Search Results

Search found 3836 results on 154 pages for 'argument'.

Page 144/154 | < Previous Page | 140 141 142 143 144 145 146 147 148 149 150 151  | Next Page >

  • Virtual member call in a constructor when assigning value to property

    - by comecme
    I have an Abstract class and a Derived class. The abstract class defines an abstract property named Message. In the derived class, the property is implemented by overriding the abstract property. The constructor of the derived class takes a string argument and assigns it to its Message property. In Resharper, this assignment leads to a warning "Virtual member call in constructor". The AbstractClass has this definition: public abstract class AbstractClass { public abstract string Message { get; set; } protected AbstractClass() { } public abstract void PrintMessage(); } And the DerivedClass is as follows: using System; public class DerivedClass : AbstractClass { private string _message; public override string Message { get { return _message; } set { _message = value; } } public DerivedClass(string message) { Message = message; // Warning: Virtual member call in a constructor } public DerivedClass() : this("Default DerivedClass message") {} public override void PrintMessage() { Console.WriteLine("DerivedClass PrintMessage(): " + Message); } } I did find some other questions about this warning, but in those situations there is an actual call to a method. For instance, in this question, the answer by Matt Howels contains some sample code. I'll repeat it here for easy reference. class Parent { public Parent() { DoSomething(); } protected virtual void DoSomething() {}; } class Child : Parent { private string foo; public Child() { foo = "HELLO"; } protected override void DoSomething() { Console.WriteLine(foo.ToLower()); } } Matt doesn't describe on what error the warning would appear, but I'm assuming it will be on the call to DoSomething in the Parent constructor. In this example, I understand what is meant by a virtual member being called. The member call occurs in the base class, in which only a virtual method exists. In my situation however, I don't see why assigning a value to Message would be calling a virtual member. Both the call to and the implementation of the Message property are defined in the derived class. Although I can get rid of the error by making my Derived Class sealed, I would like to understand why this situation is resulting in the warning.

    Read the article

  • Using fft2 with reshaping for an RGB filter

    - by Mahmoud Aladdin
    I want to apply a filter on an image, for example, blurring filter [[1/9.0, 1/9.0, 1/9.0], [1/9.0, 1/9.0, 1/9.0], [1/9.0, 1/9.0, 1/9.0]]. Also, I'd like to use the approach that convolution in Spatial domain is equivalent to multiplication in Frequency domain. So, my algorithm will be like. Load Image. Create Filter. convert both Filter & Image to Frequency domains. multiply both. reconvert the output to Spatial Domain and that should be the required output. The following is the basic code I use, the image is loaded and displayed as cv.cvmat object. Image is a class of my creation, it has a member image which is an object of scipy.matrix and toFrequencyDomain(size = None) uses spf.fftshift(spf.fft2(self.image, size)) where spf is scipy.fftpack and dotMultiply(img) uses scipy.multiply(self.image, image) f = Image.fromMatrix([[1/9.0, 1/9.0, 1/9.0], [1/9.0, 1/9.0, 1/9.0], [1/9.0, 1/9.0, 1/9.0]]) lena = Image.fromFile("Test/images/lena.jpg") print lena.image.shape lenaf = lena.toFrequencyDomain(lena.image.shape) ff = f.toFrequencyDomain(lena.image.shape) lenafm = lenaf.dotMultiplyImage(ff) lenaff = lenafm.toTimeDomain() lena.display() lenaff.display() So, the previous code works pretty well, if I told OpenCV to load the image via GRAY_SCALE. However, if I let the image to be loaded in color ... lena.image.shape will be (512, 512, 3) .. so, it gives me an error when using scipy.fttpack.ftt2 saying "When given, Shape and Axes should be of same length". What I tried next was converted my filter to 3-D .. as [[[1/9.0, 1/9.0, 1/9.0], [1/9.0, 1/9.0, 1/9.0], [1/9.0, 1/9.0, 1/9.0]], [[1/9.0, 1/9.0, 1/9.0], [1/9.0, 1/9.0, 1/9.0], [1/9.0, 1/9.0, 1/9.0]], [[1/9.0, 1/9.0, 1/9.0], [1/9.0, 1/9.0, 1/9.0], [1/9.0, 1/9.0, 1/9.0]]] And, not knowing what the axes argument do, I added it with random numbers as (-2, -1, -1), (-1, -1, -2), .. etc. until it gave me the correct filter output shape for the dotMultiply to work. But, of course it wasn't the correct value. Things were totally worse. My final trial, was using fft2 function on each of the components 2-D matrices, and then re-making the 3-D one, using the following code. # Spiltting the 3-D matrix to three 2-D matrices. for i, row in enumerate(self.image): r.append(list()) g.append(list()) b.append(list()) for pixel in row: r[i].append(pixel[0]) g[i].append(pixel[1]) b[i].append(pixel[2]) rfft = spf.fftshift(spf.fft2(r, size)) gfft = spf.fftshift(spf.fft2(g, size)) bfft = spf.fftshift(spf.fft2(b, size)) newImage.image = sp.asarray([[[rfft[i][j], gfft[i][j], bfft[i][j]] for j in xrange(len(rfft[i]))] for i in xrange(len(rfft))] ) return newImage Any help on what I made wrong, or how can I achieve that for both GreyScale and Coloured pictures.

    Read the article

  • Same data being returned by linq for 2 different executions of a stored procedure?

    - by Paul
    Hello I have a stored procedure that I am calling through Entity Framework. The stored procedure has 2 date parameters. I supply different argument in the 2 times I call the stored procedure. I have verified using SQL Profiler that the stored procedure is being called correctly and returning the correct results. When I call my method the second time with different arguments, even though the stored procedure is bringing back the correct results, the table created contains the same data as the first time I called it. dtStart = 01/08/2009 dtEnd = 31/08/2009 public List<dataRecord> GetData(DateTime dtStart, DateTime dtEnd) { var tbl = from t in db.SP(dtStart, dtEnd) select t; return tbl.ToList(); } GetData((new DateTime(2009, 8, 1), new DateTime(2009, 8, 31)) // tbl.field1 value = 45450 - CORRECT GetData(new DateTime(2009, 7, 1), new DateTime(2009, 7, 31)) // tbl.field1 value = 45450 - WRONG 27456 expected Is this a case of Entity Framework being clever and caching? I can't see why it would cache this though as it has executed the stored procedure twice. Do I have to do something to close tbl? using Visual Studio 2008 + Entity Framework. I also get the message "query cannot be enumerated more than once" a few times every now and then, am not sure if that is relevant? FULL CODE LISTING namespace ProfileDataService { public partial class DataService { public static List<MeterTotalConsumpRecord> GetTotalAllTimesConsumption(DateTime dtStart, DateTime dtEnd, EUtilityGroup ug, int nMeterSelectionType, int nCustomerID, int nUserID, string strSelection, bool bClosedLocations, bool bDisposedLocations) { dbChildDataContext db = DBManager.ChildDataConext(nCustomerID); var tbl = from t in db.GetTotalConsumptionByMeter(dtStart, dtEnd, (int) ug, nMeterSelectionType, nCustomerID, nUserID, strSelection, bClosedLocations, bDisposedLocations, 1) select t; return tbl.ToList(); } } } /// CALLER List<MeterTotalConsumpRecord> _P1Totals; List<MeterTotalConsumpRecord> _P2Totals; public void LoadData(int nUserID, int nCustomerID, ELocationSelectionMethod locationSelectionMethod, string strLocations, bool bIncludeClosedLocations, bool bIncludeDisposedLocations, DateTime dtStart, DateTime dtEnd, ReportsBusinessLogic.Lists.EPeriodType durMainPeriodType, ReportsBusinessLogic.Lists.EPeriodType durCompareToPeriodType, ReportsBusinessLogic.Lists.EIncreaseReportType rptType, bool bIncludeDecreases) { ///Code for setting properties using parameters.. _P2Totals = ProfileDataService.DataService.GetTotalAllTimesConsumption(_P2StartDate, _P2EndDate, EUtilityGroup.Electricity, 1, nCustomerID, nUserID, strLocations, bIncludeClosedLocations, bIncludeDisposedLocations); _P1Totals = ProfileDataService.DataService.GetTotalAllTimesConsumption(_StartDate, _EndDate, EUtilityGroup.Electricity, 1, nCustomerID, nUserID, strLocations, bIncludeClosedLocations, bIncludeDisposedLocations); PopulateLines() //This fills up a list of objects with information for my report ready for the totals to be added PopulateTotals(_P1Totals, 1); PopulateTotals(_P2Totals, 2); } void PopulateTotals(List<MeterTotalConsumpRecord> objTotals, int nPeriod) { MeterTotalConsumpRecord objMeterConsumption = null; foreach (IncreaseReportDataRecord objLine in _Lines) { objMeterConsumption = objTotals.Find(delegate(MeterTotalConsumpRecord t) { return t.MeterID == objLine.MeterID; }); if (objMeterConsumption != null) { if (nPeriod == 1) { objLine.P1Consumption = (double)objMeterConsumption.Consumption; } else { objLine.P2Consumption = (double)objMeterConsumption.Consumption; } objMeterConsumption = null; } } } }

    Read the article

  • Solr Facet Search spring-data-solr

    - by sv1
    I am new to Solr and we are using Spring-data for Solr I have a question may be its too simple but I am unable to comprehend. Basically I need to search on any field but I have a "zip" field as one of the facet fields. I have a Solr repository . (Am not sure if the annotations on the Repository are correct.) public interface MyRepository extends SolrCrudRepository<MyPOJO, String> { @Query(value = "*:*") @Facet(fields={"zip"}) public FacetPage<MyPOJO> findByQueryandAnno(String searchTerm,Pageable page); } In my Service class I am trying to call this methods by Injecting MyRepository like below public class MyService { @Inject MyRepository solrRepo; @Inject SolrTemplate solrTemplate; public FacetPage<MyPOJO> tryFacets(String searchString){ //Here is where I am struggling SimpleFacetQuery query = new SimpleQuery(new SimpleStringCriteria(searchString)); query.setFacetOptions(new FacetOptions("zip")); //Not sure how to get the Pageable object. //But the repository doesnt accept without it. return solrTemplate.queryForPage(query,{Pageable Instance to be passed here}) } From my jUnit I am loading context files needed for Solr and Spring //In jUnit the test method looks like this service.tryFacets("some value"); and it fails with - method not found in the service class at the call to the repository method. *********EDIT**************** As per ChristophStrobl's advice created a copyfield called multivaluedCopyField and the searchString argument works good. But the facet still isnt working...Now my code looks like this. I get the MyPOJO object as response but the facetcount and the faceted values are missing. public interface MyRepository extends SolrCrudRepository<MyPOJO, String> { @Query(value = "*:*") @Facet(fields={"zip"}) public FacetPage<MyPOJO> findByQueryandAnno(String searchTerm,Pageable page); } My service class looks like public class MyService { @Inject MyRepository solrRepo; public FacetPage<MyPOJO> tryFacets(String searchString){ //Here is where I am struggling SimpleFacetQuery query = new SimpleQuery(new SimpleStringCriteria(searchString)).setPageRequest new PageRequest(0,5)); query.setFacetOptions(new FacetOptions("zip")); FacetPage<MyPOJO> facetedPOJO= solrRepo.findByQueryandAnno(searchString,query.getPageRequest()); return facetedPOJO; } My jUnit method call is like service.tryFacets("some value");

    Read the article

  • Is this a valid pattern for raising events in C#?

    - by Will Vousden
    Update: For the benefit of anyone reading this, since .NET 4, the lock is unnecessary due to changes in synchronization of auto-generated events, so I just use this now: public static void Raise<T>(this EventHandler<T> handler, object sender, T e) where T : EventArgs { if (handler != null) { handlerCopy(sender, e); } } And to raise it: SomeEvent.Raise(this, new FooEventArgs()); Having been reading one of Jon Skeet's articles on multithreading, I've tried to encapsulate the approach he advocates to raising an event in an extension method like so (with a similar generic version): public static void Raise(this EventHandler handler, object @lock, object sender, EventArgs e) { EventHandler handlerCopy; lock (@lock) { handlerCopy = handler; } if (handlerCopy != null) { handlerCopy(sender, e); } } This can then be called like so: protected virtual void OnSomeEvent(EventArgs e) { this.someEvent.Raise(this.eventLock, this, e); } Are there any problems with doing this? Also, I'm a little confused about the necessity of the lock in the first place. As I understand it, the delegate is copied in the example in the article to avoid the possibility of it changing (and becoming null) between the null check and the delegate call. However, I was under the impression that access/assignment of this kind is atomic, so why is the lock necessary? Update: With regards to Mark Simpson's comment below, I threw together a test: static class Program { private static Action foo; private static Action bar; private static Action test; static void Main(string[] args) { foo = () => Console.WriteLine("Foo"); bar = () => Console.WriteLine("Bar"); test += foo; test += bar; test.Test(); Console.ReadKey(true); } public static void Test(this Action action) { action(); test -= foo; Console.WriteLine(); action(); } } This outputs: Foo Bar Foo Bar This illustrates that the delegate parameter to the method (action) does not mirror the argument that was passed into it (test), which is kind of expected, I guess. My question is will this affect the validity of the lock in the context of my Raise extension method? Update: Here is the code I'm now using. It's not quite as elegant as I'd have liked, but it seems to work: public static void Raise<T>(this object sender, ref EventHandler<T> handler, object eventLock, T e) where T : EventArgs { EventHandler<T> copy; lock (eventLock) { copy = handler; } if (copy != null) { copy(sender, e); } }

    Read the article

  • Best practices regarding equals: to overload or not to overload?

    - by polygenelubricants
    Consider the following snippet: import java.util.*; public class EqualsOverload { public static void main(String[] args) { class Thing { final int x; Thing(int x) { this.x = x; } public int hashCode() { return x; } public boolean equals(Thing other) { return this.x == other.x; } } List<Thing> myThings = Arrays.asList(new Thing(42)); System.out.println(myThings.contains(new Thing(42))); // prints "false" } } Note that contains returns false!!! We seems to have lost our things!! The bug, of course, is the fact that we've accidentally overloaded, instead of overridden, Object.equals(Object). If we had written class Thing as follows instead, then contains returns true as expected. class Thing { final int x; Thing(int x) { this.x = x; } public int hashCode() { return x; } @Override public boolean equals(Object o) { return (o instanceof Thing) && (this.x == ((Thing) o).x); } } Effective Java 2nd Edition, Item 36: Consistently use the Override annotation, uses essentially the same argument to recommend that @Override should be used consistently. This advice is good, of course, for if we had tried to declare @Override equals(Thing other) in the first snippet, our friendly little compiler would immediately point out our silly little mistake, since it's an overload, not an override. What the book doesn't specifically cover, however, is whether overloading equals is a good idea to begin with. Essentially, there are 3 situations: Overload only, no override -- ALMOST CERTAINLY WRONG! This is essentially the first snippet above Override only (no overload) -- one way to fix This is essentially the second snippet above Overload and override combo -- another way to fix The 3rd situation is illustrated by the following snippet: class Thing { final int x; Thing(int x) { this.x = x; } public int hashCode() { return x; } public boolean equals(Thing other) { return this.x == other.x; } @Override public boolean equals(Object o) { return (o instanceof Thing) && (this.equals((Thing) o)); } } Here, even though we now have 2 equals method, there is still one equality logic, and it's located in the overload. The @Override simply delegates to the overload. So the questions are: What are the pros and cons of "override only" vs "overload & override combo"? Is there a justification for overloading equals, or is this almost certainly a bad practice?

    Read the article

  • Supporting multiple instances of a plugin DLL with global data

    - by Bruno De Fraine
    Context: I converted a legacy standalone engine into a plugin component for a composition tool. Technically, this means that I compiled the engine code base to a C DLL which I invoke from a .NET wrapper using P/Invoke; the wrapper implements an interface defined by the composition tool. This works quite well, but now I receive the request to load multiple instances of the engine, for different projects. Since the engine keeps the project data in a set of global variables, and since the DLL with the engine code base is loaded only once, loading multiple projects means that the project data is overwritten. I can see a number of solutions, but they all have some disadvantages: You can create multiple DLLs with the same code, which are seen as different DLLs by Windows, so their code is not shared. Probably this already works if you have multiple copies of the engine DLL with different names. However, the engine is invoked from the wrapper using DllImport attributes and I think the name of the engine DLL needs to be known when compiling the wrapper. Obviously, if I have to compile different versions of the wrapper for each project, this is quite cumbersome. The engine could run as a separate process. This means that the wrapper would launch a separate process for the engine when it loads a project, and it would use some form of IPC to communicate with this process. While this is a relatively clean solution, it requires some effort to get working, I don't now which IPC technology would be best to set-up this kind of construction. There may also be a significant overhead of the communication: the engine needs to frequently exchange arrays of floating-point numbers. The engine could be adapted to support multiple projects. This means that the global variables should be put into a project structure, and every reference to the globals should be converted to a corresponding reference that is relative to a particular project. There are about 20-30 global variables, but as you can imagine, these global variables are referenced from all over the code base, so this conversion would need to be done in some automatic manner. A related problem is that you should be able to reference the "current" project structure in all places, but passing this along as an extra argument in each and every function signature is also cumbersome. Does there exist a technique (in C) to consider the current call stack and find the nearest enclosing instance of a relevant data value there? Can the stackoverflow community give some advice on these (or other) solutions?

    Read the article

  • What would you suggest as a high school first language?

    - by ldigas
    Edit by OA: After reading some answers I'll just update the question a little. At first I put it a little bluntly, but some of those gave me some good arguments which have to be taken into consideration while making a stand on this one. (these are mostly picked up from comments and answers below). A few things to take into account: to many pupils this is a first programming language - at this stage most of them have trouble grasping a difference between data types, variable passing, ... and whatnot, less alone pointers and similar 'low level stuff' :) they will all have to pass this to get into next grade (well, big majority of them anyway) not all of them have computers at home, not all of them are willing to learn this, less alone interested in - so the concepts have to be taught on a finite time scale in school hours (as well as practice on computers) free literature is a bonus - the teacher will make some scripts and handaways, but still ... I wouldn't like to bear the parents with the burden of buying expensive literature (also, english is not a native language here ... and although they are all learning it, their ability to read it fluently is somewhat questionable) somebody gave an argument - "a language which does not get in the way of ideas" - good one accessibility on different platforms in not expecially important at this point - although most of the suggested ones are available on win as well as linux - not many macs in this part of europe (their prices are sky high for anything but specialised usage) I will check what are the licencing issues on ms express editions about using it massively in high schools for purposes like this - if someone has any info about this, please, do not be shy with it :) A friend of mine, informatics teacher - in EU it comes as something as junior cs teacher, in a local high school asked me what I thought about what should be the first language pupils should be taught? It is a technical school (a little more oriented towards mathematics than the gymnasium, but not computer oriented totally). So I'm asking you - what do you think should be the first language pupils are exposed to in highschool? They have been teaching Pascal so far, but she's not sure that's a good course. She thought about switching to C (which I resented; considering not all pupils have interests in programming, to start with, and should be taught something higher level since they are just gripping the idea of a loop and such ... for a start), I suggested python or ruby (preferably py since it handles all paradigms). What is your opinion on this one? I looked, but didn't find a similar question on SO, so if there is one, please just point me towards it. Edit: The assumption is that none of the pupils have been exposed to any programming in junior school. See also: What is the best way to teach young kids some basic programming concepts? Best ways to teach a beginner to program How and when do you teach a kid to code What is the easiest language to start with? High School Programming

    Read the article

  • Few doubts regarding Bitmaps , Images & `using` blocks

    - by imageWorker
    I caught up in this problem. http://stackoverflow.com/questions/2559826/garbage-collector-not-doing-its-job-memory-consumption-1-5gb-outofmemory-exc I feel that there is something wrong in my understanding. Please clarify these things. Destructor & IDisposable.Dispose are two methods for freeing resources that are not not under the control of .NET. Which means, everything except memory. right? using blocks are just better way of calling IDisposable.Dispose() method of an object. This is the main code I'm referring to. class someclass { static someMethod(Bitmap img) { Bitmap bmp = new Bitmap(img); //statement1 // some code here and return } } here is class I'm using for testing: class someotherClass { public static voide Main() { foreach (string imagePath in imagePathsArray) { using (Bitmap img1 = new Bitmap(imagePath)) { someclass.someMethod(img1); // does some more processing on `img1` } } } } Is there any memory leak with statement1? Question1: If each image size is say 10MB. Then does this bmp object occupy atleast 10MB? What I mean is, will it make completely new copy of entire image? or just refer to it? Question2:should I or should I not put the statement1 in using block? My Argument: We should not. Because using is not for freeing memory but for freeing the resources (file handle in this case). If I use it in using block. It closes file handle here encapsulated by this bmp object. It means we are also closing filehandle for the caller's img1 object. Which is not correct? As of the memory leak. No there is no scope of memory leak here. Because reference bmp is destroyed when this method is returned. Which leaves memory it refered without any pointer. So, its garbage collected. Am I right? Edit: class someclass { static Bitmap someMethod(Bitmap img) { Bitmap bmp = new Bitmap(img); //can I use `using` block on this enclosing `return bmp`; ??? // do some processing on bmp here return bmp; } }

    Read the article

  • Where are the function literals in c++?

    - by academicRobot
    First of all, maybe literals is not the right term for this concept, but its the closest I could think of (not literals in the sense of functions as first class citizens). The idea is that when you make a conventional function call, it compiles to something like this: callq <immediate address> But if you make a function call using a function pointer, it compiles to something like this: mov <memory location>,%rax callq *%rax Which is all well and good. However, what if I'm writing a template library that requires a callback of some sort with a specified argument list and the user of the library is expected to know what function they want to call at compile time? Then I would like to write my template to accept a function literal as a template parameter. So, similar to template <int int_literal> struct my_template {...};` I'd like to write template <func_literal_t func_literal> struct my_template {...}; and have calls to func_literal within my_template compile to callq <immediate address>. Is there a facility in C++ for this, or a work around to achieve the same effect? If not, why not (e.g. some cataclysmic side effects)? How about C++0x or another language? Solutions that are not portable are fine. Solutions that include the use of member function pointers would be ideal. I'm not particularly interested in being told "You are a <socially unacceptable term for a person of low IQ>, just use function pointers/functors." This is a curiosity based question, and it seems that it might be useful in some (albeit limited) applications. It seems like this should be possible since function names are just placeholders for a (relative) memory address, so why not allow more liberal use (e.g. aliasing) of this placeholder. p.s. I use function pointers and functions objects all the the time and they are great. But this post got me thinking about the don't pay for what you don't use principle in relation to function calls, and it seems like forcing the use of function pointers or similar facility when the function is known at compile time is a violation of this principle, though a small one.

    Read the article

  • which way is correct to retrive data from oracle??

    - by rima
    before answer me plz thinking about the futures of these kind of program and answer me plz. I wanna get some data from oracle server like: 1-get all the function,package,procedure and etc for showing them or drop them & etc... 2-compile my *.sql files,get the result if they have problem & etc... becuz I was beginner in oracle first of all I for solve the second problem I try to connect to sqlPlus by RUN sqlplus and trace the output(I mean,I change the output stream of shell and trace what happend and handle the assigned message to customer. NOW THIS PART SUCCEED. just a little bit I have problem with get all result because the output is asynchronous.any way... [in this case I log in to oracle Server by send argument to the sqlplus by make a process in c#] after that I try to get all function,package or procedure name,but I have problem in speed!so I try to use oracle.DataAccess.dll to connect the database. now I m so confusing about: which way is correct way to build a program that work like Oracle Developer! I do not have any experience for like these program how work. If Your answer is I must use the second way follow this part plz: I search a little bit the Golden,PLedit (Benthic software),I have little bit problem how I must create the connection string?because I thinking about how I can find the host name or port number that oracle work on them?? am I need read the TNSNames.Ora file? IF your answer is I must use the first way follow this part plz: do u have any Idea for how I parse the output?because for example the result of a table is so confusing...[i can handle & program it but I really need someone experience,because the important things to me learn how such software work so nice and with quick response?] All of the has different style in output... If you are not sure Can u help me which book can help me in this way i become expert? becuz for example all the C# write just about how u can connect to DB and the DB books write how u can use this DB program,I looking for a book that give me some Idea how develop an interface for do transaction between these two.not simple send and receive data,for example how write a compiler for them. the language of book is not different for me i know C#,java,VB,sql,Oracle Thanks.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • How do you return a pointer to a base class with a virtual function?

    - by Nick Sweet
    I have a base class called Element, a derived class called Vector, and I'm trying to redefine two virtual functions from Element in Vector. //element.h template <class T> class Element { public: Element(); virtual Element& plus(const Element&); virtual Element& minus(const Element&); }; and in another file //Vector.h #include "Element.h" template <class T> class Vector: public Element<T> { T x, y, z; public: //constructors Vector(); Vector(const T& x, const T& y = 0, const T& z =0); Vector(const Vector& u); ... //operations Element<T>& plus(const Element<T>& v) const; Element<T>& minus(const Element<T>& v) const; ... }; //sum template <class T> Element<T>& Vector<T>::plus(const Element<T>& v) const { Element<T>* ret = new Vector((x + v.x), (y + v.y), (z + v.z)); return *ret; } //difference template <class T> Element<T>& Vector<T>::minus(const Element<T>& v) const { Vector<T>* ret = new Vector((x - v.x), (y - v.y), (z - v.z)); return *ret; } but I always get error: 'const class Element' has no member named 'getx' So, can I define my virtual functions to take Vector& as an argument instead, or is there a way for me to access the data members of Vector through a pointer to Element? I'm still fairly new to inheritance polymorphism, fyi.

    Read the article

  • Error With Sending mail (kSKPSMTPPartMessageKey is nil)

    - by user1553381
    I'm trying to send mail in iPhone using "SKPSMTPMessage" and I added the libraries, In my class I added the following code: - (IBAction)sendMail:(id)sender { // if there are a connection if ([theConnection isEqualToString:@"true"]) { if ([fromEmail.text isEqualToString:@""] || [toEmail.text isEqualToString:@""]) { UIAlertView *warning = [[UIAlertView alloc] initWithTitle:@"?????" message:@"?? ??? ????? ???? ????????" delegate:self cancelButtonTitle:@"?????" otherButtonTitles:nil, nil]; [warning show]; }else { SKPSMTPMessage *test_smtp_message = [[SKPSMTPMessage alloc] init]; test_smtp_message.fromEmail = fromEmail.text; test_smtp_message.toEmail = toEmail.text; test_smtp_message.relayHost = @"smtp.gmail.com"; test_smtp_message.requiresAuth = YES; test_smtp_message.login = @"[email protected]"; test_smtp_message.pass = @"myPass"; test_smtp_message.wantsSecure = YES; NSString *subject= @"Suggest a book for you"; test_smtp_message.subject = [NSString stringWithFormat:@"%@ < %@ > ",fromEmail.text, subject]; test_smtp_message.delegate = self; NSMutableArray *parts_to_send = [NSMutableArray array]; NSDictionary *plain_text_part = [NSDictionary dictionaryWithObjectsAndKeys: @"text/plain\r\n\tcharset=UTF-8;\r\n\tformat=flowed", kSKPSMTPPartContentTypeKey, [messageBody.text stringByAppendingString:@"\n"], kSKPSMTPPartMessageKey, @"quoted-printable", kSKPSMTPPartContentTransferEncodingKey, nil]; [parts_to_send addObject:plain_text_part]; // to send attachment NSString *image_path = [[NSBundle mainBundle] pathForResource:BookCover ofType:@"jpg"]; NSData *image_data = [NSData dataWithContentsOfFile:image_path]; NSDictionary *image_part = [NSDictionary dictionaryWithObjectsAndKeys: @"inline;\r\n\tfilename=\"image.png\"",kSKPSMTPPartContentDispositionKey, @"base64",kSKPSMTPPartContentTransferEncodingKey, @"image/png;\r\n\tname=Success.png;\r\n\tx-unix-mode=0666",kSKPSMTPPartContentTypeKey, [image_data encodeWrappedBase64ForData],kSKPSMTPPartMessageKey, nil]; [parts_to_send addObject:image_part]; test_smtp_message.parts = parts_to_send; Spinner.hidden = NO; [Spinner startAnimating]; ProgressBar.hidden = NO; HighestState = 0; [test_smtp_message send]; } }else { UIAlertView *alertNoconnection = [[UIAlertView alloc] initWithTitle:@"?????" message:@"?? ???? ???? " delegate:self cancelButtonTitle:@"?????" otherButtonTitles:nil, nil]; [alertNoconnection show]; } } but when I tried to send it gives me the following Exception: *** Terminating app due to uncaught exception 'NSInvalidArgumentException', reason: '*** -[NSCFString appendString:]: nil argument' and it highlighted this line in SKPSMTPMessage.m [message appendString:[part objectForKey:kSKPSMTPPartMessageKey]]; and I Can't understand what is nil exactly Can Anyone help me in this issue? Thanks in Advance.

    Read the article

  • asp.net mvc radio button state

    - by Josh Bush
    I'm trying out asp.net mvc for a new project, and I ran across something odd. When I use the MVC UI helpers for textboxes, the values get persisted between calls. But, when I use a series of radio buttons, the checked state doesn't get persisted. Here's an example from my view. <li> <%=Html.RadioButton("providerType","1")%><label>Hospital</label> <%=Html.RadioButton("providerType","2")%><label>Facility</label> <%=Html.RadioButton("providerType","3")%><label>Physician</label> </li> When the form gets posted back, I build up an object with "ProviderType" as one of it's properties. The value on the object is getting set, and then I RedirectToAction with the provider as a argument. All is well, and I end up at a URL like "http://localhost/Provider/List?ProviderType=1" with ProviderType showing. The value gets persisted to the URL, but the UI helper isn't picking up the checked state. I'm having this problem with listbox, dropdownlist, and radiobutton. Textboxes pick up the values just fine. Do you see something I'm doing wrong? I'm assuming that the helpers will do this for me, but maybe I'll just have to take care of this on my own. I'm just feeling my way through this, so your input is appreciated. Edit: I just found the override for the SelectList constructor that takes a selected value. That took care of my dropdown issue I mentioned above. Edit #2: I found something that works, but it pains me to do it this way. I feel like this should be inferred. <li> <%=Html.RadioButton("ProviderType","1",Request["ProviderType"]=="1")%><label>Hospital</label> <%=Html.RadioButton("ProviderType", "2", Request["ProviderType"] == "2")%><label>Facility</label> <%=Html.RadioButton("ProviderType", "3", Request["ProviderType"] == "3")%><label>Physician</label> </li> Hopefully someone will come up with another way.

    Read the article

  • C#/.NET Project - Am I setting things up correctly?

    - by JustLooking
    1st solution located: \Common\Controls\Controls.sln and its project: \Common\Controls\Common.Controls\Common.Controls.csproj Description: This is a library that contains this class: public abstract class OurUserControl : UserControl { // Variables and other getters/setters common to our UserControls } 2nd solution located: \AControl\AControl.sln and its project: \AControl\AControl\AControl.csproj Description: Of the many forms/classes, it will contain this class: using Common.Controls; namespace AControl { public partial class AControl : OurUserControl { // The implementation } } A note about adding references (not sure if this is relevant): When I add references (for projects I create), using the names above: 1. I add Common.Controls.csproj to AControl.sln 2. In AControl.sln I turn off the build of Common.Controls.csproj 3. I add the reference to Common.Controls (by project) to AControl.csproj. This is the (easiest) way I know how to get Debug versions to match Debug References, and Release versions to match Release References. Now, here is where the issue lies (the 3rd solution/project that actually utilizes the UserControl): 3rd solution located: \MainProj\MainProj.sln and its project: \MainProj\MainProj\MainProj.csproj Description: Here's a sample function in one of the classes: private void TestMethod<T>() where T : Common.Controls.OurUserControl, new() { T TheObject = new T(); TheObject.OneOfTheSetters = something; TheObject.AnotherOfTheSetters = something_else; // Do stuff with the object } We might call this function like so: private void AnotherMethod() { TestMethod<AControl.AControl>(); } This builds, runs, and works. No problem. The odd thing is after I close the project/solution and re-open it, I have red squigglies everywhere. I bring up my error list and I see tons of errors (anything that deals with AControl will be noted as an error). I'll see errors such as: The type 'AControl.AControl' cannot be used as type parameter 'T' in the generic type or method 'MainProj.MainClass.TestMethod()'. There is no implicit reference conversion from 'AControl.AControl' to 'Common.Controls.OurUserControl'. or inside the actual method (the properties located in the abstract class): 'AControl.AControl' does not contain a definition for 'OneOfTheSetters' and no extension method 'OneOfTheSetters' accepting a first argument of type 'AControl.AControl' could be found (are you missing a using directive or an assembly reference?) Meanwhile, I can still build and run the project (then the red squigglies go away until I re-open the project, or close/re-open the file). It seems to me that I might be setting up the projects incorrectly. Thoughts?

    Read the article

  • Maps with a nested vector

    - by wawiti
    For some reason the compiler won't let me retrieve the vector of integers from the map that I've created, I want to be able to overwrite this vector with a new vector. The error the compiler gives me is ridiculous. Thanks for your help!! The compiler didn't like this part of my code: line_num = miss_words[word_1]; Error: [Wawiti@localhost Lab2]$ g++ -g -Wall *.cpp -o lab2 main.cpp: In function ‘int main(int, char**)’: main.cpp:156:49: error: no match for ‘operator=’ in ‘miss_words.std::map<_Key, _Tp, _Compare, _Alloc>::operator[]<std::basic_string<char>, std::vector<int>, std::less<std::basic_string<char> >, std::allocator<std::pair<const std::basic_string<char>, std::vector<int> > > >((*(const key_type*)(& word_1))) = line_num.std::vector<_Tp, _Alloc>::push_back<int, std::allocator<int> >((*(const value_type*)(& line)))’ main.cpp:156:49: note: candidate is: In file included from /usr/lib/gcc/x86_64-redhat->linux/4.7.2/../../../../include/c++/4.7.2vector:70:0, from header.h:19, from main.cpp:15: /usr/lib/gcc/x86_64-redhat-linux/4.7.2/../../../../include/c++/4.7.2/bits/vector.tcc:161:5: note: std::vector<_Tp, _Alloc>& std::vector<_Tp, _Alloc>::operator=(const std::vector<_Tp, _Alloc>&) [with _Tp = int; _Alloc = std::allocator<int>] /usr/lib/gcc/x86_64-redhat-linux/4.7.2/../../../../include/c++/4.7.2/bits/vector.tcc:161:5: note: no known conversion for argument 1 from ‘void’ to ‘const std::vector<int>&’ CODE: map<string, vector<int> > miss_words; // Creates a map for misspelled words string word_1; // String for word; string sentence; // To store each line; vector<int> line_num; // To store line numbers ifstream file; // Opens file to be spell checked file.open(argv[2]); int line = 1; while(getline(file, sentence)) // Reads in file sentence by sentence { sentence=remove_punct(sentence); // Removes punctuation from sentence stringstream pars_sentence; // Creates stringstream pars_sentence << sentence; // Places sentence in a stringstream while(pars_sentence >> word_1) // Picks apart sentence word by word { if(dictionary.find(word_1)==dictionary.end()) { line_num = miss_words[word_1]; //Compiler doesn't like this miss_words[word_1] = line_num.push_back(line); } } line++; // Increments line marker }

    Read the article

  • Can I make a LaTeX macro 'return' a filename?

    - by drfrogsplat
    I'm writing my thesis/dissertation and since its an on-going work I don't always have the actual images ready for the figures I put into my document, but for various reasons want to automatically have it substitute a dummy figure in place when the included graphics file doesn't exist. E.g. I can do something like \includegraphics[width=8cm]{\chapdir/figures/fluxcapacitor} (where \chapdir is a macro for my 'current' chapter directory, e.g. \def\chapdir{./ch_timetravel} and if there's no ./ch_timetravel/figures/fluxcapacitor.jpg it'll insert ./commands/dummy.jpg instead. I've structured my macros (perhaps naïvely?) so that I have a macro (\figFileOrDummy) that determines the appropriate file to include by checking if the argument provided to it exists, so that I can call \includegraphics[properties]{\figFileOrDummy{\chapdir/figures/fluxcapacitor}}. Except I'm getting various errors depending on how I try to call this, which seem to suggest that I'm approaching the problem in a fundamentally flawed way as far as 'good LaTeX programming' goes. Here's the macro to check if the file exists (and 'return' either filename or the dummy filename): \newcommand{\figFileOrDummy}[1]{% % Figure base name (no extension) to be used if the file exists \def\fodname{#1}% \def\dummyfig{commands/dummy}% % Check if output is PS (.EPS) or PDF (.JPG/.PDF/.PNG/...) figures \ifx\pdfoutput\undefined% % EPS figures only \IfFileExists{\fodname.eps}{}{\def\fodname{\dummyfig}}% \else% % Check existence of various extensions: PDF, TIF, TIFF, JPG, JPEG, PNG, MPS \def\figtest{0}% flag below compared to this value \IfFileExists{\fodname.pdf}{\def\figfilenamefound{1}}{\def\figfilenamefound{0}}% \IfFileExists{\fodname.jpg}{\def\figfilenamefound{1}}{}% \IfFileExists{\fodname.png}{\def\figfilenamefound{1}}{}% % and so on... % If no files found matching the filename (flag is 0) then use the dummy figure \ifx\figfilenamefound\figtest% \def\fodname{\dummyfig}% \fi% \fi% % 'return' the filename \fodname% }% Alternatively, here's a much simpler version which seems to have similar problems: \newcommand{\figFileOrDummy}[1]{% \def\dummyfig{commands/dummy}% \dummyfig% } The \def commands seems to be processed after the expansion of the macro they're trying to define, so it ends up being \def {commands/dummy}... (note the space after \def) and obviously complains. Also it seems to treat the literal contents of the macro as the filename for \includegraphics, rather than resolving/expanding it first, so complains that the file '\def {commands/dummy}... .png' doesn't exist.. I've tried also doing something like \edef\figfilename{\figFileOrDummy{\chapdir/figures/fluxcapacitor}} to try to force it to make \figfilename hold just the value rather than the full macro, but I get an Undefined control sequence error complaining the variables I'm trying to \def in the \figFileOrDummy macro are undefined. So my question is either How do I make this macro expand properly?; or If this is the wrong way of structuring my macros, how should I actually structure such a macro, in order to be able to insert dummy/real figures automatically?; or Is there a package that already handles this type of thing nicely that I've overlooked? I feel like I'm missing something pretty fundamental here...

    Read the article

  • Applying styles to a GridView matching certain criteria

    - by NickK
    Hi everyone. I'm fairly new to ASP.Net so it's probably just me being a bit stupid, but I just can't figure out why this isn't working. Basically, I have a GridView control (GridView1) on a page which is reading from a database. I already have a CSS style applied to the GridView and all I want to do is change the background image applied in the style depending on if a certain cell has data in it or not. The way I'm trying to handle this change is updating the CSS class applied to each row through C#. I have the code below doing this: protected void GridView1_RowDataBound(object sender, GridViewRowEventArgs e) { GridViewRow row = e.Row; string s = row.Cells[7].Text; if (s.Length > 0) { row.CssClass = "newRowBackground"; } else { row.CssClass = "oldRowBackground"; } } In theory, the data from Cell[7] will either be null or be a string (in this case, likely a person's name). The problem is that when the page loads, every row in the GridView has the new style applied to it, whether it's empty or not. However, when I change it to use hard coded examples, it works fine. So for example, the below would work exactly how I want it to: protected void GridView1_RowDataBound(object sender, GridViewRowEventArgs e) { GridViewRow row = e.Row; string s = row.Cells[7].Text; if (s == "Smith") //Matching a name in one of the rows { row.CssClass = "newRowBackground"; } else { row.CssClass = "oldRowBackground"; } } It seems as if the top piece of code is always returning the string with a value greater than 0, but when I check the database the fields are all null (except for my test record of "Smith"). I'm probably doing something very simple that's wrong here, but I can't see what. Like I said, I'm still very new to this. One thing I have tried is changing the argument in the if statement to things like: if (s != null), if (s != "") and if (s == string.empty) all with no luck. Any help is greatly appreciated and don't hesitate to tell me if I'm just being stupid here. :)

    Read the article

  • help me to choose the best soulotion for my purpose to build my software.

    - by rima
    before answer me plz thinking about the futures of these kind of program and answer me plz. I wanna get some data from oracle server like: 1-get all the function,package,procedure and etc for showing them or drop them & etc... 2-compile my *.sql files,get the result if they have problem & etc... becuz I was beginner in oracle first of all I for solve the second problem I try to connect to sqlPlus by RUN sqlplus and trace the output(I mean,I change the output stream of shell and trace what happend and handle the assigned message to customer. NOW THIS PART SUCCEED. just a little bit I have problem with get all result because the output is asynchronous.any way... [in this case I log in to oracle Server by send argument to the sqlplus by make a process in c#] after that I try to get all function,package or procedure name,but I have problem in speed!so I try to use oracle.DataAccess.dll to connect the database. now I m so confusing about: which way is correct way to build a program that work like Oracle Developer! I do not have any experience for like these program how work. If Your answer is I must use the second way follow this part plz: I search a little bit the Golden,PLedit (Benthic software),I have little bit problem how I must create the connection string?because I thinking about how I can find the host name or port number that oracle work on them?? am I need read the TNSNames.Ora file? IF your answer is I must use the first way follow this part plz: do u have any Idea for how I parse the output?because for example the result of a table is so confusing...[i can handle & program it but I really need someone experience,because the important things to me learn how such software work so nice and with quick response?] All of the has different style in output... If you are not sure Can u help me which book can help me in this way i become expert? becuz for example all the C# write just about how u can connect to DB and the DB books write how u can use this DB program,I looking for a book that give me some Idea how develop an interface for do transaction between these two.not simple send and receive data,for example how write a compiler for them. the language of book is not different for me i know C#,java,VB,sql,Oracle Thanks.

    Read the article

  • Perfect Forwarding to async lambda

    - by Alexander Kondratskiy
    I have a function template, where I want to do perfect forwarding into a lambda that I run on another thread. Here is a minimal test case which you can directly compile: #include <thread> #include <future> #include <utility> #include <iostream> #include <vector> /** * Function template that does perfect forwarding to a lambda inside an * async call (or at least tries to). I want both instantiations of the * function to work (one for lvalue references T&, and rvalue reference T&&). * However, I cannot get the code to compile when calling it with an lvalue. * See main() below. */ template <typename T> std::string accessValueAsync(T&& obj) { std::future<std::string> fut = std::async(std::launch::async, [](T&& vec) mutable { return vec[0]; }, std::forward<T>(obj)); return fut.get(); } int main(int argc, char const *argv[]) { std::vector<std::string> lvalue{"Testing"}; // calling with what I assume is an lvalue reference does NOT compile std::cout << accessValueAsync(lvalue) << std::endl; // calling with rvalue reference compiles std::cout << accessValueAsync(std::move(lvalue)) << std::endl; // I want both to compile. return 0; } For the non-compiling case, here is the last line of the error message which is intelligible: main.cpp|13 col 29| note: no known conversion for argument 1 from ‘std::vector<std::basic_string<char> >’ to ‘std::vector<std::basic_string<char> >&’ I have a feeling it may have something to do with how T&& is deduced, but I can't pinpoint the exact point of failure and fix it. Any suggestions? Thank you! EDIT: I am using gcc 4.7.0 just in case this could be a compiler issue (probably not)

    Read the article

  • Haskell type classes and type families (cont'd)

    - by Giuseppe Maggiore
    I need some help in figuring a compiler error which is really driving me nuts... I have the following type class: infixl 7 --> class Selectable a s b where type Res a s b :: * (-->) :: (CNum n) => (Reference s a) -> (n,(a->b),(a->b->a)) -> Res a s b which I instance twice. First time goes like a charm: instance Selectable a s b where type Res a s b = Reference s b (-->) (Reference get set) (_,read,write) = (Reference (\s -> let (v,s') = get s in (read v,s')) (\s -> \x -> let (v,s') = get s v' = write v x (_,s'') = set s' v' in (x,s''))) since the type checker infers (-->) :: Reference s a -> (n,a->b,a->b->a) -> Reference s b and this signature matches with the class signature for (--) since Res a s b = Reference s b Now I add a second instance and everything breaks: instance (Recursive a, Rec a ~ reca) => Selectable a s (Method reca b c) where type Res a s (Method reca b c) = b -> Reference s c (-->) (Reference get set) (_,read,write) = \(x :: b) -> from_constant( Constant(\(s :: s)-> let (v,s') = get s :: (a,s) m = read v ry = m x :: Reference (reca) c (y,v') = getter ry (cons v) :: (c,reca) v'' = elim v' (_,s'') = set s' v'' in (y,s''))) :: Reference s c the compiler complains that Couldn't match expected type `Res a s (Method reca b c)' against inferred type `b -> Reference s c' The lambda expression `\ (x :: b) -> ...' has one argument, which does not match its type In the expression: \ (x :: b) -> from_constant (Constant (\ (s :: s) -> let ... in ...)) :: Reference s c In the definition of `-->': --> (Reference get set) (_, read, write) = \ (x :: b) -> from_constant (Constant (\ (s :: s) -> ...)) :: Reference s c reading carefully the compiler is telling me that it has inferred the type of (--) thusly: (-->) :: Reference s a -> (n,a->(Method reca b c),a->(Method reca b c)->a) -> (b -> Reference s c) which is correct since Res a s (Method reca b c) = b -> Reference s c but why can't it match the two definitions? Sorry for not offering a more succint and standalone example, but in this case I cannot figure how to do it...

    Read the article

  • Serialization Error:Unable to generate a temporary class (result=1).\r\nerror CS0030:- c#

    - by ltech
    Running XSD.exe on my xml to generate C# class. All works well except on this property public DocumentATTRIBUTES[][] Document { get { return this.documentField; } set { this.documentField = value; } } I want to try and use CollectionBase, and this was my attempt public DocumentATTRIBUTESCollection Document { get { return this.documentField; } set { this.documentField = value; } } /// <remarks/> [System.SerializableAttribute()] [System.Diagnostics.DebuggerStepThroughAttribute()] [System.ComponentModel.DesignerCategoryAttribute("code")] [System.Xml.Serialization.XmlTypeAttribute(AnonymousType = true)] public partial class DocumentATTRIBUTES { private string _author; private string _maxVersions; private string _summary; /// <remarks/> [System.Xml.Serialization.XmlElementAttribute(Form = System.Xml.Schema.XmlSchemaForm.Unqualified)] public string author { get { return _author; } set { _author = value; } } /// <remarks/> [System.Xml.Serialization.XmlElementAttribute(Form = System.Xml.Schema.XmlSchemaForm.Unqualified)] public string max_versions { get { return _maxVersions; } set { _maxVersions = value; } } /// <remarks/> [System.Xml.Serialization.XmlElementAttribute(Form = System.Xml.Schema.XmlSchemaForm.Unqualified)] public string summary { get { return _summary; } set { _summary = value; } } } public class DocumentAttributeCollection : System.Collections.CollectionBase { public DocumentAttributeCollection() : base() { } public DocumentATTRIBUTES this[int index] { get { return (DocumentATTRIBUTES)this.InnerList[index]; } } public void Insert(int index, DocumentATTRIBUTES value) { this.InnerList.Insert(index, value); } public int Add(DocumentATTRIBUTES value) { return (this.InnerList.Add(value)); } } However when I try to serialize my object using XmlSerializer serializer = new XmlSerializer(typeof(DocumentMetaData)); I get the error: {"Unable to generate a temporary class (result=1).\r\nerror CS0030: Cannot convert type 'DocumentATTRIBUTES' to 'DocumentAttributeCollection'\r\nerror CS1502: The best overloaded method match for 'DocumentAttributeCollection.Add(DocumentATTRIBUTES)' has some invalid arguments\r\nerror CS1503: Argument '1': cannot convert from 'DocumentAttributeCollection' to 'DocumentATTRIBUTES'\r\n"} the XSD pertaining to this property is <xs:complexType> <xs:sequence> <xs:element name="ATTRIBUTES" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="author" type="xs:string" minOccurs="0" /> <xs:element name="max_versions" type="xs:string" minOccurs="0" /> <xs:element name="summary" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> </xs:sequence> </xs:complexType> </xs:element>

    Read the article

  • Returning JSON in CFFunction and appending it to layer is causing an error

    - by Mel
    I'm using the qTip jQuery plugin to generate a dynamic tooltip. I'm getting an error in my JS, and I'm unsure if its source is the JSON or the JS. The tooltip calls the following function: (sorry about all this code, but it's necessary) <cffunction name="fGameDetails" access="remote" returnType="any" returnformat="JSON" output="false" hint="This grabs game details for the games.cfm page"> <!---Argument, which is the game ID---> <cfargument name="gameID" type="numeric" required="true" hint="CFC will look for GameID and retrieve its details"> <!---Local var---> <cfset var qGameDetails = ""> <!---Database query---> <cfquery name="qGameDetails" datasource="#REQUEST.datasource#"> SELECT titles.titleName AS tName, titles.titleBrief AS tBrief, games.gameID, games.titleID, games.releaseDate AS rDate, genres.genreName AS gName, platforms.platformAbbr AS pAbbr, platforms.platformName AS pName, creviews.cReviewScore AS rScore, ratings.ratingName AS rName FROM games Inner Join platforms ON platforms.platformID = games.platformID Inner Join titles ON titles.titleID = games.titleID Inner Join genres ON genres.genreID = games.genreID Inner Join creviews ON games.gameID = creviews.gameID Inner Join ratings ON ratings.ratingID = games.ratingID WHERE (games.gameID = #ARGUMENTS.gameID#); </cfquery> <cfreturn qGameDetails> </cffunction> This function returns the following JSON: { "COLUMNS": [ "TNAME", "TBRIEF", "GAMEID", "TITLEID", "RDATE", "GNAME", "PABBR", "PNAME", "RSCORE", "RNAME" ], "DATA": [ [ "Dark Void", "Ancient gods known as 'The Watchers,' once banished from our world by superhuman Adepts, have returned with a vengeance.", 154, 54, "January, 19 2010 00:00:00", "Action & Adventure", "PS3", "Playstation 3", 3.3, "14 Anos" ] ] } The problem I'm having is every time I try to append the JSON to the layer #catalog, I get a syntax error that says "missing parenthetical." This is the JavaScript I'm using: $(document).ready(function() { $('#catalog a[href]').each(function() { $(this).qtip( { content: { url: '/gamezilla/resources/components/viewgames.cfc?method=fGameDetails', data: { gameID: $(this).attr('href').match(/gameID=([0-9]+)$/)[1] }, method: 'get' }, api: { beforeContentUpdate: function(content) { var json = eval('(' + content + ')'); content = $('<div />').append( $('<h1 />', { html: json.TNAME })); return content; } }, style: { width: 300, height: 300, padding: 0, name: 'light', tip: { corner: 'leftMiddle', size: { x: 40, y : 40 } } }, position: { corner: { target: 'rightMiddle', tooltip: 'leftMiddle' } } }); }); }); Any ideas where I'm going wrong? I tried many things for several days and I can't find the issue. Many thanks!

    Read the article

  • Which is the "best" data access framework/approach for C# and .NET?

    - by Frans
    (EDIT: I made it a community wiki as it is more suited to a collaborative format.) There are a plethora of ways to access SQL Server and other databases from .NET. All have their pros and cons and it will never be a simple question of which is "best" - the answer will always be "it depends". However, I am looking for a comparison at a high level of the different approaches and frameworks in the context of different levels of systems. For example, I would imagine that for a quick-and-dirty Web 2.0 application the answer would be very different from an in-house Enterprise-level CRUD application. I am aware that there are numerous questions on Stack Overflow dealing with subsets of this question, but I think it would be useful to try to build a summary comparison. I will endeavour to update the question with corrections and clarifications as we go. So far, this is my understanding at a high level - but I am sure it is wrong... I am primarily focusing on the Microsoft approaches to keep this focused. ADO.NET Entity Framework Database agnostic Good because it allows swapping backends in and out Bad because it can hit performance and database vendors are not too happy about it Seems to be MS's preferred route for the future Complicated to learn (though, see 267357) It is accessed through LINQ to Entities so provides ORM, thus allowing abstraction in your code LINQ to SQL Uncertain future (see Is LINQ to SQL truly dead?) Easy to learn (?) Only works with MS SQL Server See also Pros and cons of LINQ "Standard" ADO.NET No ORM No abstraction so you are back to "roll your own" and play with dynamically generated SQL Direct access, allows potentially better performance This ties in to the age-old debate of whether to focus on objects or relational data, to which the answer of course is "it depends on where the bulk of the work is" and since that is an unanswerable question hopefully we don't have to go in to that too much. IMHO, if your application is primarily manipulating large amounts of data, it does not make sense to abstract it too much into objects in the front-end code, you are better off using stored procedures and dynamic SQL to do as much of the work as possible on the back-end. Whereas, if you primarily have user interaction which causes database interaction at the level of tens or hundreds of rows then ORM makes complete sense. So, I guess my argument for good old-fashioned ADO.NET would be in the case where you manipulate and modify large datasets, in which case you will benefit from the direct access to the backend. Another case, of course, is where you have to access a legacy database that is already guarded by stored procedures. ASP.NET Data Source Controls Are these something altogether different or just a layer over standard ADO.NET? - Would you really use these if you had a DAL or if you implemented LINQ or Entities? NHibernate Seems to be a very powerful and powerful ORM? Open source Some other relevant links; NHibernate or LINQ to SQL Entity Framework vs LINQ to SQL

    Read the article

< Previous Page | 140 141 142 143 144 145 146 147 148 149 150 151  | Next Page >