Search Results

Search found 3984 results on 160 pages for 'modules'.

Page 147/160 | < Previous Page | 143 144 145 146 147 148 149 150 151 152 153 154  | Next Page >

  • ASP.net Repeater Control Problem (nothing outputted)

    - by Phil
    I have the following db code in my usercontrol (content.ascx.vb): If did = 0 Then s = "select etc (statement works on server)" x = New SqlCommand(s, c) x.Parameters.Add("@contentid", Data.SqlDbType.Int) x.Parameters("@contentid").Value = contentid c.Open() r = x.ExecuteReader If r.HasRows Then Contactinforepeater.DataSource = r End If c.Close() r.Close() Else s = "select etc (statement works on server)" x = New SqlCommand(s, c) x.Parameters.Add("@contentid", SqlDbType.Int) x.Parameters("@contentid").Value = contentid x.Parameters.Add("@did", SqlDbType.Int) x.Parameters("@did").Value = did c.Open() r = x.ExecuteReader If r.HasRows Then Contactinforepeater.DataSource = r c.Close() r.Close() End If End If Then I have the following repeater control markup in my usercontrol (content.ascx): <asp:Repeater ID="Contactinforepeater" runat="server"> <HeaderTemplate> <h1>Contact Information</h1> </HeaderTemplate> <ItemTemplate> <table width="50%"> <tr> <td colspan="2"><%#Container.DataItem("position")%></td> </tr> <tr> <td>Name:</td> <td><%#Container.DataItem("surname")%></td> </tr> <tr> <td>Telephone:</td> <td><%#Container.DataItem("telephone")%></td> </tr> <tr> <td>Fax:</td> <td><%#Container.DataItem("fax")%></td> </tr> <tr> <td>Email:</td> <td><%#Container.DataItem("email")%></td> </tr> </table> </ItemTemplate> <SeparatorTemplate><br /><hr /><br /></SeparatorTemplate> </asp:Repeater> When I insert this usercontrol into default.aspx with this code: <%@ Register src="Modules/Content.ascx" tagname="Content" tagprefix="uc1" %> and <form id="form1" runat="server"> <div> <uc1:Content ID="Content" runat="server" /> </div> </form> I do not get any error messages but the expected content from the database is not displayed. Can someone please show me the syntax to get this working or point out where I am going wrong? Thanks in advance!

    Read the article

  • How to make freelance clients understand the costs of developing and maintaining mature products?

    - by John
    I have a freelance web application project where the client requests new features every two weeks or so. I am unable to anticipate the requirements of upcoming features. So when the client requests a new feature, one of several things may happen: I implement the feature with ease because it is compatible with the existing platform I implement the feature with difficulty because I have to rewrite a significant portion of the platform's foundation Client withdraws request because it costs too much to implement against existing platform At the beginning of the project, for about six months, all feature requests fell under category 1) because the system was small and agile. But for the past six months, most feature implementation fell under category 2). The system is mature, forcing me to refactor and test everytime I want to add new modules. Additionally, I find myself breaking things that use to work, and fixing it (I don't get paid for this). The client is starting to express frustration at the time and cost for me to implement new features. To them, many of the feature requests are of the same scale as the features they requested six months ago. For example, a client would ask, "If it took you 1 week to build a ticketing system last year, why does it take you 1 month to build an event registration system today? An event registration system is much simpler than a ticketing system. It should only take you 1 week!" Because of this scenario, I fear feature requests will soon land in category 3). In fact, I'm already eating a lot of the cost myself because I volunteer many hours to support the project. The client is often shocked when I tell him honestly the time it takes to do something. The client always compares my estimates against the early months of a project. I don't think they're prepared for what it really costs to develop, maintain and support a mature web application. When working on a salary for a full time company, managers were more receptive of my estimates and even encouraged me to pad my numbers to prepare for the unexpected. Is there a way to condition my clients to think the same way? Can anyone offer advice on how I can continue to work on this web project without eating too much of the cost myself? Additional info - I've only been freelancing full time for 1 year. I don't yet have the high end clients, but I'm slowly getting there. I'm getting better quality clients as time goes by.

    Read the article

  • Optimizing tasks to reduce CPU in a trading application

    - by Joel
    Hello, I have designed a trading application that handles customers stocks investment portfolio. I am using two datastore kinds: Stocks - Contains unique stock name and its daily percent change. UserTransactions - Contains information regarding a specific purchase of a stock made by a user : the value of the purchase along with a reference to Stock for the current purchase. db.Model python modules: class Stocks (db.Model): stockname = db.StringProperty(multiline=True) dailyPercentChange=db.FloatProperty(default=1.0) class UserTransactions (db.Model): buyer = db.UserProperty() value=db.FloatProperty() stockref = db.ReferenceProperty(Stocks) Once an hour I need to update the database: update the daily percent change in Stocks and then update the value of all entities in UserTransactions that refer to that stock. The following python module iterates over all the stocks, update the dailyPercentChange property, and invoke a task to go over all UserTransactions entities which refer to the stock and update their value: Stocks.py # Iterate over all stocks in datastore for stock in Stocks.all(): # update daily percent change in datastore db.run_in_transaction(updateStockTxn, stock.key()) # create a task to update all user transactions entities referring to this stock taskqueue.add(url='/task', params={'stock_key': str(stock.key(), 'value' : self.request.get ('some_val_for_stock') }) def updateStockTxn(stock_key): #fetch the stock again - necessary to avoid concurrency updates stock = db.get(stock_key) stock.dailyPercentChange= data.get('some_val_for_stock') # I get this value from outside ... some more calculations here ... stock.put() Task.py (/task) # Amount of transaction per task amountPerCall=10 stock=db.get(self.request.get("stock_key")) # Get all user transactions which point to current stock user_transaction_query=stock.usertransactions_set cursor=self.request.get("cursor") if cursor: user_transaction_query.with_cursor(cursor) # Spawn another task if more than 10 transactions are in datastore transactions = user_transaction_query.fetch(amountPerCall) if len(transactions)==amountPerCall: taskqueue.add(url='/task', params={'stock_key': str(stock.key(), 'value' : self.request.get ('some_val_for_stock'), 'cursor': user_transaction_query.cursor() }) # Iterate over all transaction pointing to stock and update their value for transaction in transactions: db.run_in_transaction(updateUserTransactionTxn, transaction.key()) def updateUserTransactionTxn(transaction_key): #fetch the transaction again - necessary to avoid concurrency updates transaction = db.get(transaction_key) transaction.value= transaction.value* self.request.get ('some_val_for_stock') db.put(transaction) The problem: Currently the system works great, but the problem is that it is not scaling well… I have around 100 Stocks with 300 User Transactions, and I run the update every hour. In the dashboard, I see that the task.py takes around 65% of the CPU (Stock.py takes around 20%-30%) and I am using almost all of the 6.5 free CPU hours given to me by app engine. I have no problem to enable billing and pay for additional CPU, but the problem is the scaling of the system… Using 6.5 CPU hours for 100 stocks is very poor. I was wondering, given the requirements of the system as mentioned above, if there is a better and more efficient implementation (or just a small change that can help with the current implemntation) than the one presented here. Thanks!! Joel

    Read the article

  • How to load a springframework ApplicationContext from Jython

    - by staticman
    I have a class that loads a springframework application context like so: package com.offlinesupport; import org.springframework.context.ApplicationContext; import org.springframework.context.support.ClassPathXmlApplicationContext; public class OfflineScriptSupport { private static ApplicationContext appCtx; public static final void initialize() { appCtx = new ClassPathXmlApplicationContext( new String[] { "mycontext.spring.xml" } ); } public static final ApplicationContext getApplicationContext() { return appCtx; } public static final void main( String[] args ) { System.out.println( "Starting..." ); initialize(); System.out.println( "loaded" ); } } The class OfflineScriptSupport, and the file mycontext.spring.xml are each deployed into separate jars (along with other classes and resources in their respective modules). Lets say the jar files are OfflineScriptSupport.jar and *MyContext.jar". mycontext.spring.xml is put at the root of the jar. In a Jython script (*myscript.jy"), I try to call the initialize method to create the application context: from com.offlinesupport import OfflineScriptSupport OfflineScriptSupport.initialize(); I execute the Jython script with the following command (from Linux): jython -Dpython.path=spring.jar:OfflineScriptSupport.jar:MyContext.jar myscript.jy The Springframework application context cannot find the mycontext.spring.xml file. It displays the following error: java.io.FileNotFoundException: class path resource [mycontext.spring.xml] cannot be opened because it does not exist at org.springframework.core.io.ClassPathResource.getInputStream(ClassPathResource.java:137) at org.springframework.beans.factory.xml.XmlBeanDefinitionReader.loadBeanDefinitions(XmlBeanDefinitionReader.java:167) at org.springframework.beans.factory.xml.XmlBeanDefinitionReader.loadBeanDefinitions(XmlBeanDefinitionReader.java:148) at org.springframework.beans.factory.support.AbstractBeanDefinitionReader.loadBeanDefinitions(AbstractBeanDefinitionReader.java:126) at org.springframework.beans.factory.support.AbstractBeanDefinitionReader.loadBeanDefinitions(AbstractBeanDefinitionReader.java:142) at org.springframework.context.support.AbstractXmlApplicationContext.loadBeanDefinitions(AbstractXmlApplicationContext.java:113) at org.springframework.context.support.AbstractXmlApplicationContext.loadBeanDefinitions(AbstractXmlApplicationContext.java:81) at org.springframework.context.support.AbstractRefreshableApplicationContext.refreshBeanFactory(AbstractRefreshableApplicationContext.java:89) at org.springframework.context.support.AbstractApplicationContext.refresh(AbstractApplicationContext.java:269) at org.springframework.context.support.ClassPathXmlApplicationContext.<init>(ClassPathXmlApplicationContext.java:87) at org.springframework.context.support.ClassPathXmlApplicationContext.<init>(ClassPathXmlApplicationContext.java:72) at com.offlinesupport.OfflineScriptSupport.initialize(OfflineScriptSupport.java:27) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) If I run the jar directly from Java (using the main entry point in OfflineScriptSupport) it works and there is no error thrown. Is there something special about the way Jython handles classpaths making the Springframework's ClassPathXmlApplicationContext not work (i.e. not be able to find resource files in the classpath)?

    Read the article

  • symfony/zend integration - blank screen

    - by user142176
    Hi, I need to use ZendAMF on a symfony project and I'm currently working on integrating the two. I have a frontend app with two modules, one of which is 'gateway' - the AMF gateway. In my frontend app config, I have the following in the configure function: // load symfony autoloading first parent::initialize(); // Integrate Zend Framework require_once('[MY PATH TO ZEND]\Loader.php'); spl_autoload_register(array('Zend_Loader', 'autoload')); The executeIndex function my the gateway actions.class.php looks like this // No Layout $this->setLayout(false); // Set MIME Type $this->getResponse()->setContentType('application/x-amf; charset='.sfConfig::get('sf_charset')); // Disable cause this is a non-html page sfConfig::set('sf_web_debug', false); // Create AMF Server $server = new Zend_Amf_Server(); $server->setClass('MYCLASS'); echo $server->handle(); return sfView::NONE; Now when I try to visit the url for the gateway module, or even the other module which was working perfectly fine until this attempt, I only see a blank screen, with not even the symfony dev bar loaded. Oddly enough, my symfony logs are not being updated as well, which suggests that Synfony is not even being 'reached'. So presumably the error has something to do with Zend, but I have no idea how to figure out what the error could be. One thing I do know for sure is that this is not a file path error, because if I change the path in the following line (a part of frontendConfiguration as shown above), I get a Zend_Amf_Server not found error. So the path must be correct. Also if I comment out this very same line, the second module resumes to normality, and my gateway broadcasts a blank x-amf stream. spl_autoload_register(array('Zend_Loader', 'autoload')); Does anyone have any tips on how I could attach this problem? Thanks P.S. I'm currently running an older version of Zend, which is why I am using Zend_Loader instead of Zend_autoLoader (I think). But I've tried switching to the new lib, but the error still remains. So it's not a version problem as well.

    Read the article

  • [Hibernate Mapping] relationship set between table and mapping table to use joins.

    - by Matthew De'Loughry
    Hi guys, I have two table a "Module" table and a "StaffModule" I'm wanting to display a list of modules by which staff are present on the staffmodule mapping table. I've tried from Module join Staffmodule sm with ID = sm.MID with no luck, I get the following error Path Expected for join! however I thought I had the correct join too allow this but obviously not can any one help StaffModule HBM <?xml version="1.0" encoding="UTF-8"?> <!DOCTYPE hibernate-mapping PUBLIC "-//Hibernate/Hibernate Mapping DTD 3.0//EN" "http://hibernate.sourceforge.net/hibernate-mapping-3.0.dtd"> <!-- Generated Apr 26, 2010 9:50:23 AM by Hibernate Tools 3.2.1.GA --> <hibernate-mapping> <class name="Hibernate.Staffmodule" schema="WALK" table="STAFFMODULE"> <composite-id class="Hibernate.StaffmoduleId" name="id"> <key-many-to-one name="mid" class="Hibernate.Module"> <column name="MID"/> </key-many-to-one> <key-property name="staffid" type="int"> <column name="STAFFID"/> </key-property> </composite-id> </class> </hibernate-mapping> and Module.HBM <?xml version="1.0" encoding="UTF-8"?> <!DOCTYPE hibernate-mapping PUBLIC "-//Hibernate/Hibernate Mapping DTD 3.0//EN" "http://hibernate.sourceforge.net/hibernate-mapping-3.0.dtd"> <!-- Generated Apr 26, 2010 9:50:23 AM by Hibernate Tools 3.2.1.GA --> <hibernate-mapping> <class name="Hibernate.Module" schema="WALK" table="MODULE"> <id name="id" type="int"> <column name="ID"/> <generator class="assigned"/> </id> <property name="modulename" type="string"> <column length="50" name="MODULENAME"/> </property> <property name="teacherid" type="int"> <column name="TEACHERID" not-null="true"/> </property> </class> hope thats enough information! and thanks in advance.

    Read the article

  • ASP.net Repeater Control Problem (nothing outputted from datasource(sqldatareader))

    - by Phil
    I have the following code to get the repeaters' data in my usercontrol (content.ascx.vb): If did = 0 Then s = "select etc (statement works on server)" x = New SqlCommand(s, c) x.Parameters.Add("@contentid", Data.SqlDbType.Int) x.Parameters("@contentid").Value = contentid c.Open() r = x.ExecuteReader If r.HasRows Then Contactinforepeater.DataSource = r End If c.Close() r.Close() Else s = "select etc (statement works on server)" x = New SqlCommand(s, c) x.Parameters.Add("@contentid", SqlDbType.Int) x.Parameters("@contentid").Value = contentid x.Parameters.Add("@did", SqlDbType.Int) x.Parameters("@did").Value = did c.Open() r = x.ExecuteReader If r.HasRows Then Contactinforepeater.DataSource = r c.Close() r.Close() End If End If Then I have the following repeater control markup in my usercontrol (content.ascx): <asp:Repeater ID="Contactinforepeater" runat="server"> <HeaderTemplate> <h1>Contact Information</h1> </HeaderTemplate> <ItemTemplate> <table width="50%"> <tr> <td colspan="2"><%#Container.DataItem("position")%></td> </tr> <tr> <td>Name:</td> <td><%#Container.DataItem("surname")%></td> </tr> <tr> <td>Telephone:</td> <td><%#Container.DataItem("telephone")%></td> </tr> <tr> <td>Fax:</td> <td><%#Container.DataItem("fax")%></td> </tr> <tr> <td>Email:</td> <td><%#Container.DataItem("email")%></td> </tr> </table> </ItemTemplate> <SeparatorTemplate><br /><hr /><br /></SeparatorTemplate> </asp:Repeater> When I insert this usercontrol into default.aspx with this code: <%@ Register src="Modules/Content.ascx" tagname="Content" tagprefix="uc1" %> and <form id="form1" runat="server"> <div> <uc1:Content ID="Content" runat="server" /> </div> </form> I do not get any error messages but the expected content from the database is not displayed. Can someone please show me the syntax to get this working or point out where I am going wrong? Thanks in advance!

    Read the article

  • Question about DBD::CSB Statement-Functions

    - by sid_com
    From the SQL::Statement::Functions documentation: Function syntax When using SQL::Statement/SQL::Parser directly to parse SQL, functions (either built-in or user-defined) may occur anywhere in a SQL statement that values, column names, table names, or predicates may occur. When using the modules through a DBD or in any other context in which the SQL is both parsed and executed, functions can occur in the same places except that they can not occur in the column selection clause of a SELECT statement that contains a FROM clause. # valid for both parsing and executing SELECT MyFunc(args); SELECT * FROM MyFunc(args); SELECT * FROM x WHERE MyFuncs(args); SELECT * FROM x WHERE y < MyFuncs(args); # valid only for parsing (won't work from a DBD) SELECT MyFunc(args) FROM x WHERE y; Reading this I would expect that the first SELECT-statement of my example shouldn't work and the second should but it is quite the contrary. #!/usr/bin/env perl use warnings; use strict; use 5.010; use DBI; open my $fh, '>', 'test.csv' or die $!; say $fh "id,name"; say $fh "1,Brown"; say $fh "2,Smith"; say $fh "7,Smith"; say $fh "8,Green"; close $fh; my $dbh = DBI->connect ( 'dbi:CSV:', undef, undef, { RaiseError => 1, f_ext => '.csv', }); my $table = 'test'; say "\nSELECT 1"; my $sth = $dbh->prepare ( "SELECT MAX( id ) FROM $table WHERE name LIKE 'Smith'" ); $sth->execute (); $sth->dump_results(); say "\nSELECT 2"; $sth = $dbh->prepare ( "SELECT * FROM $table WHERE id = MAX( id )" ); $sth->execute (); $sth->dump_results(); outputs: SELECT 1 '7' 1 rows SELECT 2 Unknown function 'MAX' at /usr/lib/perl5/site_perl/5.10.0/SQL/Parser.pm line 2893. DBD::CSV::db prepare failed: Unknown function 'MAX' at /usr/lib/perl5/site_perl/5.10.0/SQL/Parser.pm line 2894. [for Statement "SELECT * FROM test WHERE id = MAX( id )"] at ./so_3.pl line 30. DBD::CSV::db prepare failed: Unknown function 'MAX' at /usr/lib/perl5/site_perl/5.10.0/SQL/Parser.pm line 2894. [for Statement "SELECT * FROM test WHERE id = MAX( id )"] at ./so_3.pl line 30. Could someone explaine me this behavior?

    Read the article

  • How do you clear RootLayoutPanel in GWT?

    - by kerrr
    I have Buttons attached to elements on the modules entrypoint html page using RootPanel.get("foo").add(button). If I subsequently create a LayoutPanel and attach it using RootLayoutPanel.get.add(layoutpanal) then the buttons cannot be clicked. This is all fine. If I then try and remove the layoutpanel or clear the RootLayoutPanel the buttons still cannot be clicked. Any ideas how to clear this? Have I missed a step or should you simply never try and get back to using a page's RootPanel if you have used a RootLayoutPanel? Sample code: public void onModuleLoad(){ final LayoutPanel lp1=new LayoutPanel(); ClickPanel ping=new ClickPanel("Ping"); ping.getElement().getStyle().setBackgroundColor( "#fdd" ); ping.addClickHandler( new ClickHandler(){ @Override public void onClick( ClickEvent event ){ Window.alert( "Ping!!!" ); //lp1.removeFromParent(); //RootLayoutPanel.get().remove(lp1); //RootLayoutPanel.get().removeFromParent(); RootLayoutPanel.get().clear(); } } ); ClickPanel bong=new ClickPanel("Bong"); bong.getElement().getStyle().setBackgroundColor( "#ddf" ); bong.addClickHandler( new ClickHandler(){ @Override public void onClick( ClickEvent event ){ Window.alert( "Bong!!!" ); } } ); lp1.add( ping ); lp1.setWidgetLeftWidth( ping, 100, Style.Unit.PX, 500, Style.Unit.PX ); lp1.setWidgetTopHeight( ping, 100, Style.Unit.PX, 500, Style.Unit.PX ); lp1.add( bong ); lp1.setWidgetLeftWidth( bong, 50, Style.Unit.PCT, 600, Style.Unit.PX ); lp1.setWidgetTopHeight( bong, 50, Style.Unit.PCT, 200, Style.Unit.PX ); Button b=new Button("Click Me"); b.addClickHandler( new ClickHandler(){ @Override public void onClick( ClickEvent event ){ RootLayoutPanel.get().add( lp1 ); } } ); RootPanel.get("button1").add( b ); } ClickPanel is simply overrides HTMLPanel implementing HasClickHandelers. Clicking "Click Me" opens the layout panel. Clicking the panel ping gets rid of the layout panel, but the button "Click Me" cannot be clicked. I've tried various options.

    Read the article

  • Using PHP session_id() to Make Sure iframe is Generated by Our Server Dynamically

    - by Michael Robinson
    We use iframes to show ads on our site. Iframes are used to allow us to keep the ad generation code and other site modules separate. As we track ad views on our site, and need to be able to keep an accurate count of which pagetype gets what views, I must ensure that users can't simply copy-paste the iframe in which the ad is loaded onto another site. This would cause ad count to become inflated for this page, and the count would not match the view count of the page the iframe "should" be displayed in. Before anyone says so: no I can't simply compare the page view count with the ad view count, or use the page view count * number of ads per page, as # of ads per page will not necessarily be static. I need to come up with a solution that will allow ads to be shown only for iframes that are generated dynamically and are shown on our pages. I am not familiar with PHP sessions, but from what little reading I have had time to do, the following seems to be to be an acceptable solution: Add "s = session_id()" to the src of the ad's iframe. In the code that receives and processes ad requests, only return (and count) and ad if s == session_id(). Please correct me if I'm wrong, but this would ensure: Ads would only be returned to iframes whose src was generated alongside the rest of the page's content, as is the case during normal use. We can return our logo to ad calls with an invalid session_id. So a simple example would be: One of our pages: <?php session_start(); ?> <div id="someElement"> <!-- EVERYONE LOVES ADS --> <iframe src="http//awesomesite.com/ad/can_has_ad.php?s=<?php echo session_id(); ?>></iframe> </div> ad/can_has_ad.php: <?php session_start(); ?> if($_GET['s'] == session_id()){ echo 'can has ad'; } else{ echo '<img src="http://awesomesite.com/images/canhaslogo.jpg"/>'; } And finally, copied code with static 's' parameter: <!-- HAHA LULZ I WILL SCREW WITH YOUR AD VIEW COUNTS LULZ HAHA --> <iframe src="http//awesomesite.com/ad/can_has_ad.php?s=77f2b5fcdab52f52607888746969b0ad></iframe> Which would give them an iframe showing our awesome site's logo, and not screw with our view counts. I made some basic test cases: two files, one that generates the iframe and echos it, and one that the iframe's src is pointed to, that checks the 's' parameter and shows an appropriate message depending on the result. I copied the iframe into a file and hosted it on a different server, and the correct message was displayed (cannot has ad). So, my question is: Would this work or am I being a PHP session noob, with the above test being a total fluke? Thanks for your time! Edit: I'm trying to solve this without touching the SQL server

    Read the article

  • How do I delete a [sub]hash based off of the keys/values of another hash?

    - by Zack
    Lets assume I have two hashes. One of them contains a set of data that only needs to keep things that show up in the other hash. e.g. my %hash1 = ( test1 => { inner1 => { more => "alpha", evenmore => "beta" } }, test2 => { inner2 => { more => "charlie", somethingelse => "delta" } }, test3 => { inner9999 => { ohlookmore => "golf", somethingelse => "foxtrot" } } ); my %hash2 = ( major=> { test2 => "inner2", test3 => "inner3" } ); What I would like to do, is to delete the whole subhash in hash1 if it does not exist as a key/value in hash2{major}, preferably without modules. The information contained in "innerX" does not matter, it merely must be left alone (unless the subhash is to be deleted then it can go away). In the example above after this operation is preformed hash1 would look like: my %hash1 = ( test2 => { inner2 => { more => "charlie", somethingelse => "delta" } }, ); It deletes hash1{test1} and hash1{test3} because they don't match anything in hash2. Here's what I've currently tried, but it doesn't work. Nor is it probably the safest thing to do since I'm looping over the hash while trying to delete from it. However I'm deleting at the each which should be okay? This was my attempt at doing this, however perl complains about: Can't use string ("inner1") as a HASH ref while "strict refs" in use at while(my ($test, $inner) = each %hash1) { if(exists $hash2{major}{$test}{$inner}) { print "$test($inner) is in exists.\n"; } else { print "Looks like $test($inner) does not exist, REMOVING.\n"; #not to sure if $inner is needed to remove the whole entry delete ($hash1{$test}{$inner}); } }

    Read the article

  • Code golf - hex to (raw) binary conversion

    - by Alnitak
    In response to this question asking about hex to (raw) binary conversion, a comment suggested that it could be solved in "5-10 lines of C, or any other language." I'm sure that for (some) scripting languages that could be achieved, and would like to see how. Can we prove that comment true, for C, too? NB: this doesn't mean hex to ASCII binary - specifically the output should be a raw octet stream corresponding to the input ASCII hex. Also, the input parser should skip/ignore white space. edit (by Brian Campbell) May I propose the following rules, for consistency? Feel free to edit or delete these if you don't think these are helpful, but I think that since there has been some discussion of how certain cases should work, some clarification would be helpful. The program must read from stdin and write to stdout (we could also allow reading from and writing to files passed in on the command line, but I can't imagine that would be shorter in any language than stdin and stdout) The program must use only packages included with your base, standard language distribution. In the case of C/C++, this means their respective standard libraries, and not POSIX. The program must compile or run without any special options passed to the compiler or interpreter (so, 'gcc myprog.c' or 'python myprog.py' or 'ruby myprog.rb' are OK, while 'ruby -rscanf myprog.rb' is not allowed; requiring/importing modules counts against your character count). The program should read integer bytes represented by pairs of adjacent hexadecimal digits (upper, lower, or mixed case), optionally separated by whitespace, and write the corresponding bytes to output. Each pair of hexadecimal digits is written with most significant nibble first. The behavior of the program on invalid input (characters besides [a-fA-F \t\r\n], spaces separating the two characters in an individual byte, an odd number of hex digits in the input) is undefined; any behavior (other than actively damaging the user's computer or something) on bad input is acceptable (throwing an error, stopping output, ignoring bad characters, treating a single character as the value of one byte, are all OK) The program may write no additional bytes to output. Code is scored by fewest total bytes in the source file. (Or, if we wanted to be more true to the original challenge, the score would be based on lowest number of lines of code; I would impose an 80 character limit per line in that case, since otherwise you'd get a bunch of ties for 1 line).

    Read the article

  • ASP.NET Application Level vs. Session Level and Global.asax...confused

    - by contactmatt
    The following text is from the book I'm reading, 'MCTS Self-Paced Training Kit (Exam 70-515) Web Applications Development with ASP.NET 4". It gives the rundown of the Application Life Cycle. A user first makes a request for a page in your site. The request is routed to the processing pipeline, which forwards it to the ASP.NET runtime. The ASP.NET runtime creates an instance of the ApplicationManager class; this class instance represents the .NET framework domain that will be used to execute requests for your application. An application domain isolates global variables from other applications and allows each application to load and unload separately, as required. After the application domain has been created, an instance of the HostingEnvironment class is created. This class provides access to items inside the hosting environment, such as directory folders. ASP.NET creates instances of the core objects that will be used to process the request. This includes HttpContext, HttpRequest, and HttpResponse objects. ASP.NET creates an instance of the HttpApplication class (or an instance is reused). This class is also the base class for a site’s Global.asax file. You can use this class to trap events that happen when your application starts or stops. When ASP.NET creates an instance of HttpApplication, it also creates the modules configured for the application, such as the SessionStateModule. Finally, ASP.NET processes request through the HttpApplication pipleline. This pipeline also includes a set of events for validating requests, mapping URLs, accessing the cache, and more. The book then demonstrated an example of using the Global.asax file: <script runat="server"> void Application_Start(object sender, EventArgs e) { Application["UsersOnline"] = 0; } void Session_Start(object sender, EventArgs e) { Application.Lock(); Application["UsersOnline"] = (int)Application["UsersOnline"] + 1; Application.UnLock(); } void Session_End(object sender, EventArgs e) { Application.Lock(); Application["UsersOnline"] = (int)Application["UsersOnline"] - 1; Application.UnLock(); } </script> When does an application start? Whats the difference between session and application level? I'm rather confused on how this is managed. I thought that Application level classes "sat on top of" an AppDomain object, and the AppDomain contained information specific to that Session for that user. Could someone please explain how IIS manages Applicaiton level classes, and how an HttpApplication class sits under an AppDomain? Anything is appreciated.

    Read the article

  • Myself throwing NullReferenceException... needs help

    - by Amit Ranjan
    I know it might be a weird question and its Title too, but i need your help. I am a .net dev , working on platform for the last 1.5 years. I am bit confused on the term usually we say " A Good Programmer ". I dont know ,what are the qualities of a good programmer ? Is the guy who writes a bug free code? or Can develop applications solely? or blah blah blah...lots of points. I dont know... But as far i am concerned , I know I am not a good programmer, still in learning phase an needs a lot to learn in coming days. So you guys are requested to please help me with this two problems of mine My first problem is regarding the proper Error Handling, which is a most debatable aspect of programming. We all know we use ` try { } catch { } finally { } ` in our code to manage exception. But even if I use try { } catch(exception ex) { throw ex } finally { } , different guys have different views. I still dont know the good way to handle errors. I can write code, use try-catch but still i feel I lacks something. When I saw the codes generated by .net fx tools even they uses throw ex or `throw new Exception("this is my exception")`.. I am just wondering what will be the best way to achieve the above. All means the same thing but why we avoid something. If it has some demerits then it must be made obselete.Anyways I still dont have one [how to handle errors efficiently?]. I generally follow the try-catch(execoption ex){throw ex}, and usually got stucked in debates with leads why you follow this why not that... 2.Converting your entire code blocks in modules using Design patterns of some OOPs concepts. How do you guys decide what architeture or pattern will be the best for my upcoming application based on its working, flow etc. I need to know what you guys can see that I can't. Since I know , I dont have that much experience but I can say, with my experience that experience doesnot comes either from degree/certificates or success you made instead it cames from failures you faced or got stucking situations. Pleas help me out.

    Read the article

  • Using pointers, references, handles to generic datatypes, as generic and flexible as possible

    - by Patrick
    In my application I have lots of different data types, e.g. Car, Bicycle, Person, ... (they're actually other data types, but this is just for the example). Since I also have quite some 'generic' code in my application, and the application was originally written in C, pointers to Car, Bicycle, Person, ... are often passed as void-pointers to these generic modules, together with an identification of the type, like this: Car myCar; ShowNiceDialog ((void *)&myCar, DATATYPE_CAR); The 'ShowNiceDialog' method now uses meta-information (functions that map DATATYPE_CAR to interfaces to get the actual data out of Car) to get information of the car, based on the given data type. That way, the generic logic only has to be written once, and not every time again for every new data type. Of course, in C++ you could make this much easier by using a common root class, like this class RootClass { public: string getName() const = 0; }; class Car : public RootClass { ... }; void ShowNiceDialog (RootClass *root); The problem is that in some cases, we don't want to store the data type in a class, but in a totally different format to save memory. In some cases we have hundreds of millions of instances that we need to manage in the application, and we don't want to make a full class for every instance. Suppose we have a data type with 2 characteristics: A quantity (double, 8 bytes) A boolean (1 byte) Although we only need 9 bytes to store this information, putting it in a class means that we need at least 16 bytes (because of the padding), and with the v-pointer we possibly even need 24 bytes. For hundreds of millions of instances, every byte counts (I have a 64-bit variant of the application and in some cases it needs 6 GB of memory). The void-pointer approach has the advantage that we can almost encode anything in a void-pointer and decide how to use it if we want information from it (use it as a real pointer, as an index, ...), but at the cost of type-safety. Templated solutions don't help since the generic logic forms quite a big part of the application, and we don't want to templatize all this. Additionally, the data model can be extended at run time, which also means that templates won't help. Are there better (and type-safer) ways to handle this than a void-pointer? Any references to frameworks, whitepapers, research material regarding this?

    Read the article

  • Newbie - what do I need to do with httpd.conf to make CakePHP work correctly?

    - by EmmyS
    (Not sure if this belongs here or on webmasters; please move if necessary.) I'm a total newbie to Cake and not much better with apache; I've done a lot of PHP but always with a server that's already been set up by someone else. So I'm going through the basic blog tutorial, and it says: A Note On mod_rewrite Occasionally a new user will run in to mod_rewrite issues, so I'll mention them marginally here. If the Cake welcome page looks a little funny (no images or css styles), it probably means mod_rewrite isn't functioning on your system. Here are some tips to help get you up and running: Make sure that an .htaccess override is allowed: in your httpd.conf, you should have a section that defines a section for each Directory on your server. Make sure the AllowOverride is set to All for the correct Directory. Make sure you are editing the system httpd.conf rather than a user- or site-specific httpd.conf. For some reason or another, you might have obtained a copy of CakePHP without the needed .htaccess files. This sometimes happens because some operating systems treat files that start with '.' as hidden, and don't copy them. Make sure your copy of CakePHP is from the downloads section of the site or our SVN repository. Make sure you are loading up mod_rewrite correctly! You should see something like LoadModule rewrite_module libexec/httpd/mod_rewrite.so and AddModule mod_rewrite.c in your httpd.conf." I'm using XAMPP on linux. I've found my httpd.conf file in opt/lampp/ etc, but am not sure what I need to do with it. I've searched for "rewrite", and there's only one line: LoadModule rewrite_module modules/mod_rewrite.so There's nothing about AddModule mod_rewrite.c. Do I just create a Directory section for the directory I've installed Cake in and set AlllowOverride to All? (I created a separate subdirectory of my wwwroot and installed in there, since I also have installs of Joomla and CodeIgniter.) Is there anything else I need to do? My download of Cake did come with two htaccess-type files (._.htaccess and .htaccess) - do I need to do anything with them? Thanks for any help you can provide to this non-server-admin. EDIT TO ADD virtual host sample: <VirtualHost *:80> ServerAdmin [email protected] DocumentRoot /www/docs/dummy-host.example.com ServerName dummy-host.example.com ServerAlias www.dummy-host.example.com ErrorLog logs/dummy-host.example.com-error_log CustomLog logs/dummy-host.example.com-access_log common </VirtualHost>

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • how to use window.onload?

    - by Patrick
    I'm refactoring a website using MVC. What was a set of huge pages with javascript, php, html etc etc is becoming a series of controllers and views. I'm trying to do it in a modular way so views are split in 'modules' that I can reuse in other pages when needed eg. "view/searchform displays only one div with the searchform "view/display_events displays a list of events and so on. One of the old pages was supposed to load a google map with a marker on it. Amongst the rest of the code, I can identify the relevant bits as follows <head> <script src="http://maps.google.com/maps?file=api&amp;v=2&amp;key=blablabla" type="text/javascript"></script> <script type="text/javascript"> //<![CDATA[ function load() { if (GBrowserIsCompatible()) { var map = new GMap2(document.getElementById("map")); var point = new GLatLng(<?php echo ($info->lat && $info->lng) ? $info->lat .",". $info->lng : "51.502759,-0.126171"; ?>); map.setCenter(new GLatLng(<?php echo ($info->lat && $info->lng) ? $info->lat .",". $info->lng : "51.502759,-0.126171"; ?>), 15); map.addControl(new GLargeMapControl()); map.addControl(new GScaleControl()); map.addOverlay(new GMarker(point)); var marker = createMarker(point,GIcon(),"CIAO"); map.addOverlay(marker); } } //]]> </script> </head> ...then <body onload="load()" onunload="GUnload()"> ...and finally this div where the map should be displayed <div id="map" style="width: 440px; height: 300px"> </div> Don't know much about js, but my understanding is that a) I have to include the scripts in the view module I'm writing (directly in the HTML? I would prefer to load a separate script) b) I have to trigger that function using the equivalent of body onload... (obviously there's no body tag in my view. In my ignorance I've tried div onload=.... but didn't seem to be working :) What do you suggest I do? I've read about window.onload but don't know what's the correct syntax for that. please keep in mind that other parts of the page include other js functions (eg, google adsense) that are called after the footer.

    Read the article

  • How to interpret kernel panics?

    - by Owen
    Hi all, I'm new to linux kernel and could barely understand how to debug kernel panics. I have this error below and I don't know where in the C code should I start checking. I was thinking maybe I could echo what functions are being called so I could check where in the code is this null pointer dereferenced. What print function should I use ? How do you interpret the error message below? Unable to handle kernel NULL pointer dereference at virtual address 0000000d pgd = c7bdc000 [0000000d] *pgd=4785f031, *pte=00000000, *ppte=00000000 Internal error: Oops: 17 [#1] PREEMPT Modules linked in: bcm5892_secdom_fw(P) bcm5892_lcd snd_bcm5892 msr bcm5892_sci bcm589x_ohci_p12 bcm5892_skeypad hx_decoder(P) pinnacle hx_memalloc(P) bcm_udc_dwc scsi_mod g_serial sd_mod usb_storage CPU: 0 Tainted: P (2.6.27.39-WR3.0.2ax_standard #1) PC is at __kmalloc+0x70/0xdc LR is at __kmalloc+0x48/0xdc pc : [c0098cc8] lr : [c0098ca0] psr: 20000093 sp : c7a9fd50 ip : c03a4378 fp : c7a9fd7c r10: bf0708b4 r9 : c7a9e000 r8 : 00000040 r7 : bf06d03c r6 : 00000020 r5 : a0000093 r4 : 0000000d r3 : 00000000 r2 : 00000094 r1 : 00000020 r0 : c03a4378 Flags: nzCv IRQs off FIQs on Mode SVC_32 ISA ARM Segment user Control: 00c5387d Table: 47bdc008 DAC: 00000015 Process sh (pid: 1088, stack limit = 0xc7a9e260) Stack: (0xc7a9fd50 to 0xc7aa0000) fd40: c7a6a1d0 00000020 c7a9fd7c c7ba8fc0 fd60: 00000040 c7a6a1d0 00000020 c71598c0 c7a9fd9c c7a9fd80 bf06d03c c0098c64 fd80: c71598c0 00000003 c7a6a1d0 bf06c83c c7a9fdbc c7a9fda0 bf06d098 bf06d008 fda0: c7159880 00000000 c7a6a2d8 c7159898 c7a9fde4 c7a9fdc0 bf06d130 bf06d078 fdc0: c79ca000 c7159880 00000000 00000000 c7afbc00 c7a9e000 c7a9fe0c c7a9fde8 fde0: bf06d4b4 bf06d0f0 00000000 c79fd280 00000000 0f700000 c7a9e000 00000241 fe00: c7a9fe3c c7a9fe10 c01c37b4 bf06d300 00000000 c7afbc00 00000000 00000000 fe20: c79cba84 c7463c78 c79fd280 c7473b00 c7a9fe6c c7a9fe40 c00a184c c01c35e4 fe40: 00000000 c7bb0005 c7a9fe64 c79fd280 c7463c78 00000000 c00a1640 c785e380 fe60: c7a9fe94 c7a9fe70 c009c438 c00a164c c79fd280 c7a9fed8 c7a9fed8 00000003 fe80: 00000242 00000000 c7a9feb4 c7a9fe98 c009c614 c009c2a4 00000000 c7a9fed8 fea0: c7a9fed8 00000000 c7a9ff64 c7a9feb8 c00aa6bc c009c5e8 00000242 000001b6 fec0: 000001b6 00000241 00000022 00000000 00000000 c7a9fee0 c785e380 c7473b00 fee0: d8666b0d 00000006 c7bb0005 00000300 00000000 00000000 00000001 40002000 ff00: c7a9ff70 c79b10a0 c79b10a0 00005402 00000003 c78d69c0 ffffff9c 00000242 ff20: 000001b6 c79fd280 c7a9ff64 c7a9ff38 c785e380 c7473b00 00000000 00000241 ff40: 000001b6 ffffff9c 00000003 c7bb0000 c7a9e000 00000000 c7a9ff94 c7a9ff68 ff60: c009c128 c00aa380 4d18b5f0 08000000 00000000 00071214 0007128c 00071214 ff80: 00000005 c0027ee4 c7a9ffa4 c7a9ff98 c009c274 c009c0d8 00000000 c7a9ffa8 ffa0: c0027d40 c009c25c 00071214 0007128c 0007128c 00000241 000001b6 00000000 ffc0: 00071214 0007128c 00071214 00000005 00073580 00000003 000713e0 400010d0 ffe0: 00000001 bef0c7b8 000269cc 4d214fec 60000010 0007128c 00000000 00000000 Backtrace: [] (__kmalloc+0x0/0xdc) from [] (gs_alloc_req+0x40/0x70 [g_serial]) r8:c71598c0 r7:00000020 r6:c7a6a1d0 r5:00000040 r4:c7ba8fc0 [] (gs_alloc_req+0x0/0x70 [g_serial]) from [] (gs_alloc_requests+0x2c/0x78 [g_serial]) r7:bf06c83c r6:c7a6a1d0 r5:00000003 r4:c71598c0 [] (gs_alloc_requests+0x0/0x78 [g_serial]) from [] (gs_start_io+0x4c/0xac [g_serial]) r7:c7159898 r6:c7a6a2d8 r5:00000000 r4:c7159880 [] (gs_start_io+0x0/0xac [g_serial]) from [] (gs_open+0x1c0/0x224 [g_serial]) r9:c7a9e000 r8:c7afbc00 r7:00000000 r6:00000000 r5:c7159880 r4:c79ca000 [] (gs_open+0x0/0x224 [g_serial]) from [] (tty_open+0x1dc/0x314) [] (tty_open+0x0/0x314) from [] (chrdev_open+0x20c/0x22c) [] (chrdev_open+0x0/0x22c) from [] (__dentry_open+0x1a0/0x2b8) r8:c785e380 r7:c00a1640 r6:00000000 r5:c7463c78 r4:c79fd280 [] (__dentry_open+0x0/0x2b8) from [] (nameidata_to_filp+0x38/0x50) [] (nameidata_to_filp+0x0/0x50) from [] (do_filp_open+0x348/0x6f4) r4:00000000 [] (do_filp_open+0x0/0x6f4) from [] (do_sys_open+0x5c/0x170) [] (do_sys_open+0x0/0x170) from [] (sys_open+0x24/0x28) r8:c0027ee4 r7:00000005 r6:00071214 r5:0007128c r4:00071214 [] (sys_open+0x0/0x28) from [] (ret_fast_syscall+0x0/0x2c) Code: e59c4080 e59c8090 e3540000 159c308c (17943103) ---[ end trace be196e7cee3cb1c9 ]--- note: sh[1088] exited with preempt_count 2 process '-/bin/sh' (pid 1088) exited. Scheduling for restart. Welcome to Wind River Linux

    Read the article

  • App losing db connection

    - by DaveKub
    I'm having a weird issue with an old Delphi app losing it's database connection. Actually, I think it's losing something else that then makes the connection either drop or be unusable. The app is written in Delphi 6 and uses the Direct Oracle Access component (v4.0.7.1) to connect to an Oracle 9i database. The app runs as a service and periodically queries the db using a TOracleQuery object (qryAlarmList). The method that is called to do this looks like this: procedure TdmMain.RefreshAlarmList; begin try qryAlarmList.Execute; except on E: Exception do begin FStatus := ssError; EventLog.LogError(-1, 'TdmMain.RefreshAlarmList', 'Message: ' + E.Message); end; end; end; It had been running fine for years, until a couple of Perl scripts were added to this machine. These scripts run every 15 minutes and look for datafiles to import into the db, and then they do a some calculations and a bunch of reads/writes to/from the db. For some reason, when they are processing large amounts of data, and then the Delphi app tries to query the db, the Delphi app throws an exception at the "qryAlarmList.Execute" line in the above code listing. The exception is always: Access violation at address 00000000. read of address 00000000 HOW can something that the Perl scripts are doing cause this?? There are other Perl scripts on this machine that load data using the same modules and method calls and we didn't have problems. To make it even weirder, there are two other apps that will also suddenly lose their ability to talk to the database at the same time as the Perl stuff is running. Neither of those apps run on this machine, but both are Delphi 6 apps that use the same DOA component to connect to the same database. We have other apps that connect to the same db, written in Java or C# and they don't seem to have any problems. I've tried adding code before the '.Execute' method is called to: check the session's connection (session.CheckConnection(true); always comes back as 'ccOK'). see whether I can access a field of the qryAlarmList object to see if maybe it's become null; can access it fine. check the state of the qryAlarmList; always says it's qsIdle. Does anyone have any suggestions of something to try? This is driving me nuts! Dave

    Read the article

  • mod_rewrite not working for a specific directory

    - by punkish
    This has got me completely foxed for a couple of days now, and I am convinced that I will look stupid once I solve it, but will be even stupider if I don't ask for help now. I have mod_rewrite working successfully on my localhost (no vhosts involved; this is my laptop, my development machine), and I use .htaccess in various directories to help rewrite crufty URLs to clean ones. EXCEPT... it doesn't work in one directory. Since it is impossible to reproduce my entire laptop in this question, I provide the following details. In my httpd.conf, I have mod_rewrite.so loaded. LoadModule rewrite_module modules/mod_rewrite.so In my httpd.conf, I have included another conf file like so Include /usr/local/apache2/conf/other/punkish.conf In my punkish.conf, I have directories defined like so DocumentRoot "/Users/punkish/Sites" <Directory "/Users/punkish/Sites"> Options ExecCGI AllowOverride None Order allow,deny Allow from all </Directory> <Directory "/Users/punkish/Sites/one"> Options FollowSymLinks AllowOverride All Order allow,deny Allow from all </Directory> <Directory "/Users/punkish/Sites/two"> Options FollowSymLinks AllowOverride All Order allow,deny Allow from all </Directory> In ~/Sites/one I have the following .htaccess file RewriteEngine On RewriteBase /one/ # If an actual file or directory is requested, serve directly RewriteCond %{REQUEST_FILENAME} !-f RewriteCond %{REQUEST_FILENAME} !-d # Otherwise, pass everything through to the dispatcher RewriteRule ^(.*)$ index.cgi/$1 [L,QSA] and, everything works just fine. However, in my directory ~/Sites/two I have the following .htaccess file RewriteEngine On RewriteBase /two/ # If an actual file or directory is requested, serve directly RewriteCond %{REQUEST_FILENAME} !-f RewriteCond %{REQUEST_FILENAME} !-d # Otherwise, pass everything through to the dispatcher RewriteRule ^(.*)$ index.cgi/$1 [L,QSA] and, nothing works. Nada. Zip. Zilch. I just get a 404. I have determined that mod_rewrite is not even looking at my ~/Sites/two/.htaccess by putting spurious commands in it and not getting any error other than 404. Another confounding issue -- I have turned on RewriteLog in my httpd.conf with RewriteLogLevel 3, but my rewrite_log is completely empty. I know this is hard to trouble shoot unless sitting physically at the computer in question, but I hope someone can give me some indication as to what is going on. **Update: ** There are no aliases involved anywhere. This is my laptop, and everything is under the above stated Document Root, so I just access each directory as http://localhost/. Yes, typos are a big possibility (I did say that I will look stupid once I solve it, however, for now, I have not discovered a single typo anywhere, and yes, I have restarted Apache about a dozen times now. I even thought that perhaps I had two different Apaches running, but no, I have only one, the one under /usr/local/apache2, and I installed it myself a while back.

    Read the article

  • Do you use an exception class in your Perl programs? Why or why not?

    - by daotoad
    I've got a bunch of questions about how people use exceptions in Perl. I've included some background notes on exceptions, skip this if you want, but please take a moment to read the questions and respond to them. Thanks. Background on Perl Exceptions Perl has a very basic built-in exception system that provides a spring-board for more sophisticated usage. For example die "I ate a bug.\n"; throws an exception with a string assigned to $@. You can also throw an object, instead of a string: die BadBug->new('I ate a bug.'); You can even install a signal handler to catch the SIGDIE psuedo-signal. Here's a handler that rethrows exceptions as objects if they aren't already. $SIG{__DIE__} = sub { my $e = shift; $e = ExceptionObject->new( $e ) unless blessed $e; die $e; } This pattern is used in a number of CPAN modules. but perlvar says: Due to an implementation glitch, the $SIG{DIE} hook is called even inside an eval(). Do not use this to rewrite a pending exception in $@ , or as a bizarre substitute for overriding CORE::GLOBAL::die() . This strange action at a distance may be fixed in a future release so that $SIG{DIE} is only called if your program is about to exit, as was the original intent. Any other use is deprecated. So now I wonder if objectifying exceptions in sigdie is evil. The Questions Do you use exception objects? If so, which one and why? If not, why not? If you don't use exception objects, what would entice you to use them? If you do use exception objects, what do you hate about them, and what could be better? Is objectifying exceptions in the DIE handler a bad idea? Where should I objectify my exceptions? In my eval{} wrapper? In a sigdie handler? Are there any papers, articles or other resources on exceptions in general and in Perl that you find useful or enlightening.

    Read the article

  • sys.path() and PYTHONPATH issues

    - by Justin
    I've been learning Python, I'm working in 2.7.3, and I'm trying to understand import statements. The documentation says that when you attempt to import a module, the interpreter will first search for one of the built-in modules. What is meant by a built-in module? Then, the documentation says that the interpreter searches in the directories listed by sys.path, and that sys.path is initialized from these sources: the directory containing the input script (or the current directory). PYTHONPATH (a list of directory names, with the same syntax as the shell variable PATH). the installation-dependent default. Here is a sample output of a sys.path command from my computer using python in command-line mode: (I deleted a few so that it wouldn't be huge) ['', '/usr/lib/python2.7', '/usr/lib/python2.7/lib-old', '/usr/lib/python2.7/lib-dynload', '/usr/local/lib/python2.7/dist-packages', '/usr/lib/python2.7/dist-packages', '/usr/lib/python2.7/dist-packages/PIL', '/usr/lib/python2.7/dist-packages/gst-0.10', '/usr/lib/python2.7/dist-packages/gtk-2.0', '/usr/lib/pymodules/python2.7', '/usr/lib/python2.7/dist-packages/ubuntuone-couch', '/usr/lib/python2.7/dist-packages/ubuntuone-storage-protocol'] Now, I'm assuming that the '' path refers to the directory containing the 'script', and so I figured the rest of them would be coming from my PYTHONPATH environmental variable. However, when I go to the terminal and type env, PYTHONPATH doesn't exist as an environmental variable. I also tried import os then os.environ, but I get the same output. Do I really not have a PYTHONPATH environmental variable? I don't believe I ever specifically defined a PYTHONPATH environmental variable, but I assumed that when I installed new packages they automatically altered that environment variable. If I don't have a PYTHONPATH, how is my sys.path getting populated? If I download new packages, how does Python know where to look for them if I don't have this PYTHONPATH variable? How do environment variables work? From what I understand, environment variables are specific to the process for which they are set, however, if I open multiple terminal windows and run env, they all display a number of identical variables, for example, PATH. I know there file locations for persistent environment variables, for example /etc/environment, which contains my PATH variable. Is it possible to tell where a persistent environment variable is stored? What is the recommended location for storing new persistent environment variables? How do environment variables actually work with say, the Python interpreter? The Python interpreter looks for PYTHONPATH, but how does it work at the nitty-gritty level?

    Read the article

  • Lighttpd + fastcgi + python (for django) slow on first request

    - by EagleOne
    I'm having a problem with a django website I host with lighttpd + fastcgi. It works great but it seems that the first request always takes up to 3seconds. Subsequent requests are much faster (<1s). I activated access logs in lighttpd in order to track the issue. But I'm kind of stuck. Here are logs where I 'lose' 4s (from 10:04:17 to 10:04:21): 2012-12-01 10:04:17: (mod_fastcgi.c.3636) handling it in mod_fastcgi 2012-12-01 10:04:17: (response.c.470) -- before doc_root 2012-12-01 10:04:17: (response.c.471) Doc-Root : /var/www 2012-12-01 10:04:17: (response.c.472) Rel-Path : /finderauto.fcgi 2012-12-01 10:04:17: (response.c.473) Path : 2012-12-01 10:04:17: (response.c.521) -- after doc_root 2012-12-01 10:04:17: (response.c.522) Doc-Root : /var/www 2012-12-01 10:04:17: (response.c.523) Rel-Path : /finderauto.fcgi 2012-12-01 10:04:17: (response.c.524) Path : /var/www/finderauto.fcgi 2012-12-01 10:04:17: (response.c.541) -- logical -> physical 2012-12-01 10:04:17: (response.c.542) Doc-Root : /var/www 2012-12-01 10:04:17: (response.c.543) Rel-Path : /finderauto.fcgi 2012-12-01 10:04:17: (response.c.544) Path : /var/www/finderauto.fcgi 2012-12-01 10:04:21: (response.c.128) Response-Header: HTTP/1.1 200 OK Last-Modified: Sat, 01 Dec 2012 09:04:21 GMT Expires: Sat, 01 Dec 2012 09:14:21 GMT Content-Type: text/html; charset=utf-8 Cache-Control: max-age=600 Transfer-Encoding: chunked Date: Sat, 01 Dec 2012 09:04:21 GMT Server: lighttpd/1.4.28 I guess that if there is a problem, it's whith my configuration. So here is the way I launch my django app: python manage.py runfcgi method=threaded host=127.0.0.1 port=3033 And here is my lighttpd conf: server.modules = ( "mod_access", "mod_alias", "mod_compress", "mod_redirect", "mod_rewrite", "mod_fastcgi", "mod_accesslog", ) server.document-root = "/var/www" server.upload-dirs = ( "/var/cache/lighttpd/uploads" ) server.errorlog = "/var/log/lighttpd/error.log" server.pid-file = "/var/run/lighttpd.pid" server.username = "www-data" server.groupname = "www-data" accesslog.filename = "/var/log/lighttpd/access.log" debug.log-request-header = "enable" debug.log-response-header = "enable" debug.log-file-not-found = "enable" debug.log-request-handling = "enable" debug.log-timeouts = "enable" debug.log-ssl-noise = "enable" debug.log-condition-cache-handling = "enable" debug.log-condition-handling = "enable" fastcgi.server = ( "/finderauto.fcgi" => ( "main" => ( # Use host / port instead of socket for TCP fastcgi "host" => "127.0.0.1", "port" => 3033, #"socket" => "/home/finderadmin/finderauto.sock", "check-local" => "disable", "fix-root-scriptname" => "enable", ) ), ) alias.url = ( "/media" => "/home/user/django/contrib/admin/media/", ) url.rewrite-once = ( "^(/media.*)$" => "$1", "^/favicon\.ico$" => "/media/favicon.ico", "^(/.*)$" => "/finderauto.fcgi$1", ) index-file.names = ( "index.php", "index.html", "index.htm", "default.htm", " index.lighttpd.html" ) url.access-deny = ( "~", ".inc" ) static-file.exclude-extensions = ( ".php", ".pl", ".fcgi" ) ## Use ipv6 if available #include_shell "/usr/share/lighttpd/use-ipv6.pl" dir-listing.encoding = "utf-8" server.dir-listing = "enable" compress.cache-dir = "/var/cache/lighttpd/compress/" compress.filetype = ( "application/x-javascript", "text/css", "text/html", "text/plain" ) include_shell "/usr/share/lighttpd/create-mime.assign.pl" include_shell "/usr/share/lighttpd/include-conf-enabled.pl" If any of you could help me finding out where I lose these 3 or 4 s. I would much appreciate. Thanks in advance!

    Read the article

  • Passing custom info to mongrel_rails start

    - by whaka
    One thing I really don't understand is how I can pass custom start-up options to a mongrel instance. I see that a common approach is the use environment variables, but in my environment this is not going to work because my rails application serves many different clients. Much code is shared between clients, but there are also many differences which I implement by subclassing controllers and views to overload or extend existing features or introduce new ones. To make this all work, I simply add the paths to client specific modules the module load path ($:). In order to start the application for a particular client, I could now use an environment variable like say, TARGET=AMAZONE. Unfortunately, on some systems I'm running multiple mongrel clusters, each cluster serving a different client. Some of these systems run under Windows and to start mongrel I installed mongrel_services. Clearly, this makes my environment variable unsuitable. Passing this extra bit of data to the application is proving to be a real challenge. For a start, mongrel_rails service_install will reject any [custom] command line parameters that aren't documented. I'm not too concerned as installing the services using the install program is trivial. However, even if I manage to install mongrel_services such that when run it passes the custom command line option --target to mongrel_rails start, I get an error because mongrel_rails doesn't recognize the switch. So here were the things I looked at: Pass an extra parameter: mongrel_rails start --target XYZ ... use a config file and add target:XYZ, then do: mongrel_rails start -C x:\myapp\myconfig.yml modify the file: Ruby\lib\ruby\gems\1.8\gems\mongrel-1.1.5-x86-mswin32-60\lib\mongrel\command.rb Perhaps I can use the --script option, but all docs that I found on it were for Unix 1 and 2 simply don't work. I played with 4 but never managed it to do anything. So I had no choice but to go with 3. While it is relatively simple, I hate changing ruby library code. Particularly disappointing is that 2 doesn't work. I mean what is so unreasonable about adding other [custom] options in the config file? Actually I think this is a fundamental piece that is missing in rails. Somehow, the application should be able to register and access command line arguments it expects. If anybody has a good idea how to do this more elegantly using the current infrastructure, I have a chocolate fish to give away!!!

    Read the article

< Previous Page | 143 144 145 146 147 148 149 150 151 152 153 154  | Next Page >