Search Results

Search found 5554 results on 223 pages for 'cool cs'.

Page 142/223 | < Previous Page | 138 139 140 141 142 143 144 145 146 147 148 149  | Next Page >

  • Paging with jQuery

    - by zurna
    I get data from another page using jQuery get method. But I have a small problem. Sometimes, data that I take from another page is too long so it's divided into pages. When the user clicks on 1, 2, 3, ... links he/she is redirected to the other page. However, I want data to be reloaded on the same page. Edit $('ul.thumbs li.pagination a').live('click', function() { var pageNumber = parseInt($(this).text().replace(/[^0-9]/g, '')); $.ajax({ type: "GET", url: "images.cs.asp?Process=ViewImages&PAGEID=<%=Request.QueryString("PAGEID")%>", success: function(data) { $("#ViewImages").html(data); }, error: function (XMLHttpRequest, textStatus, errorThrown) { $("#ViewImages").html('.'); } }); return false; });

    Read the article

  • How do you manually insert options into boost.Program_options?

    - by windfinder
    I have an application that uses Boost.Program_options to store and manage its configuration options. We are currently moving away from configuration files and using database loaded configuration instead. I've written an API that reads configuration options from the database by hostname and instance name. (cool!) However, as far as I can see there is no way to manually insert these options into the boost Program_options. Has anyone used this before, any ideas? The docs from boost seem to indicate the only way to get stuff in that map is by the store function, which either reads from the command line or config file (not what I want). Basically looking for a way to manually insert the DB read values in to the map.

    Read the article

  • How is the implicit segment register of a near pointer determined?

    - by Daniel Trebbien
    In section 4.3 of Intel 64® and IA-32 Architectures Software Developer's Manual. Volume 1: Basic Architecture, it says: A near pointer is a 32-bit offset ... within a segment. Near pointers are used for all memory references in a flat memory model or for references in a segmented model where the identity of the segment being accessed is implied. This leads me to wondering: how is the implied segment register determined? I know that (%eip) and displaced (%eip) (e.g. -4(%eip)) addresses use %cs by default, and that (%esp) and displaced (%esp) addresses use %ss, but what about (%eax), (%edx), (%edi), (%ebp) etc., and can the implicit segment register depend also on the instruction that the memory address operand appears in?

    Read the article

  • Where do you find images and graphics designers for your softwares ?

    - by ereOn
    Hi, As a programmer, I'm sure some of you already experienced the same problem: You create a good software (free, open-source, or for friend-only diffusion, whatever) relying on good code and good ideas but since you're a programmer and not an image designer, your program looks just bad. While it seems pretty easy to find motivated developpers to join for free an open-source project, it seems quite hard to find a single free graphic designer. What free and good resources do you usually use for your programs/websites ? Do you have any cool tip that you're willing to share ? Do you know any place where to find people involved into graphic design willing to participate to open-source projects ?

    Read the article

  • How to set ItemsSource?

    - by Mark
    This dialog makes no sense to me And I'm having trouble finding good tutorials on it. Most of the examples aren't detailed enough, or do stuff via code, but I'd like to take advantage of the IDE as much as possible. Whats the difference between ItemsSource and DataContext? I'd like to bind it to just a List for starters. I don't need SQL or databases or anything fancy. Where would I declare my list? In MainWindow.xaml.cs? How do I get it to appear in that dialog?

    Read the article

  • C++ IDE for OSX

    - by gprime
    When i was at university i wrote a lot of C++. I primarily used either Visual Studio (at the time it was version 6) or VIM (if i was on linux) as an editor to write my code. Since i have graduate and have been working primarily in web programming i have stopped writing C++. Since i graduated i have also bought myself and started using my Mac exclusively. I am now starting to get back to my C++ coding (just for fun) and would like an opinion on good IDE's for Mac. I am currently using xCode which seems kinda cool because it has everything built into it. Do any of you have any other IDE's that you would suggest that i give a shot or should i just stick to xCode?

    Read the article

  • Where do you find images and graphics for your softwares ?

    - by ereOn
    Hi, As a programmer, I'm sure some of you already experienced the same problem: You create a good software (free, open-source, or for friend-only diffusion, whatever) relying on good code and good ideas but since you're a programmer and not an image designer, your program looks just bad. While it seems pretty easy to find motivated developpers to join for free an open-source project, it seems quite hard to find a single free graphic designer. What free and good resources do you usually use for your programs/websites ? Do you have any cool tip that you're willing to share ?

    Read the article

  • How does the dataset determine the return type of a scalar query?

    - by Tobias Funke
    I am attempting to add a scalar query to a dataset. The query is pretty straight forward, it's just adding up some decimal values in a few columns and returning them. I am 100% confident that only one row and one column is returned, and that it is of decimal type (SQL money type). The problem is that for some reason, the generated method (in the .designer.cs code file) is returning a value of type object, when it should be decimal. What's strange is that there's another scalar query that has the exact same SQL but is returning decimal like it should. How does the dataset designer determine the data type, and how can I tell it to return decimal?

    Read the article

  • How can I get Facebook Profile image from email?

    - by Forbini
    There's an outlook plugin called Xobni that has a really cool feature, if a contact has an email address, it will fetch that contact's profile picture and display it. Their FAQ states the following: Xobni sends an encrypted email address to Facebook to retrieve the Facebook profile for the person who is currently being viewed in the Xobni sidebar. Your own Facebook profile is never altered by Xobni, and all Facebook privacy settings are strictly followed when viewing other profiles. I'd like to duplicate this functionality. However, I can't figure out which API call they're using. I'm assuming when they say "encrypted email address" that's laymen's terms for the email hash. Once a username is derived, the graph api looks ideal for actually fetching the image, but I'm having trouble going from email hash to profile ID.

    Read the article

  • Programmatically Setting the Version of a Window's Service on the ProjectInstaller

    - by user302004
    I have a Windows Service created in Visual Studio 2005 in C#. I have a setup project and a ProjectInstaller class. I also have code to programmatically get the version from the AssemblyFileVersionAttribute. I need to figure out where I set the version that I've obtained (and where this code should go). I tried placing it in the InitializeComponent method on ProjectInstaller.Designer.cs and then appending the version to serviceInstaller1.DisplayName and serviceInstaller1.ServiceName. This didn't work and you're not supposed to modify the contents of this method. Any ideas?

    Read the article

  • Programmatically set browser cookie (Firefox)

    - by Andrew
    I know from this question that Firefox 3.0 and up stores its cookies in an SQLite database. My question is: can you access this database from other desktop programs in such a way that you could add a cookie? I realize this has security implications. However, I do not want to read them at all. I want to be able to set one cookie if possible. I don't even want to overwrite a cookie. I just want to add it if it isn't there already. This is sort of a personal project I'm working on for fun. This question is mostly language agnostic. I would prefer a solution in C#, but proof of concept in any language will suffice. Extra credit: It would be cool to set the same cookie in Internet Explorer, too

    Read the article

  • Text property in a UserControl in C#

    - by yeyeyerman
    I have a control with a inner TextBox. I want to make a direct relationship between the Text property of the UserControl and the Text property of the TextBox. The first thing I realized is that Text was not being displayed in the Properties of the UserControl. Then I added the Browsable(true) attribute. [Browsable(true)] public override string Text { get { return m_textBox.Text; } set { m_textBox.Text = value; } } Now, the text will be shown for a while, but then is deleted. This is because the information is not written within the xxxx.Designer.cs. How can this behviour be changed?

    Read the article

  • .NET: Get all Outlook calendar items

    - by Qinnie
    How can I get all items from a specific calendar (for a specific date). Lets say for instance that I have a calendar with a recurring item every Monday evening. When I request all items like this: CalendarItems = CalendarFolder.Items; CalendarItems.IncludeRecurrences = true; I only get 1 item... Is there an easy way to get all items (main item + derived items) from a calendar? In my specific situation it can be possible to set a date limit but it would be cool just to get all items (my recurring items are time limited themselves). I'm using the Microsoft Outlook 12 Object library (Microsoft.Office.Interop.Outlook).

    Read the article

  • can a program written in C be faster than one written in OCaml and translated to C?

    - by Ole Jak
    So I have some cool Image Processing algorithm. I have written it in OCaml. It performs well. I now I can compile it as C code with such command ocamlc -output-obj -o foo.c foo.ml (I have a situation where I am not alowed to use OCaml compiler to bild my programm for my arcetecture, I can use only specialy modified gcc. so I will compile that programm with sometyhing like gcc -L/usr/lib/ocaml foo.c -lcamlrun -lm -lncurses and Itll run on my archetecture.) I want to know in general case can a program written in C be faster than one written in OCaml and translated to C?

    Read the article

  • Clear the form once form submitted

    - by zurna
    Once the form submitted, response from another page is printed to #GameStorySys. But values entered to the form still stays there. Is it possible for the form values to disappear (but the form should still stay) once the form submitted? $("[name='GameStoryForm']").click(function() { $.ajax({ type: "POST", data: $("#GameStoryForm").serialize(), url: "content/commentary/index.cs.asp?Process=EditLiveCommentaryStory&CommentaryID=<%=Request.QueryString("CommentaryID")%>", success: function(output) { $('#GameStorySys').html(output); }, error: function(output) { $('#GameStorySys').html(output); } }); });

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Method to register method to be called when event is raised

    - by zaidwaqi
    I have a Panel which contains 20 PictureBox controls. If a user clicks on any of the controls, I want a method within the Panel to be called. How do I do this? public class MyPanel : Panel { public MyPanel() { for(int i = 0; i < 20; i++) { Controls.Add(new PictureBox()); } } // DOESN'T WORK. // function to register functions to be called if the pictureboxes are clicked. public void RegisterFunction( <function pointer> func ) { foreach ( Control c in Controls ) { c.Click += new EventHandler( func ); } } } How do I implement RegisterFunction()? Also, if there are cool C# features that can make the code more elegant, please share.

    Read the article

  • How does the dataset designer determine the return type of a scalar query?

    - by Tobias Funke
    I am attempting to add a scalar query to a dataset. The query is pretty straight forward, it's just adding up some decimal values in a few columns and returning them. I am 100% confident that only one row and one column is returned, and that it is of decimal type (SQL money type). The problem is that for some reason, the generated method (in the .designer.cs code file) is returning a value of type object, when it should be decimal. What's strange is that there's another scalar query that has the exact same SQL but is returning decimal like it should. How does the dataset designer determine the data type, and how can I tell it to return decimal?

    Read the article

  • lambda+for_each+delete on STL containers

    - by rubenvb
    I'm trying to get a simple delete every pointer in my vector/list/... function written with an ultra cool lambda function. Mind you, I don't know c**p about those things :) template <typename T> void delete_clear(T const& cont) { for_each(T.begin(), T.end(), [](???){ ???->delete() } ); T.clear(); } I have no clue what to fill in for the ???'s. Any help is greatly appreciated!

    Read the article

  • C++ Questions about vectors

    - by xbonez
    Hey guys, I have a CS exam tomorrow. Just want to get a few questions cleared up. Thanks a lot, and I really appreciate the help. Que 1. What are parallel vectors? Vectors of the same length that contain data that is meant to be processed together Vectors that are all of the same data type Vectors that are of the same length Any vector of data type parallel Que 2. Arrays are faster and more efficient than vectors. True False Que 3. Arrays can be a return type of a function call. True False Que 4. Vectors can be a return type of a function call. True False

    Read the article

  • How to Use a Windows App with Embeded files and folders to copy to a destination. In C#

    - by Mark Sweetman
    I am trying to write a small application, whose only purpose is to copy some folders and .cs source files into a user specified Directory, I can do it easy enough by simply having the application look for the files and folders in its own install directory then copy them to thier destination Directory, but I was wondering if its possible to Embed the Folders and Files into the Application, so that when you run the application it creates or copies the folders and files from the exe app directly to the install directory, rather than searching for them in the apps install directory then copying them over. Basically Im trying to only have a single exe file rather than having an exe file and a bunch of folders and files along side it. Is this possible to do with just a Windows Form App without using an actual Installer Class?

    Read the article

  • How to change Session for only one route in asp.net mvc?

    - by denis_n
    How to handle Application_BeginRequest using a custom filter in asp.net mvc? I want to restore session only for one route (~/my-url). It would be cool, if I could create a custom filter and handle that. protected void Application_BeginRequest(object sender, EventArgs e) { var context = HttpContext.Current; if (string.Equals("~/my-url", context.Request.AppRelativeCurrentExecutionFilePath, StringComparison.OrdinalIgnoreCase)) { string sessionId = context.Request.Form["sessionId"]; if (sessionId != null) { HttpCookie cookie = context.Request.Cookies.Get("ASP.NET_SessionId"); if (cookie == null) { cookie = new HttpCookie("ASP.NET_SessionId"); } cookie.Value = sessionId; context.Request.Cookies.Set(cookie); } }

    Read the article

  • Example applications and benefits of using "C" , "C++" or "Java"

    - by Waltzy
    Ok, I'm revising for my upcoming year 2 exams on a CS course and its likely something like this will come up. my question is what is an ideal application that would especially benefit from the program features of each of the three languages? I have a vague idea but getting a second opinion could really help. JavaPortability, easy - good for GUIs. C++Fast but may requite significant changes in order to be moved from system to system, good for image processing. CI'm unsure here small embedded applications? Some clarification on this would be really appreciated, thanks again StackOverflow

    Read the article

  • Catching / Redirecting 404's (ASP.NET)

    - by maxp
    Ive noticed that when I request a page in ASP.NET (webforms) that does not exist, the 'StaticFile' handler deals with the error notification. Id like to be a bit more helpful in these situations. What is the correct way for me to intercept this 404, and as a result, run some code to redirect the user? Two ways Ive thought of doing which I currently don't really like are: 1 - Create a module that basically does a if (!file.exists($url){redirect to $correctedurl}) 2 - Modify the error.aspx.cs(or the default error page) to do something similar (yuck!)

    Read the article

  • How to copy a structure with pointers to data inside (so to copy pointers and data they point to)?

    - by Kabumbus
    so I have a structure like struct GetResultStructure { int length; char* ptr; }; I need a way to make a full copy of it meaning I need a copy to have a structure with new ptr poinnting on to copy of data I had in original structure. Is It any how possible? I mean any structure I have which contains ptrs will have some fields with its lengths I need a function that would copy my structure coping all ptrs and data they point to by given array of lengthes... Any cool boost function for it? Or any way how to create such function?

    Read the article

< Previous Page | 138 139 140 141 142 143 144 145 146 147 148 149  | Next Page >