Search Results

Search found 14154 results on 567 pages for 'spooky note'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 146/567 | < Previous Page | 142 143 144 145 146 147 148 149 150 151 152 153  | Next Page >

  • How to set offset in GORM when using createCriteria?

    - by firnnauriel
    I'm just wondering if it's possible for 'createCriteria' to specify the paginateParams (i.e. offset) similar to dynamic finder (findAll, etc.) Note that this code is not working since 'offset' is not documented in http://www.grails.org/doc/1.2.1/ref/Domain%20Classes/createCriteria.html def c = SnbrItemActDistance.createCriteria() def results = c.list { eq('iid', newsId) ge('distance', cap) maxResults(count) offset(offset) order('distance', 'desc') }

    Read the article

  • How can I use linq to initialize an array of repeated elements?

    - by Eric
    At present, I'm using something like this to build a list of 10 objects: myList = (from _ in Enumerable.Range(0, 9) select new MyObject {...}).toList() This is based off my python background, where I'd write: myList = [MyObject(...) for _ in range(10)] Note that I want my list to contain 10 instances of my object, not the same instance 10 times. Is this still a sensible way to do things in C#? Is there a cost to doing it this way over a simple for loop?

    Read the article

  • define colors as variables in CSS

    - by patrick
    Hi all, I'm working CSS file which is quite long. I know the client could ask for changes to the color scheme, and was wondering: is it possible to assign colors to variables so I can just change them to have the new color applied to all elements that use it? Please note I can't use php to dynamically change the css file.

    Read the article

  • jQuery, Animate opacity to 1 then remove the opacity property to make it better looking on IE

    - by Emily
    Hi everyone, I tried the jQuery fadeIn animation in all browsers and it work good, but not that much on IE. the Alpha png images are so creepy after appending the CSS opacity, but i have an idea and i don't know how to implement it using jQuery. The idea is to fadeIn the element and when the animation is finished it will automatically remove the opacity property in order to make the picture quality better. How to do that? Note: i'm using Animate and not FadeIn. Thanks

    Read the article

  • How to programatically sense the iPhone mute switch?

    - by Olie
    I can't seem to find in the SDK how to programatically sense the mute button/switch on the iPhone. When my app plays background music, it responds properly to the volume button without me having any code to follow that but, when I use the mute switch, it just keeps playing away. How do I test the position of mute? (NOTE: My program has its own mute switch, but I'd like the physical switch to override that.) Thanks!

    Read the article

  • Laravel with Homestead

    - by Ahmed el-Gendy
    I new with virtual box and vagrant , Now I using Homestead image and every thing is run well but when i create my project named laravel on virtual machine it supposed that i see this new folder named laravel on my machine but i didn't get any thing on my machine , The synchronization is not working. NOTE: I'm using ubuntu 14.04 This is my homestead.yaml ip: "192.168.10.10" memory: 2048 cpus: 1 authorize: ~/.ssh/id_rsa.pub keys: - ~/.ssh/id_rsa folders: - map: /var/projects/ to: /home/vagrant/projects/ sites: - map: homestead.app to: /home/vagrant/projects/laravel/public variables: - key: APP_ENV value: local thanks advance

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Macports 1.8.2 fails to build db46 on os x 1.6.3

    - by themoch
    i'm trying to put a dev environment on my mac, and to do so i need to install several packages which require db46 when running sudo port install db46 i get the following error: ---> Computing dependencies for db46 ---> Fetching db46 ---> Attempting to fetch patch.4.6.21.1 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.2 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.3 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.4 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch db-4.6.21.tar.gz from http://distfiles.macports.org/db4/4.6.21_6 ---> Verifying checksum(s) for db46 ---> Extracting db46 ---> Applying patches to db46 ---> Configuring db46 ---> Building db46 Error: Target org.macports.build returned: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_databases_db46/work/db-4.6.21/build_unix" && /usr/bin/make -j2 all " returned error 2 Command output: ../dist/../libdb_java/db_java_wrap.c:9464: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9487: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9509: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9532: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9563: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9588: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9613: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9638: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9666: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9691: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9716: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9739: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9771: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9796: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9819: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9842: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9867: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jobject' ../dist/../libdb_java/db_java_wrap.c:9899: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9920: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9943: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9966: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jstring' ../dist/../libdb_java/db_java_wrap.c:9991: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:10010: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10046: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10071: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' make: *** [db_java_wrap.lo] Error 1 make: *** Waiting for unfinished jobs.... Note: Some input files use unchecked or unsafe operations. Note: Recompile with -Xlint:unchecked for details. cd ./classes && jar cf ../db.jar ./com/sleepycat Error: Status 1 encountered during processing. i have removed my /usr/local folder completely and it does not seem to help

    Read the article

  • Can one create Sized Types in Scala?

    - by Jens Schauder
    Is it possible to create types like e.g. String(20) in scala? The aim would be to have compiler checks for things like: a: String(20) b: String(30) a = b; // throws a compiler exception when no implicit conversion is available b= a; // works just fine Note: It doesn't need to be/named String

    Read the article

  • Can you make an incrementing compiler constant?

    - by Keith Nicholas
    While sounding nonsensical..... I want a Contant where every time you use it it will increment by 1 int x; int y; x = INCREMENTING_CONSTNAT; y = INCREMENTING_CONSTNAT; where x == 1; and y == 2 Note I don't want y = INCREMENTING_CONSTNAT+1 type solutions. Basically I want to use it as a compile time unique ID ( generally it wouldn't be used in code like the example but inside another macro)

    Read the article

  • Redirect a specific IP address to a special page of my homepage with .htaccess

    - by Jim Knopf
    How can I use .htaccess to forward a visitor of a specific IP address to a webpage on my server? This example causes an infinite loop: RewriteCond %{REMOTE_ADDR} ^123\.\123\.123\.123$ RewriteRule ^(.*)$ /specialpage.php [R,L] I found this on the web but it just does not work: SetEnvIf REMOTE_ADDR 123.123.123.123 REDIR="redir" RewriteCond %{REDIR} redir RewriteRule ^(.*)$ /specialpage.php Note: My website consists of .htm, html and .php pages. Your help would be very much appreciated.

    Read the article

  • How to get the Queue name that NServiceBus pulled the message from.

    - by Simon
    I can use this code to get the return address. string returnAddress = Bus.CurrentMessageContext.ReturnAddress; But how do i get the "to address" of the message. i.e. the Queue that NServiceBus pulled the message from. I had a look through the source and it seems Bus.Transport.Address is what i want but there is no get on Transport Note: I am within the "Handle" method of a message handler.

    Read the article

  • ASp.NET Dropdown and Dictionary

    - by Lijo
    Hi Team, I am using a dropdown list in ASP.NET with C#. I am trying to bind a dictionary to the dropdownlist. How can we specify the "Text" (key of dictionary as Text of drop down) and "value" (value as Value) for the dropdown? Could you please help? Note: There is a constraint that a class should not be introduced for this purpose. That is why I am trying to use a dictionary. Thanks Lijo

    Read the article

  • sql - get the latest date of two columns

    - by stacker
    table1 - date1 datetime not null - date2 nvarchar null I want to get the latest date of this two. select date1, date2, (CASE WHEN date1 > CAST(date2 as DateTime) THEN date1 ELSE date2 END) as DateTime) as LatestDate from table1 please note that date2 can be null. in this case, date1 win.

    Read the article

  • Find the version of an installed npm package

    - by Laurent Couvidou
    How to find the local version of an installed node.js/npm package? This prints the version of npm itself: npm -v <package-name> This prints a cryptic error: npm version <package-name> For some reason, probably because of the weird arguments ordering, or because of the false positives mentioned above, I just can't remember the proper command. So this question is a note for self that might help others.

    Read the article

  • Visual Studio 2010 .NET framework 3.5 unavailable

    - by Haxed
    Hey people, I have installed VS 2010 Professional, and despite my tremendous urge to work on it since it is pleasing to the eye, it seems not to support .NET framework 3.5/3.0. Therefore, I have switched to VS 2008 rather relunctantly. Does anyone know, to add .NET framework 3.0/3.5 to the top right Combo Box within the make new project ? (Note : In the top right Combo Box within the make new project, I have only .NET framework 4.0 available) Many Thanks..............................

    Read the article

  • How to split records per hour in order to display them as a chart?

    - by Axel
    Hi, I have an SQL table like this : sales(product,timestamp) I want to display a chart using Open Flash Chart but i don't know how to get the total sales per hour within the last 12 hours. ( the timestamp column is the sale date ) By example i will end up with an array like this : array(12,5,8,6,10,35,7,23,4,5,2,16) every number is the total sales in each hour. Note: i want to use php or only mysql for this. Thanks

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 142 143 144 145 146 147 148 149 150 151 152 153  | Next Page >