Search Results

Search found 43200 results on 1728 pages for 'large object pattern'.

Page 143/1728 | < Previous Page | 139 140 141 142 143 144 145 146 147 148 149 150  | Next Page >

  • The simplest concurrency pattern

    - by Ilya Kogan
    Please, would you help me in reminding me of one of the simplest parallel programming techniques. How do I do the following in C#: Initial state: semaphore counter = 0 Thread 1: // Block until semaphore is signalled semaphore.Wait(); // wait until semaphore counter is 1 Thread 2: // Allow thread 1 to run: semaphore.Signal(); // increments from 0 to 1 It's not a mutex because there is no critical section, or rather you can say there is an infinite critical section. So what is it?

    Read the article

  • Dynamically create and cast objects at runtime

    - by vaibhav bindroo
    Let's say we have 2 classes A and B public class A{ private int member1; A() { member1 = 10; } public getMember(){ return member1; } } Class B is also on the same lines except that its member variable is named member2 and gets intitialized to say 20 inside the constructor. My Requirement : At runtime , I get a string which contains a className ( could be A or B). I want to dynamically create an object of this class along with invoking the constructor. How can I achieve this . I don't want to use interfaces for common functionality of above classes Morever, later on I set the properties of this raw object using Propery Builder Bean Util class based on a list of columns . Class clazz = Class.forName("className"); Obj obj = clazz.newInstance(); How I can dynamically convert that obj to className object.

    Read the article

  • Decorator Pattern on List<T> for DataGridView

    - by elector
    Hi all, I would like to apply a Decorator on List class and be able to bind it to the WinForms DataGirdView. I would like to know what members of List i need to implement for this new class to be able to bind it to DataGrid. Some of the methods from List I would hide with my decorated class methods and others I would just call _decoratedList.Method(). Is this an option for implementing Decorator on List type? Decorator: public class MyCustomList : List<MyObject> { List<MyObject> _decoratedList; . . . }

    Read the article

  • Cache for large read only database recommendation

    - by paddydub
    I am building site on with Spring, Hibernate and Mysql. The mysql database contains information on coordinates and locations etc, it is never updated only queried. The database contains 15000 rows of coordinates and 48000 rows of coordinate connections. Every time a request is processed, the application needs to read all these coordinates which is taking approx 3-4 seconds. I would like to set up a cache, to allow quick access to the data. I'm researching memcached at the moment, can you please advise if this would be my best option?

    Read the article

  • Non standard interaction among two tables to avoid very large merge

    - by riko
    Suppose I have two tables A and B. Table A has a multi-level index (a, b) and one column (ts). b determines univocally ts. A = pd.DataFrame( [('a', 'x', 4), ('a', 'y', 6), ('a', 'z', 5), ('b', 'x', 4), ('b', 'z', 5), ('c', 'y', 6)], columns=['a', 'b', 'ts']).set_index(['a', 'b']) AA = A.reset_index() Table B is another one-column (ts) table with non-unique index (a). The ts's are sorted "inside" each group, i.e., B.ix[x] is sorted for each x. Moreover, there is always a value in B.ix[x] that is greater than or equal to the values in A. B = pd.DataFrame( dict(a=list('aaaaabbcccccc'), ts=[1, 2, 4, 5, 7, 7, 8, 1, 2, 4, 5, 8, 9])).set_index('a') The semantics in this is that B contains observations of occurrences of an event of type indicated by the index. I would like to find from B the timestamp of the first occurrence of each event type after the timestamp specified in A for each value of b. In other words, I would like to get a table with the same shape of A, that instead of ts contains the "minimum value occurring after ts" as specified by table B. So, my goal would be: C: ('a', 'x') 4 ('a', 'y') 7 ('a', 'z') 5 ('b', 'x') 7 ('b', 'z') 7 ('c', 'y') 8 I have some working code, but is terribly slow. C = AA.apply(lambda row: ( row[0], row[1], B.ix[row[0]].irow(np.searchsorted(B.ts[row[0]], row[2]))), axis=1).set_index(['a', 'b']) Profiling shows the culprit is obviously B.ix[row[0]].irow(np.searchsorted(B.ts[row[0]], row[2]))). However, standard solutions using merge/join would take too much RAM in the long run. Consider that now I have 1000 a's, assume constant the average number of b's per a (probably 100-200), and consider that the number of observations per a is probably in the order of 300. In production I will have 1000 more a's. 1,000,000 x 200 x 300 = 60,000,000,000 rows may be a bit too much to keep in RAM, especially considering that the data I need is perfectly described by a C like the one I discussed above. How would I improve the performance?

    Read the article

  • Can't declare unused exception variable when using catch-all pattern

    - by b0x0rz
    what is a best practice in cases such as this one: try { // do something } catch (SpecificException ex) { Response.Redirect("~/InformUserAboutAn/InternalException/"); } the warning i get is that ex is never used. however all i need here is to inform the user, so i don't have a need for it. do i just do: try { // do something } catch { Response.Redirect("~/InformUserAboutAn/InternalException/"); } somehow i don't like that, seems strange!!? any tips? best practices? what would be the way to handle this. thnx

    Read the article

  • Hibernate session method to update object

    - by EugeneP
    I need this roadmap of a Hibernate managed object instance. First, I create an instance with initial properties and persist this object in a db. Then session associated with this object is closed. But still, I serialize my object and on the next step deserialize it, invoke some setters, and again, I need to update what changed in a database. What methods of Hibernate session should I use? persist() or save() on the first step and saveOrUpdate() on the second? In fact I see that saveOrUpdate() can be used on each step. What would you recommend?

    Read the article

  • Pattern for null settings

    - by user21243
    Hi, I would like to hear your thoughts and ideas about this one. in my application i have controls that are binded to objects properties. but.. the controls always looks like that: a check box, label that explain the settings and then the edited control (for ex: text box) when unchecking the checkbox i disable the text box (using binding) when the checkbox is unchecked i want the property to contain null, and when it is checked i would like the property to contain the text box's text. Of course text box can be NumericUpDown, ComboBox, DatePicker etc.. Do you have any smart way of doing it using binding or do i have to do everything on code; I really would like to a build a control that supports that and re-use it all over Ideas? Thanks,

    Read the article

  • Database for managing large volumes of (system) metrics

    - by symcbean
    Hi, I'm looking at building a system for managing and reporting stats on web page performance. I'll be collecting a lot more stats than are available in the standard log formats (approx 20 metrics) but compared to most types of database applications, the base data structure will be very simple. My problem is that I'll be accumulating a lot of data - in the region of 100,000 records (i.e. sets of metrics) per hour. Of course, resources are very limited! So that its possible to sensibly interact with the data, I'd need to consolidate each metric into one minute bins, broken down by URL, then for anything more than 1 day old, consolidated into 10 minute bins, then at 1 week, hourly bins. At the front end, I want to provide a view (prefereably as plots) of the last hour of data, with the facility for users to drill up/down through defined hierarchies of URLs (which do not always map directly to the hierarchy expressed in the path of the URL) and to view different time frames. Rather than coding all this myself and using a relational database, I was wondering if there were tools available which would facilitate both the management of the data and the reporting. I had a look at Mondrian however I can't see from the documentation I've looked at whether it's possible to drop the more granular information while maintaining the consolidated views of the data. RRDTool looks promising in terms of managing the data consolidation, but seems to be rather limited in terms of querying the dataset as a multi-dimensional/relational database. What else whould I be looking at?

    Read the article

  • Finding cause of memory leaks in large PHP stacks

    - by Mike B
    I have CLI script that runs over several thousand iterations between runs and it appears to have a memory leak. I'm using a tweaked version of Zend Framework with Smarty for view templating and each iteration uses several MB worth of code. The first run immediately uses nearly 8MB of memory (which is fine) but every following run adds about 80kb. My main loop looks like this (very simplified) $users = UsersModel::getUsers(); foreach($users as $user) { $obj = new doSomethingAwesome(); $obj->run($user); $obj = null; unset($obj); } The point is that everything in scope should be unset and the memory freed. My understanding is that PHP runs through its garbage collection process at it's own desire but it does so at the end of functions/methods/scripts. So something must be leaking memory inside doSomethingAwesome() but as I said it is a huge stack of code. Ideally, I would love to find some sort of tool that displayed all my variables no matter the scope at some point during execution. Some sort of symbol-table viewer for php. Does anything like that or any other tools that could help nail down memory leaks in php exist?

    Read the article

  • Reverse massive text file in Java

    - by DanJanson
    What would be the best approach to reverse a large text file that is uploaded asynchronously to a servlet that reverses this file in a scalable and efficient way? text file can be massive (gigabytes long) can assume mulitple server/clustered environment to do this in a distributed manner. open source libraries are encouraged to consider I was thinking of using Java NIO to treat file as an array on disk (so that I don't have to treat the file as a string buffer in memory). Also, I am thinking of using MapReduce to break up the file and process it in separate machines. Any input is appreciated. Thanks. Daniel

    Read the article

  • parse part of the text from regex pattern

    - by dalco
    I have a string: [\n['-','some text what\rcontains\nnewlines'],\n\n trying to parse: Regex.Split(@"[\n['-','some text what contains newlines'],\n\n", @"\[\n\['(.*)','(.*)'],.*"); but the split return array seems to be null i need to get part of text: "some text what contains newlines"

    Read the article

  • Large tables of static data with DBGhost

    - by Paulo Manuel Santos
    We are thinking of restructuring our database development and deployment processes by using DBGhost, we want to move away from the central development database and bring the database to the source control. One of the problems we have is a big table with static data (containing translated language strings), it has close to 200K rows. I know that our best solution is to move these stings into resource files, but until we implement that, will DbGhost be able to maintain all this static data and generate our development and deployment databases in a short time? And if not is there a good alternative to filling up this table whenever we need to?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • populate object graph from database

    - by Rama
    Hi, I would like to know the best way to populate an object that has a collection of child objects and each child object may inturn have a collection of objects, from database without making multiple calls to the database to get child objects for each object. basically in hierarchical format something like for example a customer has orders and each order has order items. is it best to retrieve the data in xml format (SQL server 2005), or retrieve a dataset by joining the related tables together and then map that the data to the object? thanks in advance for your help.

    Read the article

  • Migrating from Physical SQL (SQL2000) To VMWare machine (SQL2008) - Transferring Large DB

    - by alex
    We're in the middle of migrating from a windows & SQL 2000 box to a Virtualised Win & SQL 2k8 box The VMWare box is on a different site, with better hardware, connectivity etc... The old(current) physical machine is still in constant use - I've taken a backup of the DB on this machine, which is 21GB Transfering this to our virtual machine took around 7+ hours - which isn't ideal when we do the "actual" switchover. My question is - How should I handle the migration better? Could i set up our current machine to do log shipping to the VM machine to keep up to date? then, schedule down time out of hours to do the switch over? Is there a better way?

    Read the article

  • Google App Engine - Dealing with concurrency issues of storing an object

    - by Spines
    My User object that I want to create and store in the datastore has an email, and a username. How do I make sure when creating my User object that another User object doesn't also have either the same email or the same username? If I just do a query to see if any other users have already used the username or the email, then there could be a race condition. UPDATE: The solution I'm currently considering is to use the MemCache to implement a locking mechanism. I would acquire 2 locks before trying to store the User object in the datastore. First a lock that locks based on email, then another that locks based on username. Since creating new User objects only happens at user registration time, and it's even rarer that two people try to use either the same username or the same email, I think it's okay to take the performance hit of locking. I'm thinking of using the MemCache locking code that is here: http://appengine-cookbook.appspot.com/recipe/mutex-using-memcache-api/ What do you guys think?

    Read the article

  • bitshift large strings for encoding QR Codes

    - by icekreaman
    As an example, suppose a QR Code data stream contains 55 data words (each one byte in length) and 15 error correction words (again one byte). The data stream begins with a 12 bit header and ends with four 0 bits. So, 12 + 4 bits of header/footer and 15 bytes of error correction, leaves me 53 bytes to hold 53 alphanumeric characters. The 53 bytes of data and 15 bytes of ec are supplied in a string of length 68 (str68). The problem seems simple enough - concatenate 2 bytes of (right-shifted) header data with str68 and then left shift the entire 70 bytes by 4 bits. This is the first time in many years of programming that I have ever needed to do something like this, I am a c and bit shifting noob, so please be gentle... I have done a little investigation and so far have not been able to figure out how to bitshift 70 bytes of data; any help would be greatly appreciated. Larger QR codes can hold 2000 bytes of data...

    Read the article

  • Canonical pattern reference in Actors programming model.

    - by Bubba88
    Hello! Is there a source, which I could use to learn some of the most used and popular practices regarding Actor-/Agent-oriented programming. My primary concern is about parallelism and distribution limited to the mentioned scheme - Actors, message passing. Should I begin with Erlang documentation or maybe there is any kind of book that describes the most important building blocks when programming Actor-oriented? Thank you! (Most useful examples would be in Scala or F#)

    Read the article

  • Managing Large Database Entity Models

    - by ChiliYago
    I would like hear how other's are effectively (or not) working with the Visual Studio Entity Designer when many database tables exists. It seems to me that navigating the Designer is tough enough to find what you are looking for with just a few tables but how about a database with say 100 to 200 tables? When a table change is made at the database level how is the model updated? Does it overwrite any manual changes you have made to the model? How would you quickly find an entity in the designer to make a change or inspect a change? Seems unrealistic to be scrolling around looking for specific entity. Thanks for your feedback!

    Read the article

  • Objective C code to handle large amount of data processing in iPhone

    - by user167662
    I had the following code that takes in 14 mb or more of image data encoded in base4 string and converts them to jpeg before writing to a file in iphone. It crashes my program giving the following error : Program received signal: “0”. warning: check_safe_call: could not restore current frame I tweak my program and it can process a few more images before the error appear again. My coding is as follows: // parameters is an array where the fourth element contains a list of images in base64 >encoded string NSMutableArray *imageStrList = (NSMutableArray*) [parameters objectAtIndex:5]; while (imageStrList.count != 0) { NSString *imgString = [imageStrList objectAtIndex:0]; // Create a file name using my own Utility class NSString *fileName = [Utility generateFileNName]; NSData *restoredImg = [NSData decodeWebSafeBase64ForString:imgString]; UIImage *img = [UIImage imageWithData: restoredImg]; NSData *imgJPEG = UIImageJPEGRepresentation(img, 0.4f); [imgJPEG writeToFile:fileName atomically:YES]; [imageStrList removeObjectAtIndex:0]; } I tried playing around with UIImageJPEGRepresentation and found out that the lower the value, the more image it can processed but this should not be the way. I am wondering if there is anyway to free up memory of the imageStrList immediately after processing each image so that it can be used by the next one in the line.

    Read the article

  • design pattern tools to use?

    - by ajsie
    i have noticed that every area has some tools you can use to make things easier. eg. css = dreamweaver doctrine/propel = orm designer // you dont have to hardcore code schemas manually and remembering all the syntax/variables mysql = mysql workbench // the same etc. in this way you get aided and dont have to type things the hard way, and can learn the structure, but then use GUI tools to help you develop faster. now i'm learning design patterns (singleton, factory, command, memento etc) and im wondering if there are some kind of tools you can use that will help you develop faster. i dont know exactly what tools i'm trying to find, just helping me when coding with design patterns (schema drawings? references?) are there any?

    Read the article

  • Best practice to modularise a large Grails app?

    - by Mulone
    Hi all, A Grails app I'm working on is becoming pretty big, and it would be good to refactor it into several modules, so that we don't have to redeploy the whole thing every time. In your opinion, what is the best practice to split a Grails app in several modules? In particular I'd like to create a package of domain classes + relevant services and use it in the app as a module. Is this possible? Is it possible to do it with plugins? Cheers, Mulone

    Read the article

< Previous Page | 139 140 141 142 143 144 145 146 147 148 149 150  | Next Page >