Search Results

Search found 8258 results on 331 pages for 'sequence points'.

Page 141/331 | < Previous Page | 137 138 139 140 141 142 143 144 145 146 147 148  | Next Page >

  • Php - please help to find two alternatives for ereg functions

    - by Guanche
    ereg and eregi functions will be deleted from Php. Please help to find alternatives for the following ereg functions: 1) To allow IP addresses only for specific ranges: $targetAddr = "60.37..*..*"; if (!ereg($targetAddr, $_SERVER['REMOTE_ADDR'])) { die; } 2) To replace series of points like ....................... $message = ereg_replace("[.]{3,}", "... ", $message);

    Read the article

  • change attributes of SVG graph without refresh

    - by Mike Hudak
    Hello, I have a simple SVG graph generated by GraphViz: <?xml version="1.0" encoding="UTF-8" standalone="no"?> <!DOCTYPE svg PUBLIC "-//W3C//DTD SVG 1.1//EN" "http://www.w3.org/Graphics/SVG/1.1/DTD/svg11.dtd"> <!-- Generated by graphviz version 2.26.3 (20100126.1600) --> <!-- Title: G Pages: 1 --> <svg width="138pt" height="168pt" viewBox="0.00 0.00 138.00 168.00" xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink"> <g id="graph1" class="graph" transform="scale(1 1) rotate(0) translate(4 164)"> <title>G</title> <polygon fill="white" stroke="white" points="-4,5 -4,-164 135,-164 135,5 -4,5"/> <!-- Node1 --> <g id="node1" class="node"><title>Node1</title> <a xlink:href="http://localhost/viz/applet.php" xlink:title="Internet"> <image xlink:href="images/cloud.png" width="130px" height="77px" preserveAspectRatio="xMinYMin meet" x="0" y="-159.5"/> <text text-anchor="middle" x="65" y="-116.4" font-family="Times New Roman,serif" font-size="14.00">&#39;.$Internet.&#39;</text> </a> </g> <!-- Node2 --> <g id="node2" class="node"><title>Node2</title> <a xlink:href="http://localhost/viz/applet.php"> <image xlink:href="images/file server.png" width="44px" height="45px" preserveAspectRatio="xMinYMin meet" x="43" y="-45.5"/> </a> </g> <!-- Node1&#45;&gt;Node2 --> <g id="edge2" class="edge"><title>Node1&#45;&gt;Node2</title> <a xlink:title="Bandwidth: 1544kbps&#10;Using link: 12%&#10;VOIP calls: 4&#10;Packet rate: 10000&#10;Packet loss: 2"> <path fill="none" stroke="black" d="M65,-82.2678C65,-73.5404 65,-64.358 65,-55.8964"/> <polygon fill="black" stroke="black" points="68.5001,-55.6524 65,-45.6524 61.5001,-55.6525 68.5001,-55.6524"/> </a> </g> </g> </svg> I want to change some atributes: for example " VOIP calls: 4 " -changing "4" to value from Database(LDAP) without refreshing whole SVG graph <a xlink:title="Bandwidth: 1544kbps&#10;Using link: 12%&#10;VOIP calls: 4&#10;Packet rate: 10000&#10;Packet loss: 2"> Thank you for your answers

    Read the article

  • Problem loading java properties

    - by markovuksanovic
    I am trying to load properties from a file (test.properties) The code I use is as follows: URL url = getClass().getResource("../resources/test.properties"); properties.load(url.openStream()); But when executing the second line I get a NPE. (null pointer exception) I'm not sure what's wrong here... I have checked that the file exists at the location where URL points to... Any help is appreciated....

    Read the article

  • segmented reduction with scattered segments

    - by Christian Rau
    I got to solve a pretty standard problem on the GPU, but I'm quite new to practical GPGPU, so I'm looking for ideas to approach this problem. I have many points in 3-space which are assigned to a very small number of groups (each point belongs to one group), specifically 15 in this case (doesn't ever change). Now I want to compute the mean and covariance matrix of all the groups. So on the CPU it's roughly the same as: for each point p { mean[p.group] += p.pos; covariance[p.group] += p.pos * p.pos; ++count[p.group]; } for each group g { mean[g] /= count[g]; covariance[g] = covariance[g]/count[g] - mean[g]*mean[g]; } Since the number of groups is extremely small, the last step can be done on the CPU (I need those values on the CPU, anyway). The first step is actually just a segmented reduction, but with the segments scattered around. So the first idea I came up with, was to first sort the points by their groups. I thought about a simple bucket sort using atomic_inc to compute bucket sizes and per-point relocation indices (got a better idea for sorting?, atomics may not be the best idea). After that they're sorted by groups and I could possibly come up with an adaption of the segmented scan algorithms presented here. But in this special case, I got a very large amount of data per point (9-10 floats, maybe even doubles if the need arises), so the standard algorithms using a shared memory element per thread and a thread per point might make problems regarding per-multiprocessor resources as shared memory or registers (Ok, much more on compute capability 1.x than 2.x, but still). Due to the very small and constant number of groups I thought there might be better approaches. Maybe there are already existing ideas suited for these specific properties of such a standard problem. Or maybe my general approach isn't that bad and you got ideas for improving the individual steps, like a good sorting algorithm suited for a very small number of keys or some segmented reduction algorithm minimizing shared memory/register usage. I'm looking for general approaches and don't want to use external libraries. FWIW I'm using OpenCL, but it shouldn't really matter as the general concepts of GPU computing don't really differ over the major frameworks.

    Read the article

  • Overriding or overloading?

    - by atch
    Guys I know this question is silly but just to make sure: Having in my class method: boolean equal(Document d) { //do something } I'm overloading this method nor overriding right? I know that this or similiar question will be on upcoming egzam and would be stupid to not get points for such a simple mistake;

    Read the article

  • Castle WCF DefaultServiceHostFactory in IIS: Accessing the ServiceHost

    - by user250837
    I am attempting to move from a self hosting architecture to hosting under IIS 6, primarily to take advantage of built in dynamic compression. I am using the Castle DefaultServiceHostFactory to provide the service to IIS in the .svc file. However, I need to programmatically specify certain end points and behaviours and I do not know how to retrieve the current ServiceHost. Is this be possible, or should I just look at other methods of compression independent of IIS?

    Read the article

  • How to find the ocean using Google Maps API

    - by geejay
    I am trying to figure out where the ocean is in an arbitrary Google Maps view. I actually have the lat lon (a range of points, when joined together form the coastline) of the coastline. But how do I tell which side of this line is the coastline? One possible solution would be to find the latlon of the nearest service or town or business or something, and then the ocean is obviously on the other side (given a small enough enclosing polygon). Is there a better way?

    Read the article

  • unknown action with will_paginate

    - by merlin
    In my users controller I have this in a method: @users = User.paginate :page => params[:page], :per_page => 10, The results are rendered on users/search. The 2nd page link points to users/search?page=2, but it leads to an unknown action error.

    Read the article

  • How do I get the available wifi APs and their signal strength in .net?

    - by LDomagala
    Is there any way to access all WiFi access points and their respective RSSI values using .NET? It would be really nice if I could do it without using unmanaged code or even better if it worked in mono as well as .NET. If it is possible i would appriciate a code sample. Thanks Here are a few similiar stackoverflow questions i found: -Get SSID of the wireless network I am connected to with C# .Net on Windows Vista -Managing wireless network connection in C# -Get BSSID (MAC address) of wireless access point from C#

    Read the article

  • Biggest Delphi nitpicks

    - by Mason Wheeler
    What sort of minor annoyances do you run into using Delphi? I'm not looking for major issues such as "I want a 64-bit compiler." Just little things that can be easily worked around but still should have been implemented better so you don't have to work around them? Marking this CW. I'm more interested in the answers than the points.

    Read the article

  • How do you throw an HTTP error with mod_python

    - by Zxaos
    I have a setup where I'm serving simple python pages using the mod_python publisher. At some points I'd like to have the python function raise a standard apache error - for example throwing a 500 error if a required file is missing. How can I throw an apache error from within a mod_python script?

    Read the article

  • Fit Map onto Google Map

    - by Viplime
    I would like to fit my map onto the same place in google maps.I have max 10 gps(latitude and longitude) positions on my map and I want to fit it on google maps using the points.I think I need to use overlay features of google maps.However, I need to transform my map to fit properly.How do i transform my map(image) to be able to fit it onto google maps? Is there an google method or API for it? Thanks.

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Ant hangs randomly with executing

    - by deltamatrix
    Hi, I have noticed in recent times that when invoking my ant scripts to build and unit test my Java app, it randomly hangs at various points in the execution. The ant scripts are been invoked from my local machine on my remote clearcase view. Has anyone else had this problem? Please advise if you can.

    Read the article

  • Sprite to Line Collision

    - by Alu
    If I have a sprite, how would I check collision between two points? For example, in a game I am making, I would like to draw multiple lines that my sprite collides against. I'm thinking that this is more flexible than other collision systems if I had a lot of platforms.

    Read the article

  • how to save poiner in C

    - by JosiP
    Hi In my app, for debugging i want to save pointer, before i do other operations on it eg: void foo(...) { /* suppose ptr1 points to one of my strcuts */ ptr1 = NULL; /* before that ptr1=NULL i want to save value of that pointer - how to do it ? */ } thx for any help

    Read the article

  • How to handle different screen resolution /screen size when developing a site ?

    - by Misha Moroshko
    I would like to develop a site using jQuery that will work with all major browsers. I thought to start with a basic layout (a header, a couple of tabs with content, and footer). I wonder how should I create this layout to support different screen resolution, screen size, or window size. Should I work in pixels / points / percents when defining width and height of the components ? Are there any jQuery plugins that can help me with this task ? Thanks !

    Read the article

< Previous Page | 137 138 139 140 141 142 143 144 145 146 147 148  | Next Page >