = 0; StringBuffer outputReport = new StringBuffer(); StringBuffer errorBuffer = new StringBuffer(); try { proc = Runtime.getRuntime().exec(cmd); } catch (IOException e) { return ""; } try { response.status = 1; result = proc.waitFor(); } catch (InterruptedException e) { return ""; } if (proc != null && null != proc.getInputStream()) { InputStream is = proc.getInputStream(); InputStream es = proc.getErrorStream(); OutputStream os = proc.getOutputStream(); try { while ((inBuffer = is.read()) != -1) { outputReport.append((char) inBuffer); } while ((errBuffer = es.read()) != -1) { errorBuffer.append((char) errBuffer); } } catch (IOException e) { return ""; } try { is.close(); is = null; es.close(); es = null; os.close(); os = null; } catch (IOException e) { return ""; } proc.destroy(); proc = null; } if (errorBuffer.length() > 0) { logger .error("could not finish execution because of error(s)."); logger.error("*** Error : " + errorBuffer.toString()); return ""; } return outputReport.toString(); } but when i try to exec command like : /export/home/test/myapp -T "some argument" myapp reads "some argument" as two seperated arguments.but I want to read "some argument" as only a argument. when i directly run this command from terminal, it executed successfully. I tried '"some argument"' ,""some argument"" , "some\ argument" but did not work for me. how can i read this argument as one argument. Thnaks.

    Read the article

  • When transactionManager is not named "transactionManager" ...

    - by smallufo
    I am trying Spring 3(.0.2.RELEASE) and JPA2 and Hibernate 3.5.1-Final... One thing upsets me is that spring seems only accept a transaction Manager named "transactionManager" If I don't name it "transactionManager" , Spring will throws NoSuchBeanDefinitionException: No bean named 'transactionManager' is defined. Here is my config : <context:component-scan base-package="destiny.data.mining"/> <context:annotation-config/> <bean id="miningEntityManagerFactory" class="org.springframework.orm.jpa.LocalContainerEntityManagerFactoryBean"> <property name="persistenceUnitName" value="mining"/> </bean> <bean id="miningTransactionManager" class="org.springframework.orm.jpa.JpaTransactionManager" > <property name="entityManagerFactory" ref="miningEntityManagerFactory"/> </bean> <tx:advice id="txAdviceMining" transaction-manager="miningTransactionManager"> <tx:attributes> <tx:method name="get*" read-only="true"/> <tx:method name="save*" propagation="REQUIRED"/> <tx:method name="update*" propagation="REQUIRED"/> <tx:method name="delete*" propagation="REQUIRED"/> <tx:method name="*" propagation="SUPPORTS" read-only="true"/> </tx:attributes> </tx:advice> <aop:config> <aop:pointcut id="methods" expression="execution(* destiny.utils.AbstractDao+.*(..))"/> <aop:advisor advice-ref="txAdviceMining" pointcut-ref="methods"/> </aop:config> <tx:annotation-driven transaction-manager="miningTransactionManager"/> In this config , an Entity Manager Factory is not necessarily named "entityManagerFactory" , and "txAdvice" is not necessarily named "txAdvice" , either. But I don't know why on earth Spring requires a transaction manager named "transactionManager" ? Is there any way not to name a transaction manager "transactionManager" ? (I'm running multiple spring config files , so I try my best to avoid name-conflicting) test code : @RunWith(SpringJUnit4ClassRunner.class) @ContextConfiguration(locations={"classpath:mining.xml"}) public class MiningPersonDaoTest { @Inject private EntityManagerFactory miningEntityManagerFactory; @Inject private MiningPersonDao miningPersonDao; @Transactional @Test public void testUpdate() { MiningPerson p = miningPersonDao.get(42L); p.setLocationName("OOXX"); miningPersonDao.update(p); System.out.println(p); } } ii

    Read the article

  • StaX: Content not allowed in prolog

    - by RalfB
    I have the following (test) XML file below and Java code that uses StaX. I want to apply this code to a file that is about 30 GB large but with fairly small elements, so I thought StaX is a good choice. I am getting the following error: Exception in thread "main" javax.xml.stream.XMLStreamException: ParseError at [row,col]:[1,1] Message: Content is not allowed in prolog at com.sun.org.apache.xerces.internal.impl.XMLStreamReaderImpl.next(XMLStreamReaderImpl.java:598) at at.tuwien.mucke.util.xml.staxtest.StaXTest.main(StaXTest.java:18) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:57) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:43) at java.lang.reflect.Method.invoke(Method.java:601) at com.intellij.rt.execution.application.AppMain.main(AppMain.java:120) <?xml version='1.0' encoding='utf-8'?> <catalog> <book id="bk101"> <author>Gambardella, Matthew</author> <title>XML Developer's Guide</title> <price>44.95</price> <description>An in-depth look at creating applications with XML.</description> </book> <book id="bk102"> <author>Ralls, Kim</author> <title>Midnight Rain</title> <price>5.95</price> <description>A former architect battles corporate zombies, an evil sorceress, and her own childhood to become queen of the world.</description> </book> </catalog> Here the code: package xml.staxtest; import java.io.*; import javax.xml.stream.*; public class StaXTest { public static void main(String[] args) throws Exception { XMLInputFactory xif = XMLInputFactory.newInstance(); XMLStreamReader streamReader = xif.createXMLStreamReader(new FileReader("D:/Data/testFile.xml")); while(streamReader.hasNext()){ int eventType = streamReader.next(); if(eventType == XMLStreamReader.START_ELEMENT){ System.out.println(streamReader.getLocalName()); } //... more to come here later ... } } }

    Read the article

  • Poor performance / speed of regex with lookahead

    - by Hugo Zaragoza
    I have been observing extremely slow execution times with expressions with several lookaheads. I suppose that this is due to underlying data structures, but it seems pretty extreme and I wonder if I do something wrong or if there are known work-arounds. The problem is determining if a set of words are present in a string, in any order. For example we want to find out if two terms "term1" AND "term2" are somewhere in a string. I do this with the expresion: (?=.*\bterm1\b)(?=.*\bterm2\b) But what I observe is that this is an order of magnitude slower than checking first just \bterm1\b and just then \bterm2\b This seems to indicate that I should use an array of patterns instead of a single pattern with lookaheads... is this right? it seems wrong... Here is an example test code and resulting times: public static void speedLookAhead() { Matcher m, m1, m2; boolean find; int its = 1000000; // create long non-matching string char[] str = new char[2000]; for (int i = 0; i < str.length; i++) { str[i] = 'x'; } String test = str.toString(); // First method: use one expression with lookaheads m = Pattern.compile("(?=.*\\bterm1\\b)(?=.*\\bterm2\\b)").matcher(test); long time = System.currentTimeMillis(); ; for (int i = 0; i < its; i++) { m.reset(test); find = m.find(); } time = System.currentTimeMillis() - time; System.out.println(time); // Second method: use two expressions and AND the results m1 = Pattern.compile("\\bterm1\\b").matcher(test); m2 = Pattern.compile("\\bterm2\\b").matcher(test); time = System.currentTimeMillis(); ; for (int i = 0; i < its; i++) { m1.reset(test); m2.reset(test); find = m1.find() && m2.find(); } time = System.currentTimeMillis() - time; System.out.println(time); } This outputs in my computer: 1754 150

    Read the article

  • Android browser touch events stop display being updated inc. canvas/elements - How to work around?

    - by Ed Kirk
    On some android's native browser touching the page seems to stop the display from being updated until the finger is released. This occurs for both html element based animation (switching classes) and for canvas based animation. It does not however stop normal js execution and other events are fired as normal. On devices with this problem the dolphin browser also seems effected (not firefox though). Touchstart/move both have preventDefault() fired as well as stopPropergation(), cancelBubble = true; and e.returnValue = false;. In the CSS webkit selection has also been disabled. The page will not scroll. A similar question has been asked here: Does Android browser lock DOM on touchStart? but I'd like to find out if this behaviour can be overcome, or at least to discover what devices will be effected by the problem, is it a device or version android issue? If you cannot answer the question running the demo and reporting your experience along with your device model and useragent (displayed at bottom of demo page) as a comment might help others or myself answer the question. Here is a demo and steps to reproduce the behaviour. A QR code for the link can be found here https://s3-eu-west-1.amazonaws.com/canvas-test-pd/tmp.png. https://s3-eu-west-1.amazonaws.com/canvas-test-pd/index.html The web page has a canvas at the top and a div with a background image at the bottom. Every second the canvas is cleared and a different image displayed and the div has it's class switched (both toggle between 0 and 1 pngs). Once this has toggled a few times place your finger on the canvas (the top grey box) and hold it there. Wait to see if the animation continues (sometimes it will once or twice then stops) and if there are any visual distortions. Update It seems that the Galaxy Tab running 3.2 requires handlers for touchstart/end of document, not just required divs for the screen to continue updating the display. Thanks jimpic. I'm starting to believe it's an issue caused by manufacturers skins, although this is difficult to prove.

    Read the article

  • Why does the Ternary\Conditional operator seem significantly faster

    - by Jodrell
    Following on from this question, which I have partially answered. I compile this console app in x64 Release Mode, with optimizations on, and run it from the command line without a debugger attached. using System; using System.Diagnostics; class Program { static void Main() { var stopwatch = new Stopwatch(); var ternary = Looper(10, Ternary); var normal = Looper(10, Normal); if (ternary != normal) { throw new Exception(); } stopwatch.Start(); ternary = Looper(10000000, Ternary); stopWatch.Stop(); Console.WriteLine( "Ternary took {0}ms", stopwatch.ElapsedMilliseconds); stopwatch.Start(); normal = Looper(10000000, Normal); stopWatch.Stop(); Console.WriteLine( "Normal took {0}ms", stopwatch.ElapsedMilliseconds); if (ternary != normal) { throw new Exception(); } Console.ReadKey(); } static int Looper(int iterations, Func<bool, int, int> operation) { var result = 0; for (int i = 0; i < iterations; i++) { var condition = result % 11 == 4; var value = ((i * 11) / 3) % 5; result = operation(condition, value); } return result; } static int Ternary(bool condition, in value) { return value + (condition ? 2 : 1); } static int Normal(int iterations) { if (condition) { return = 2 + value; } return = 1 + value; } } I don't get any exceptions and the output to the console is somthing close to, Ternary took 107ms Normal took 230ms When I break down the CIL for the two logical functions I get this, ... Ternary ... { : ldarg.1 // push second arg : ldarg.0 // push first arg : brtrue.s T // if first arg is true jump to T : ldc.i4.1 // push int32(1) : br.s F // jump to F T: ldc.i4.2 // push int32(2) F: add // add either 1 or 2 to second arg : ret // return result } ... Normal ... { : ldarg.0 // push first arg : brfalse.s F // if first arg is false jump to F : ldc.i4.2 // push int32(2) : ldarg.1 // push second arg : add // add second arg to 2 : ret // return result F: ldc.i4.1 // push int32(1) : ldarg.1 // push second arg : add // add second arg to 1 : ret // return result } Whilst the Ternary CIL is a little shorter, it seems to me that the execution path through the CIL for either function takes 3 loads and 1 or 2 jumps and a return. Why does the Ternary function appear to be twice as fast. I underdtand that, in practice, they are both very quick and indeed, quich enough but, I would like to understand the discrepancy.

    Read the article

  • Vertical Seek not progress value not showing on MainActivity textView

    - by Raju Gujarati
    I am try to display the progress value of the seekBar but when it comes to the execution, there is no update on the value being display on the TextView. I wonder what alternatives than putting two classes onto one big class in order to archive this aim ? The below is my code VerticalSeekBar.java package com.example.imagerotation; import android.content.Context; import android.graphics.Canvas; import android.util.AttributeSet; import android.view.MotionEvent; import android.widget.SeekBar; import android.widget.Toast; public class VerticalSeekBar extends SeekBar { public VerticalSeekBar(Context context) { super(context); } public VerticalSeekBar(Context context, AttributeSet attrs, int defStyle) { super(context, attrs, defStyle); } public VerticalSeekBar(Context context, AttributeSet attrs) { super(context, attrs); } protected void onSizeChanged(int w, int h, int oldw, int oldh) { super.onSizeChanged(h, w, oldh, oldw); } @Override protected synchronized void onMeasure(int widthMeasureSpec, int heightMeasureSpec) { super.onMeasure(heightMeasureSpec, widthMeasureSpec); setMeasuredDimension(getMeasuredHeight(), getMeasuredWidth()); } protected void onDraw(Canvas c) { c.rotate(-90); c.translate(-getHeight(), 0); super.onDraw(c); } @Override public boolean onTouchEvent(MotionEvent event) { if (!isEnabled()) { return false; } switch (event.getAction()) { case MotionEvent.ACTION_DOWN: case MotionEvent.ACTION_MOVE: case MotionEvent.ACTION_UP: int progress = getMax() - (int) (getMax() * event.getY() / getHeight()); setProgress(progress); onSizeChanged(getWidth(), getHeight(), 0, 0); //Toast.makeText(getContext(), String.valueOf(progress), Toast.LENGTH_SHORT).show(); break; case MotionEvent.ACTION_CANCEL: break; } return true; } } MainActvity.java package com.example.imagerotation; import android.app.Activity; import android.os.Bundle; import android.view.Menu; import android.view.MenuItem; import android.widget.TextView; public class MainActivity extends Activity { private VerticalSeekBar seek; private TextView by; @Override protected void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.activity_main); seek = (VerticalSeekBar)findViewById(R.id.seekBar1); by = (TextView)findViewById(R.id.textView1); by.setText(String.valueOf(seek.getProgress())); } }

    Read the article

  • How to fix this Speech Recognition wicked bug?

    - by aF
    I have this code in my C# project: public void startRecognition(string pName) { presentationName = pName; if (WaveNative.waveInGetNumDevs() > 0) { string grammar = System.Environment.GetEnvironmentVariable("PUBLIC") + "\\SoundLog\\Presentations\\" + presentationName + "\\SpeechRecognition\\soundlog.cfg"; if (File.Exists(grammar)) { File.Delete(grammar); } executeCommand(); /// Create an instance of SpSharedRecoContextClass which will be used /// to interface with the incoming audio stream recContext = new SpSharedRecoContextClass(); // Create the grammar object recContext.CreateGrammar(1, out recGrammar); //recContext.CreateGrammar(2, out recGrammar2); // Set up dictation mode //recGrammar2.SetDictationState(SpeechLib.SPRULESTATE.SPRS_ACTIVE); //recGrammar2.SetGrammarState(SPGRAMMARSTATE.SPGS_ENABLED); // Set appropriate grammar mode if (File.Exists(grammar)) { recGrammar.LoadCmdFromFile(grammar, SPLOADOPTIONS.SPLO_STATIC); //recGrammar.SetDictationState(SpeechLib.SPRULESTATE.SPRS_INACTIVE); recGrammar.SetGrammarState(SPGRAMMARSTATE.SPGS_ENABLED); recGrammar.SetRuleIdState(0, SPRULESTATE.SPRS_ACTIVE); } /// Bind a callback to the recognition event which will be invoked /// When a dictated phrase has been recognised. recContext.Recognition += new _ISpeechRecoContextEvents_RecognitionEventHandler(handleRecognition); // System.Windows.Forms.MessageBox.Show(recContext.ToString()); // gramática compilada } } private static void handleRecognition(int StreamNumber, object StreamPosition, SpeechLib.SpeechRecognitionType RecognitionType, SpeechLib.ISpeechRecoResult Result) { string temp = Result.PhraseInfo.GetText(0, -1, true); _recognizedText = ""; // System.Windows.Forms.MessageBox.Show(temp); // System.Windows.Forms.MessageBox.Show(recognizedWords.Count.ToString()); foreach (string word in recognizedWords) { if (temp.Contains(word)) { // System.Windows.Forms.MessageBox.Show("yes"); _recognizedText = word; } } } This codes generates a dll that I use in another application. Now, the wicked bug: - when I run the startRecognition method in the beginning of the execution of the other application, this codes works very well. But when I run it some time after the beginning, this codes works but the handleRecognition method is never called. I see that the words are recognized because they appear on the Microsoft Speech Recognition app, but the handler method is never called. Do you know what's the problem with this code? NOTE: this project has some code that is allways being executed. Might that be the problem? Because the other code is running it doesn't allow it to this to run?

    Read the article

  • How to fix this Speech Recognition on C# wicked bug?

    - by aF
    Hello, I have this code in my C# project: public void startRecognition(string pName) { presentationName = pName; if (WaveNative.waveInGetNumDevs() > 0) { string grammar = System.Environment.GetEnvironmentVariable("PUBLIC") + "\\SoundLog\\Presentations\\" + presentationName + "\\SpeechRecognition\\soundlog.cfg"; if (File.Exists(grammar)) { File.Delete(grammar); } executeCommand(); /// Create an instance of SpSharedRecoContextClass which will be used /// to interface with the incoming audio stream recContext = new SpSharedRecoContextClass(); // Create the grammar object recContext.CreateGrammar(1, out recGrammar); //recContext.CreateGrammar(2, out recGrammar2); // Set up dictation mode //recGrammar2.SetDictationState(SpeechLib.SPRULESTATE.SPRS_ACTIVE); //recGrammar2.SetGrammarState(SPGRAMMARSTATE.SPGS_ENABLED); // Set appropriate grammar mode if (File.Exists(grammar)) { recGrammar.LoadCmdFromFile(grammar, SPLOADOPTIONS.SPLO_STATIC); //recGrammar.SetDictationState(SpeechLib.SPRULESTATE.SPRS_INACTIVE); recGrammar.SetGrammarState(SPGRAMMARSTATE.SPGS_ENABLED); recGrammar.SetRuleIdState(0, SPRULESTATE.SPRS_ACTIVE); } /// Bind a callback to the recognition event which will be invoked /// When a dictated phrase has been recognised. recContext.Recognition += new _ISpeechRecoContextEvents_RecognitionEventHandler(handleRecognition); // System.Windows.Forms.MessageBox.Show(recContext.ToString()); // gramática compilada } } private static void handleRecognition(int StreamNumber, object StreamPosition, SpeechLib.SpeechRecognitionType RecognitionType, SpeechLib.ISpeechRecoResult Result) { string temp = Result.PhraseInfo.GetText(0, -1, true); _recognizedText = ""; // System.Windows.Forms.MessageBox.Show(temp); // System.Windows.Forms.MessageBox.Show(recognizedWords.Count.ToString()); foreach (string word in recognizedWords) { if (temp.Contains(word)) { // System.Windows.Forms.MessageBox.Show("yes"); _recognizedText = word; } } } This codes generates a dll that I use in another application. Now, the wicked bug: - when I run the startRecognition method in the beginning of the execution of the other application, this codes works very well. But when I run it some time after the beginning, this codes works but the handleRecognition method is never called. I see that the words are recognized because they appear on the Microsoft Speech Recognition app, but the handler method is never called. Do you know what's the problem with this code? Thanks in advance :D

    Read the article

  • How do I use JDK 7 on Mac OSX?

    - by Yko
    OK. This is a newbie question but I can't figure it out... I would like to use the WatchService API as mentioned in this link: http://download.oracle.com/javase/tutorial/essential/io/notification.html After reading around, I found out that WatchService is part of the NIO class which is scheduled for JDK 7. So, it is in beta form. It's fine. http://jdk7.java.net/download.html has the JDK which I downloaded and extracted. I got a bunch of folders. I don't know what to do with them. Then, I read around some more and found that some nice group of people created JDK 7 as a binary so someone like me can install it easily. It is called Open JDK: http://code.google.com/p/openjdk-osx-build/ So, I downloaded the .dmg file and instal it. Then I open "Java Preference" and see that OpenJDK7 is available. So, now I feel that I can start trying out WatchService API. From the tutorial in the first link, the author gave a .java file to test it out first and make sure that it is running. Here is the link to the file: http://download.oracle.com/javase/tutorial/essential/io/examples/WatchDir.java So, I boot up Eclipse (actually I use STS) and create a new Java project and choose JaveSE-1.7 in the "use an execution environment JRE:". Under the src folder, I copy pasted the WatchDir.java file. And I still see tons of squiggly red lines. All the "import.java.nio.*" are all red and I cannot run it as a Java app. If you read this far, thanks a lot. So, now... What do I need to do? Thanks. EDIT: I actually did not pursue using Java 7 but there are a lot of interest in it and it seems like people keep answering this question. What should I do to make it more relevant to people who search for it? Let me know by PMing me. Thanks.

    Read the article

  • Is typeid of type name always evaluated at compile time in c++ ?

    - by cyril42e
    I wanted to check that typeid is evaluated at compile time when used with a type name (ie typeid(int), typeid(std::string)...). To do so, I repeated in a loop the comparison of two typeid calls, and compiled it with optimizations enabled, in order to see if the compiler simplified the loop (by looking at the execution time which is 1us when it simplifies instead of 160ms when it does not). And I get strange results, because sometimes the compiler simplifies the code, and sometimes it does not. I use g++ (I tried different 4.x versions), and here is the program: #include <iostream> #include <typeinfo> #include <time.h> class DisplayData {}; class RobotDisplay: public DisplayData {}; class SensorDisplay: public DisplayData {}; class RobotQt {}; class SensorQt {}; timespec tp1, tp2; const int n = 1000000000; int main() { int avg = 0; clock_gettime(CLOCK_REALTIME, &tp1); for(int i = 0; i < n; ++i) { // if (typeid(RobotQt) == typeid(RobotDisplay)) // (1) compile time // if (typeid(SensorQt) == typeid(SensorDisplay)) // (2) compile time if (typeid(RobotQt) == typeid(RobotDisplay) || typeid(SensorQt) == typeid(SensorDisplay)) // (3) not compile time ???!!! avg++; else avg--; } clock_gettime(CLOCK_REALTIME, &tp2); std::cout << "time (" << avg << "): " << (tp2.tv_sec-tp1.tv_sec)*1000000000+(tp2.tv_nsec-tp1.tv_nsec) << " ns" << std::endl; } The conditions in which this problem appear are not clear, but: - if there is no inheritance involved, no problem (always compile time) - if I do only one comparison, no problem - the problem only appears only with a disjunction of comparisons if all the terms are false So is there something I didn't get with how typeid works (is it always supposed to be evaluated at compilation time when used with type names?) or may this be a gcc bug in evaluation or optimization? About the context, I tracked down the problem to this very simplified example, but my goal is to use typeid with template types (as partial function template specialization is not possible). Thanks for your help!

    Read the article

  • SwingWorker exceptions lost even when using wrapper classes

    - by Ti Strga
    I've been struggling with the usability problem of SwingWorker eating any exceptions thrown in the background task, for example, described on this SO thread. That thread gives a nice description of the problem, but doesn't discuss recovering the original exception. The applet I've been handed needs to propagate the exception upwards. But I haven't been able to even catch it. I'm using the SimpleSwingWorker wrapper class from this blog entry specifically to try and address this issue. It's a fairly small class but I'll repost it at the end here just for reference. The calling code looks broadly like try { // lots of code here to prepare data, finishing with SpecialDataHelper helper = new SpecialDataHelper(...stuff...); helper.execute(); } catch (Throwable e) { // used "Throwable" here in desperation to try and get // anything at all to match, including unchecked exceptions // // no luck, this code is never ever used :-( } The wrappers: class SpecialDataHelper extends SimpleSwingWorker { public SpecialDataHelper (SpecialData sd) { this.stuff = etc etc etc; } public Void doInBackground() throws Exception { OurCodeThatThrowsACheckedException(this.stuff); return null; } protected void done() { // called only when successful // never reached if there's an error } } The feature of SimpleSwingWorker is that the actual SwingWorker's done()/get() methods are automatically called. This, in theory, rethrows any exceptions that happened in the background. In practice, nothing is ever caught, and I don't even know why. The SimpleSwingWorker class, for reference, and with nothing elided for brevity: import java.util.concurrent.ExecutionException; import javax.swing.SwingWorker; /** * A drop-in replacement for SwingWorker<Void,Void> but will not silently * swallow exceptions during background execution. * * Taken from http://jonathangiles.net/blog/?p=341 with thanks. */ public abstract class SimpleSwingWorker { private final SwingWorker<Void,Void> worker = new SwingWorker<Void,Void>() { @Override protected Void doInBackground() throws Exception { SimpleSwingWorker.this.doInBackground(); return null; } @Override protected void done() { // Exceptions are lost unless get() is called on the // originating thread. We do so here. try { get(); } catch (final InterruptedException ex) { throw new RuntimeException(ex); } catch (final ExecutionException ex) { throw new RuntimeException(ex.getCause()); } SimpleSwingWorker.this.done(); } }; public SimpleSwingWorker() {} protected abstract Void doInBackground() throws Exception; protected abstract void done(); public void execute() { worker.execute(); } }

    Read the article

  • -[NSConcreteMutableData release]: message sent to deallocated instance

    - by kamibutt
    Dear members, I am facing a problem of -[NSConcreteMutableData release]: message sent to deallocated instance, i have attached my sample code as well. - (IBAction)uploadImage { NSString *urlString = @"http://192.168.1.108/iphoneimages/uploadfile.php?userid=1&charid=23&msgid=3"; //if(FALSE) for (int i=0; i<[imgArray count]; i++) { // setting up the request object now NSMutableURLRequest *request = [[NSMutableURLRequest alloc] init]; [request setURL:[NSURL URLWithString:urlString]]; [request setHTTPMethod:@"POST"]; /* add some header info now we always need a boundary when we post a file also we need to set the content type You might want to generate a random boundary.. this is just the same as my output from wireshark on a valid html post */ NSString *boundary = [NSString stringWithString:@"---------------------------14737809831466499882746641449"]; NSString *contentType = [NSString stringWithFormat:@"multipart/form-data; boundary=%@",boundary]; [request addValue:contentType forHTTPHeaderField: @"Content-Type"]; /* now lets create the body of the post */ NSMutableData *body = [[NSMutableData data] autorelease]; NSString *str = [NSString stringWithFormat:@"Content-Disposition: form-data; name=\"userfile\"; filename=\"ipodfile%d.jpg\"\r\n",i]; [body appendData:[[NSString stringWithFormat:@"\r\n--%@\r\n",boundary] dataUsingEncoding:NSUTF8StringEncoding]]; [body appendData:[[NSString stringWithString:str] dataUsingEncoding:NSUTF8StringEncoding]]; [body appendData:[[NSString stringWithString:@"Content-Type: application/octet-stream\r\n\r\n"] dataUsingEncoding:NSUTF8StringEncoding]]; NSData *imageData = UIImageJPEGRepresentation([imgArray objectAtIndex:i], 90); [body appendData:[NSData dataWithData:imageData]]; [body appendData:[[NSString stringWithFormat:@"\r\n--%@--\r\n",boundary] dataUsingEncoding:NSUTF8StringEncoding]]; // setting the body of the post to the reqeust [request setHTTPBody:body]; // now lets make the connection to the web [NSURLConnection sendSynchronousRequest:request returningResponse:nil error:nil]; //NSString *returnString = [[NSString alloc] initWithData:returnData encoding:NSUTF8StringEncoding]; //NSLog(@"%@",returnString); [imageData release]; [request release]; //[body release]; } } It successfully upload the images to the folder and there is no any error in the execution but when it complete it process and try to go back it give error -[NSConcreteMutableData release]: message sent to deallocated instance Please help me out. Thanks

    Read the article

  • form inside tabview doesn't work

    - by user3536737
    i am working with jsf and primefaces , and here is what 've tried well i want to creat a tabview that get data from an arraylist in my bean i get for exemple 4 tabs , and inside each one i've created a hidden panel where i have a form with 2 input text to update informations , do i display the panel when i click on the second button Update , after that my panel is not hidden anymore , and i set the new values and click on the second button to update the informations , the problem is that the updating and the execution is working only for the first tab , it means when i try to update the new informations it works for the first one and for the other tabs it doesn't here is the code <p:tab title="#{rr.nom_ressource}"> <h:panelGrid> <h:graphicImage value="Ressources/images/emp.jpg" style="vertical-align:middle" /> <span style="font-size:15px; width:170px; display:inline-block;"> Nom : #{rr.nom_ressource} Type: #{rr.type_ressource} Specification: #{rr.experience} </span> <h:commandButton image="Ressources/images/delete.jpg" actionListener="#{SelectBean.act}" update=":form" style="vertical-align:middle" > Update </h:commandButton> <h:commandButton update=":outPanel" actionListener="#{SelectBean.mod1()}" image="Ressources/images/update.png" style="vertical-align:middle" > Modifier </h:commandButton> <h:form id="form111"> <p:growl id="growl" showDetail="true" sticky="true" /> <p:panel rendered ="#{SelectBean.bol}" closable="true" toggleable="true" id="outPanel" styleClass="outPanel" widgetVar="outpanel"> <h:outputLabel value="Nom " /> <h:inputText value="#{SelectBean.nom}" /> <br/> <h:outputLabel value="Experience " /> <h:inputText value="#{SelectBean.exp}" /> <br/> <h:commandButton value="Update" action="#{SelectBean.done}"/> </p:panel> </h:form> </h:panelGrid> </p:tab> for my managedbean the code is correct i think the problem is here

    Read the article

  • Hibernate/Spring: getHibernateTemplate().save(...) Freezes/Hangs

    - by ashes999
    I'm using Hibernate and Spring with the DAO pattern (all Hibernate dependencies in a *DAO.java class). I have nine unit tests (JUnit) which create some business objects, save them, and perform operations on them; the objects are in a hash (so I'm reusing the same objects all the time). My JUnit setup method calls my DAO.deleteAllObjects() method which calls getSession().createSQLQuery("DELETE FROM <tablename>").executeUpdate() for my business object table (just one). One of my unit tests (#8/9) freezes. I presumed it was a database deadlock, because the Hibernate log file shows my delete statement last. However, debugging showed that it's simply HibernateTemplate.save(someObject) that's freezing. (Eclipse shows that it's freezing on HibernateTemplate.save(Object), line 694.) Also interesting to note is that running this test by itself (not in the suite of 9 tests) doesn't cause any problems. How on earth do I troubleshoot and fix this? Also, I'm using @Entity annotations, if that matters. Edit: I removed reuse of my business objects (use unique objects in every method) -- didn't make a difference (still freezes). Edit: This started trickling into other tests, too (can't run more than one test class without getting something freezing) Transaction configuration: <bean id="txManager" class="org.springframework.jdbc.datasource.DataSourceTransactionManager"> <property name="dataSource" ref="dataSource" /> </bean> <tx:advice id="txAdvice" transaction-manager="txManager"> <!-- the transactional semantics... --> <tx:attributes> <!-- all methods starting with 'get' are read-only --> <tx:method name="get*" read-only="true" /> <tx:method name="find*" read-only="true" /> <!-- other methods use the default transaction settings (see below) --> <tx:method name="*" /> </tx:attributes> </tx:advice> <!-- my bean which is exhibiting the hanging behavior --> <aop:config> <aop:pointcut id="beanNameHere" expression="execution(* com.blah.blah.IMyDAO.*(..))" /> <aop:advisor advice-ref="txAdvice" pointcut-ref="beanNameHere" /> </aop:config>

    Read the article

  • How to get all captures of subgroup matches with preg_match_all()?

    - by hakre
    Update/Note: I think what I'm probably looking for is to get the captures of a group in PHP. Referenced: PCRE regular expressions using named pattern subroutines. (Read carefully:) I have a string that contains a variable number of segments (simplified): $subject = 'AA BB DD '; // could be 'AA BB DD CC EE ' as well I would like now to match the segments and return them via the matches array: $pattern = '/^(([a-z]+) )+$/i'; $result = preg_match_all($pattern, $subject, $matches); This will only return the last match for the capture group 2: DD. Is there a way that I can retrieve all subpattern captures (AA, BB, DD) with one regex execution? Isn't preg_match_all suitable for this? This question is a generalization. Both the $subject and $pattern are simplified. Naturally with such the general list of AA, BB, .. is much more easy to extract with other functions (e.g. explode) or with a variation of the $pattern. But I'm specifically asking how to return all of the subgroup matches with the preg_...-family of functions. For a real life case imagine you have multiple (nested) level of a variant amount of subpattern matches. Example This is an example in pseudo code to describe a bit of the background. Imagine the following: Regular definitions of tokens: CHARS := [a-z]+ PUNCT := [.,!?] WS := [ ] $subject get's tokenized based on these. The tokenization is stored inside an array of tokens (type, offset, ...). That array is then transformed into a string, containing one character per token: CHARS -> "c" PUNCT -> "p" WS -> "s" So that it's now possible to run regular expressions based on tokens (and not character classes etc.) on the token stream string index. E.g. regex: (cs)?cp to express one or more group of chars followed by a punctuation. As I now can express self-defined tokens as regex, the next step was to build the grammar. This is only an example, this is sort of ABNF style: words = word | (word space)+ word word = CHARS+ space = WS punctuation = PUNCT If I now compile the grammar for words into a (token) regex I would like to have naturally all subgroup matches of each word. words = (CHARS+) | ( (CHARS+) WS )+ (CHARS+) # words resolved to tokens words = (c+)|((c+)s)+c+ # words resolved to regex I could code until this point. Then I ran into the problem that the sub-group matches did only contain their last match. So I have the option to either create an automata for the grammar on my own (which I would like to prevent to keep the grammar expressions generic) or to somewhat make preg_match working for me somehow so I can spare that. That's basically all. Probably now it's understandable why I simplified the question. Related: pcrepattern man page Get repeated matches with preg_match_all()

    Read the article

  • Can you call FB.login inside a callback from other FB methods (like FB.getLoginStatus) without triggering popup blockers?

    - by Erik Kallevig
    I'm trying to set up a pretty basic authentication logic flow with the FB JavaScript SDK to check a user's logged-in status and permissions before performing an action (and prompting the user to login with permissions if they are not)... User types a message into a textarea on my site to post to their Facebook feed and click's a 'post to facebook' button on my site. In response to the click, I check user's logged in status with FB.getLoginStatus In the callback to FB.getLoginStatus, if user is not logged in, prompt them to login (FB.login). In the callback to FB.login I then need to make sure they have the right permissions so I make a call to FB.api('/me/permissions') -- if they don't , I again prompt them to login (FB.login) The problem I'm running into is that anytime I try to call FB.login inside a callback to other FB methods, the browser seems to lose track of the origin of execution (the click) and thus will block the popup. I'm wondering if I'm missing some way to prompt the user to login after checking their status without the browser mistakenly thinking that it's not a user-initiated popup? I've currently fallen back to just calling FB.login() first regardless. The undesired side effect of this approach, however, is that if the user is already logged-in with permissions and I'm still calling FB.login, the auth popup will open and close immediately before continuing, which looks rather buggy despite being functional. It seems like checking a user's login status and permissions before doing something would be a common flow so I feel like I'm missing something. Here's some example code. <div onclick="onClickPostBtn()">Post to Facebook</div> <script> // Callback to click on Post button. function onClickPostBtn() { // Check if logged in, prompt to do so if not. FB.getLoginStatus(function(response) { if (response.status === 'connected') { checkPermissions(response.authResponse.accessToken); } else { FB.login(function(){}, {scope: 'publish_stream'}) } }); } // Logged in, check permissions. function checkPermissions(accessToken) { FB.api('/me/permissions', {'access_token': accessToken}, function(response){ // Logged in and authorized for this site. if (response.data && response.data.length) { // Parse response object to check for permission here... if (hasPermission) { // Logged in with permission, perform some action. } else { // Logged in without proper permission, request login with permissions. FB.login(function(){}, {scope: 'publish_stream'}) } // Logged in to FB but not authorized for this site. } else { FB.login(function(){}, {scope: 'publish_stream'}) } } ); } </script>

    Read the article

  • Fail to save a managed object to core-data after its properties were updated.

    - by Tzur Gazit
    I have to trouble to create the object, but updating it fails. Here is the creation code: // Save data from pList to core data fro the first time - (void) saveToCoreData:(NSDictionary *)plistDictionary { // Create system parameter entity SystemParameters *systemParametersEntity = (SystemParameters *)[NSEntityDescription insertNewObjectForEntityForName:@"SystemParameters" inManagedObjectContext:mManagedObjectContext]; //// // GPS SIMULATOR //// NSDictionary *GpsSimulator = [plistDictionary valueForKey:@"GpsSimulator"]; [systemParametersEntity setMGpsSimulatorEnabled:[[GpsSimulator objectForKey:@"Enabled"] boolValue]]; [systemParametersEntity setMGpsSimulatorFileName:[GpsSimulator valueForKey:@"FileName"]]; [systemParametersEntity setMGpsSimulatorPlaybackSpeed:[[GpsSimulator objectForKey:@"PlaybackSpeed"] intValue]]; [self saveAction]; } During execution the cached copy is changed and then it is saved (or trying) to the database. Here is the code to save the changed copy: // Save data from pList to core data fro the first time - (void) saveSystemParametersToCoreData:(SystemParameters *)theSystemParameters { // Step 1: Select Data NSFetchRequest *fetchRequest = [[NSFetchRequest alloc] init]; NSEntityDescription *entity = [NSEntityDescription entityForName:@"SystemParameters" inManagedObjectContext:mManagedObjectContext]; [fetchRequest setEntity:entity]; NSError *error = nil; NSArray *items = [self.managedObjectContext executeFetchRequest:fetchRequest error:&error]; [fetchRequest release]; if (error) { NSLog(@"CoreData: saveSystemParametersToCoreData: Unresolved error %@, %@", error, [error userInfo]); abort(); } // Step 2: Update Object SystemParameters *systemParameters = [items objectAtIndex:0]; //// // GPS SIMULATOR //// [systemParameters setMGpsSimulatorEnabled:[theSystemParameters mGpsSimulatorEnabled]]; [systemParameters setMGpsSimulatorFileName:[theSystemParameters mGpsSimulatorFileName]]; [systemParameters setMGpsSimulatorPlaybackSpeed:[theSystemParameters mGpsSimulatorPlaybackSpeed]]; // Step 3: Save Updates [self saveAction]; } As to can see, I fetch the object that I want to update, change its values and save. Here is the saving code: - (void)saveAction { NSError *error; if (![[self mManagedObjectContext] save:&error]) { NSLog(@"ERROR:saveAction. Unresolved Core Data Save error %@, %@", error, [error userInfo]); exit(-1); } } The Persistent store method: - (NSPersistentStoreCoordinator *)persistentStoreCoordinator { if (mPersistentStoreCoordinator != nil) { return mPersistentStoreCoordinator; } NSString *path = [self databasePath]; NSURL *storeUrl = [NSURL fileURLWithPath:path]; NSError *error = nil; mPersistentStoreCoordinator = [[NSPersistentStoreCoordinator alloc] initWithManagedObjectModel:[self managedObjectModel]]; if (![mPersistentStoreCoordinator addPersistentStoreWithType:NSSQLiteStoreType configuration:nil URL:storeUrl options:nil error:&error]) { NSLog(@"Unresolved error %@, %@", error, [error userInfo]); abort(); } return mPersistentStoreCoordinator; } There is no error but the sqLite file is not updated, hence the data is not persistent. Thanks in advance.

    Read the article

< Previous Page | 136 137 138 139 140 141 142 143 144 145 146 147  | Next Page >