Search Results

Search found 20092 results on 804 pages for 'python import'.

Page 147/804 | < Previous Page | 143 144 145 146 147 148 149 150 151 152 153 154  | Next Page >

  • Decode base64 data as array in Python

    - by skerit
    I'm using this handy Javascript function to decode a base64 string and get an array in return. This is the string: base64_decode_array('6gAAAOsAAADsAAAACAEAAAkBAAAKAQAAJgEAACcBAAAoAQAA') This is what's returned: 234,0,0,0,235,0,0,0,236,0,0,0,8,1,0,0,9,1,0,0,10,1,0,0,38,1,0,0,39,1,0,0,40,1,0,0 The problem is I don't really understand the javascript function: var base64chars = 'ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz0123456789+/'.split(""); var base64inv = {}; for (var i = 0; i < base64chars.length; i++) { base64inv[base64chars[i]] = i; } function base64_decode_array (s) { // remove/ignore any characters not in the base64 characters list // or the pad character -- particularly newlines s = s.replace(new RegExp('[^'+base64chars.join("")+'=]', 'g'), ""); // replace any incoming padding with a zero pad (the 'A' character is zero) var p = (s.charAt(s.length-1) == '=' ? (s.charAt(s.length-2) == '=' ? 'AA' : 'A') : ""); var r = []; s = s.substr(0, s.length - p.length) + p; // increment over the length of this encrypted string, four characters at a time for (var c = 0; c < s.length; c += 4) { // each of these four characters represents a 6-bit index in the base64 characters list // which, when concatenated, will give the 24-bit number for the original 3 characters var n = (base64inv[s.charAt(c)] << 18) + (base64inv[s.charAt(c+1)] << 12) + (base64inv[s.charAt(c+2)] << 6) + base64inv[s.charAt(c+3)]; // split the 24-bit number into the original three 8-bit (ASCII) characters r.push((n >>> 16) & 255); r.push((n >>> 8) & 255); r.push(n & 255); } // remove any zero pad that was added to make this a multiple of 24 bits return r; } What's the function of those "<<<" and "" characters. Or is there a function like this for Python?

    Read the article

  • itertools.product eliminating repeated reversed tuples

    - by genclik27
    I asked a question yesterday and thanks to Tim Peters, it is solved. The question is here; itertools.product eliminating repeated elements The new question is further version of this. This time I will generate tuples inside of tuples. Here is an example; lis = [[(1,2), (3,4)], [(5,2), (1,2)], [(2,1), (1,2)]] When I use it in itertools.product function this is what I get, ((1, 2), (5, 2), (2, 1)) ((1, 2), (5, 2), (1, 2)) ((1, 2), (1, 2), (2, 1)) ((1, 2), (1, 2), (1, 2)) ((3, 4), (5, 2), (2, 1)) ((3, 4), (5, 2), (1, 2)) ((3, 4), (1, 2), (2, 1)) ((3, 4), (1, 2), (1, 2)) I want to change it in a way that if a sequence has (a,b) inside of it, then it can not have (b,a). In this example if you look at this sequence ((3, 4), (1, 2), (2, 1)) it has (1,2) and (2,1) inside of it. So, this sequence ((3, 4), (1, 2), (2, 1)) should not be considered in the results. As I said, I asked similar question before, in that case it was not considering duplicate elements. I try to adapt it to my problem. Here is modified code. Changed parts in old version are taken in comments. def reverse_seq(seq): s = [] for i in range(len(seq)): s.append(seq[-i-1]) return tuple(s) def uprod(*seqs): def inner(i): if i == n: yield tuple(result) return for elt in sets[i] - reverse: #seen.add(elt) rvrs = reverse_seq(elt) reverse.add(rvrs) result[i] = elt for t in inner(i+1): yield t #seen.remove(elt) reverse.remove(rvrs) sets = [set(seq) for seq in seqs] n = len(sets) #seen = set() reverse = set() result = [None] * n for t in inner(0): yield t In my opinion this code should work but I am getting error for the input lis = [[(1,2), (3,4)], [(5,2), (1,2)], [(2,1), (1,2)]]. I could not understand where I am wrong. for i in uprod(*lis): print i Output is, ((1, 2), (1, 2), (1, 2)) Traceback (most recent call last): File "D:\Users\SUUSER\workspace tree\sequence_covering _array\denemeler_buraya.py", line 39, in <module> for i in uprod(*lis): File "D:\Users\SUUSER\workspace tree\sequence_covering _array\denemeler_buraya.py", line 32, in uprod for t in inner(0): File "D:\Users\SUUSER\workspace tree\sequence_covering _array\denemeler_buraya.py", line 22, in inner for t in inner(i+1): File "D:\Users\SUUSER\workspace tree\sequence_covering _array\denemeler_buraya.py", line 25, in inner reverse.remove(rvrs) KeyError: (2, 1) Thanks,

    Read the article

  • Python File Search Line And Return Specific Number of Lines after Match

    - by Simos Anderson
    I have a text file that has lines representing some data sets. The file itself is fairly long but it contains certain sections of the following format: Series_Name INFO Number of teams : n1 | Team | # | wins | | TeamName1 | x | y | . . . | TeamNamen1 | numn | numn | Some Irrelevant lines Series_Name2 INFO Number of teams : n1 | Team | # | wins | | TeamName1 | num1 | num2 | . where each section has a header that begins with the Series_Name. Each Series_Name is different. The line with the header also includes the number of teams in that series, n1. Following the header line is a set of lines that represents a table of data. For each series there are n1+1 rows in the table, where each row shows an individual team name and associated stats. I have been trying to implement a function that will allow the user to search for a Team name and then print out the line in the table associated with that team. However, certain team names show up under multiple series. To resolve this, I am currently trying to write my code so that the user can search for the header line with series name first and then print out just the following n1+1 lines that represent the data associated with the series. Here's what I have come up with so far: import re print fname = raw_input("Enter filename: ") seriesname = raw_input("Enter series: ") def findcounter(fname, seriesname): logfile = open(fname, "r") pat = 'INFO Number of teams :' for line in logfile: if seriesname in line: if pat in line: s=line pattern = re.compile(r"""(?P<name>.*?) #starting name \s*INFO #whitespace and success \s*Number\s*of\s*teams #whitespace and strings \s*\:\s*(?P<n1>.*)""",re.VERBOSE) match = pattern.match(s) name = match.group("name") n1 = int(match.group("n1")) print name + " has " + str(n1) + " teams" lcount = 0 for line in logfile: if line.startswith(name): if pat in line: while lcount <= n1: s.append(line) lcount += 1 return result The first part of my code works; it matches the header line that the person searches for, parses the line, and then prints out how many teams are in that series. Since the header line basically tells me how many lines are in the table, I thought that I could use that information to construct a loop that would continue printing each line until a set counter reached n1. But I've tried running it, and I realize that the way I've set it up so far isn't correct. So here's my question: How do you return a number of lines after a matched line when given the number of desired lines that follow the match? I'm new to programming, and I apologize if this question seems silly. I have been working on this quite diligently with no luck and would appreciate any help.

    Read the article

  • Optimizing a memoization decorator not increase call stack

    - by Tyler Crompton
    I have a very, very basic memoization decorator that I need to optimize below: def memoize(function): memos = {} def wrapper(*args): try: return memos[args] except KeyError: pass result = function(*args) memos[args] = result return result return wrapper The goal is to make this so that it doesn't add on to the call stack. It actually doubles it right now. I realize that I can embed this on a function by function basis, but that is not desired as I would like a global solution for memoizing. Any ideas?

    Read the article

  • Problems installing PIL after OSX 10.9

    - by user2632417
    I installed Mac OSX 10.9 the day it came out. Afterwards I decided I needed to install PIL. I'd installed it before, but it appeared the update had broken that. When I try to use pip to install PIL, it fails when building _imaging. It appears the root cause is this. /usr/include/sys/cdefs.h:655:2: error: Unsupported architecture Theres also a similar error here: /usr/include/machine/limits.h:8:2: error: architecture not supported and here: /usr/include/machine/_types.h:34:2: error: architecture not supported Then there's a whole list of missing types. /usr/include/sys/_types.h:94:9: error: unknown type name '__int64_t' typedef __int64_t __darwin_blkcnt_t; /* total blocks */ ^ /usr/include/sys/_types.h:95:9: error: unknown type name '__int32_t' typedef __int32_t __darwin_blksize_t; /* preferred block size */ ^ /usr/include/sys/_types.h:96:9: error: unknown type name '__int32_t' typedef __int32_t __darwin_dev_t; /* dev_t */ ^ /usr/include/sys/_types.h:99:9: error: unknown type name '__uint32_t' typedef __uint32_t __darwin_gid_t; /* [???] process and group IDs */ ^ /usr/include/sys/_types.h:100:9: error: unknown type name '__uint32_t' typedef __uint32_t __darwin_id_t; /* [XSI] pid_t, uid_t, or gid_t*/ ^ /usr/include/sys/_types.h:101:9: error: unknown type name '__uint64_t' typedef __uint64_t __darwin_ino64_t; /* [???] Used for 64 bit inodes */ Needless to say I don't know where to go from here. I've got a couple of guesses, but I don't even know how to check. Wrong include probably as a result of a badly configured environment variable Problem with Xcode's installation/ missing command line tools Messed up header files If anyone has any suggestions either to check one of those possibilities or for one of their own I'm all ears.

    Read the article

  • Parsing Data in XML and Storing to DB in Python

    - by Rakesh
    Hi Guys i have problem parsing an xml file and entering the data to sqlite, the format is like i need to enter the chracters before the token like 111,AAA,BBB etc <DOCUMENT> <PAGE width="544.252" height="634.961" number="1" id="p1"> <MEDIABOX x1="0" y1="0" x2="544.252" y2="634.961"/> <BLOCK id="p1_b1"> <TEXT width="37.7" height="74.124" id="p1_t1" x="51.1" y="20.8652"> <TOKEN sid="p1_s11" id="p1_w1" font-name="Verdanae" bold="yes" italic="no">111</TOKEN> </TEXT> </BLOCK> <BLOCK id="p1_b3"> <TEXT width="151.267" height="10.725" id="p1_t6" x="24.099" y="572.096"> <TOKEN sid="p1_s35" id="p1_w22" font-name="Verdanae" bold="yes" italic="yes">AAA</TOKEN> <TOKEN sid="p1_s36" id="p1_w23" font-name="verdanae" bold="yes" italic="no">BBB</TOKEN> <TOKEN sid="p1_s37" id="p1_w24" font-name="verdanae" bold="yes" italic="no">CCC</TOKEN> </TEXT> </BLOCK> <BLOCK id="p1_b4"> <TEXT width="82.72" height="26" id="p1_t7" x="55.426" y="138.026"> <TOKEN sid="p1_s42" id="p1_w29" font-name="verdanae" bold="yes" italic="no">DDD</TOKEN> <TOKEN sid="p1_s43" id="p1_w30" font-name="verdanae" bold="yes" italic="no">EEE</TOKEN> </TEXT> <TEXT width="101.74" height="26" id="p1_t8" x="55.406" y="162.026"> <TOKEN sid="p1_s45" id="p1_w31" font-name="verdanae" bold="yes" italic="no">FFF</TOKEN> </TEXT> <TEXT width="152.96" height="26" id="p1_t9" x="55.406" y="186.026"> <TOKEN sid="p1_s47" id="p1_w32" font-name="verdanae" bold="yes" italic="no">GGG</TOKEN> <TOKEN sid="p1_s48" id="p1_w33" font-name="verdanae" bold="yes" italic="no">HHH</TOKEN> </TEXT> </BLOCK> </PAGE> </DOCUMENT> in .net it is done with 3 foreach loops 1. for "DOCUMENT/PAGE/BLOCK" 2."TEXT" 3. "TOKEN" and then it is entered into the DB i dont get how to do it in python and i am trying it with lxml module

    Read the article

  • Launchpad failed to build after "quickly submitubuntu"

    - by function
    I uploaded my python project by running "quickly submitubuntu", but it failed to build on Launchpad. "quickly submitubuntu" is supposed to add package dependencies automatically, but the error log https://launchpadlibrarian.net/108711786/buildlog_ubuntu-precise-i386.indicator-launcher_12.06.24_FAILEDTOBUILD.txt.gz says some python modules aren't found; for example "ERROR: Python module gconf not found". Is this a bug in quickly, or is there something wrong in my program?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • copying same file name from client to server using tcp protocol with same size of file

    - by user3686570
    This is the client and server program where a client sends a file to server to save in the server. There is a issuse in that same file name is not getting copied on the server with same file size Please help me in this Client program import socket import sys s = socket.socket(socket.AF_INET, socket.SOCK_STREAM) s.connect(("localhost",9999)) path=raw_input("Please enter the complete PATH of your file : ") f=open (path, "rb") l = f.read(256) while (l): s.sendall(l) l = f.read(10000) s.close() Server Program import socket import sys s = socket.socket(socket.AF_INET, socket.SOCK_STREAM) s.bind(("localhost",9999)) s.listen(10) while True: s, address = s.accept() print address i=1 f = open( str(i),'wb') #open in binary #i=i+1 while (True): l=s.recv(256) #while (l): f.write(l) l=s.recv(256) print 'File recieve succesfully' f.close() #sc.close() s.close() Thanks in advance

    Read the article

  • Is C# development effectively inseparable from the IDE you use?

    - by Ghopper21
    I'm a Python programmer learning C# who is trying to stop worrying and just love C# for what it is, rather than constantly comparing it back to Python. I'm really get caught up on one point: the lack of explicitness about where things are defined, as detailed in this Stack Overflow question. In short: in C#, using foo doesn't tell you what names from foo are being made available, which is analogous to from foo import * in Python -- a form that is discouraged within Python coding culture for being implicit rather than the more explicit approach of from foo import bar. I was rather struck by the Stack Overflow answers to this point from C# programmers, which was that in practice this lack of explicitness doesn't really matter because in your IDE (presumably Visual Studio) you can just hover over a name and be told by the system where the name is coming from. E.g.: Now, in theory I realise this means when you're looking with a text editor, you can't tell where the types come from in C#... but in practice, I don't find that to be a problem. How often are you actually looking at code and can't use Visual Studio? This is revelatory to me. Many Python programmers prefer a text editor approach to coding, using something like Sublime Text 2 or vim, where it's all about the code, plus command line tools and direct access and manipulation of folders and files. The idea of being dependent on an IDE to understand code at such a basic level seems anathema. It seems C# culture is radically different on this point. And I wonder if I just need to accept and embrace that as part of my learning of C#. Which leads me to my question here: is C# development effectively inseparable from the IDE you use?

    Read the article

  • Djangobb problem

    - by Djero
    I've installed Djangobb app on my server (Debian, mod_python) by cloning original source. The only things I've changed is database options in settings.py. All needed components are installed - syncdb query was executed right. But, when I'm trying to enter on my forum, it returns me error: ImproperlyConfigured: Error importing middleware django_authopenid.middleware: "No module named djangobb_forum.subscription" I've checked - djangobb_forum/subscription.py exist, so I don't know what can be wrong. Maybe someone had problems like that and know how to fix it? Sorry for my english.

    Read the article

  • Order a sentence alphabetically and count the number of times each words appears and print in a table

    - by JaAnTr
    I am struggling with the print in a table part of the question. So far I have managed to order the user inputted sentence alphabetically and count the number of times each word occurs. Here is the code: thestring = (raw_input()) sentence = thestring.split(" ") sentence.sort() count = {} for word in thestring.split(): try: count[word] += 1 except KeyError: count[word] = 1 print sentence print count And when I run the code I get this: ['apple', 'apple', 'banana', 'mango', 'orange', 'pear', 'pear', 'strawberry'] {'apple': 2, 'pear': 2, 'strawberry': 1, 'mango': 1, 'orange': 1, 'banana': 1} However, ideally I want it printed in a table that looks something like: apple.....|.....2 banana....|.....1 mango.....|.....1 orange....|.....1 pear......|.....2 strawberry|.....1 Thanks for any help!

    Read the article

  • Have to put files in static_dir but need to read them afterwards

    - by SanjamX
    I just started using google app engine. In order to use templates, I'm using jinja2. I want to add images dynamically after I set the width and height of the img tag. I used PIL in order to read the image size and put the one I want. However when I open the image with PIL, I need it not to be in a static_dir and to put the image in the img tag, I need it to be in the static_dir. As a testing solution I've copied the folder to see if I get results and I did. But as you can see having each image saved twice is kind of bad.

    Read the article

  • easy, straightforward way to package a python program for debian?

    - by Jeremiah Rose
    i'm having trouble navigating the maze of distribution tools for python and debian; cdbs, debhelper, python-support, python-central, blah blah blah .. my application is a fairly straightforward one - a single python package (directory containing modules and a __init__.py), a script for running the program (script.py) and some icons and menu items (.desktop files). is there a simple straightforward way to make a .deb file out of these, or should i brave the nonsensical tools listed above?

    Read the article

  • What are the common techniques to handle user-generated HTML modified differently by different browsers?

    - by Jakie
    I am developing a website updater. The front end uses HTML, CSS and JavaScript, and the backend uses Python. The way it works is that <p/>, <b/> and some other HTML elements can be updated by the user. To enable this, I load the webpage and, with JQuery, convert all those elements to <textarea/> elements. Once they the content of the text area is changed, I apply the change to the original elements and send it to a Python script to store the new content. The problem is that I'm finding that different browsers change the original HTML. How do you get around this issue? What Python libraries do you use? What techniques or application designs do you use to avoid or overcome this issue? The problems I found are: IE removes the quotes around class and id attributes. For example, <img class='abc'/> becomes <img class=abc/>. Firefox removes the backslash from the line breaks: <br \> becomes <br>. Some websites have very specific display technicalities, so an insertion of a simple "\n"(which IE does) can affect the display of a website. Example: changing <img class='headingpic' /><div id="maincontent"> to <img class='headingpic'/>\n <div id="maincontent"> inserts a vertical gap in IE. The things I have unsuccessfully tried to overcome these issues: Using either JQuery or Python to remove all >\n< occurences, <br> etc. But this fails because I get different patterns in IE, sometimes a ·\n, sometimes a \n···. In a Python, parse the new HTML, extract the new text/content, insert it into the old HTML so the elements and format never change, just the content. This is very difficult and seems to be overkill.

    Read the article

  • how to interleaving lists

    - by user2829177
    I have two lists that could be not equal in lengths and I want to be able to interleave them. I want to be able to append the extra values in the longer list at the end of my interleaved list.I have this: a=xs b=ys minlength=[len(a),len(b)] extralist= list() interleave= list() for i in range((minval(minlength))): pair=a[i],b[i] interleave.append(pair) flat=flatten(interleave) c=a+b if len(b)>len(a): remainder=len(c)-len(a) for j in range(-remainder): extra=remainder[j] extralist.append(extra) if len(a)>len(b): remainder=len(c)-len(b) for j in range(-remainder): extra=remainder[j] final=flat+extralist return final but if I test it: >>> interleave([1,2,3], ["hi", "bye",True, False, 33]) [1, 'hi', 2, 'bye', 3, True] >>> The False and 33 don't appear. What is it that Im doing wrong?

    Read the article

  • In pdb how do you reset the list (l) command line count?

    - by Jorge Vargas
    From PDB (Pdb) help l l(ist) [first [,last]] List source code for the current file. Without arguments, list 11 lines around the current line or continue the previous listing. With one argument, list 11 lines starting at that line. With two arguments, list the given range; if the second argument is less than the first, it is a count. The "continue the previous listing" feature is really nice, but how do you turn it off?

    Read the article

  • javascript-aware html parser for Python ~

    - by znetor
    <html> <head> <script type="text/javascript"> document.write('<a href="http://www.google.com">f*** js</a>'); document.write("f*** js!"); </script> </head> <body> <script type="text/javascript"> document.write('<a href="http://www.google.com">f*** js</a>'); document.write("f*** js!"); </script> <div><a href="http://www.google.com">f*** js</a></div> </body> </html> I want use xpath to catch all lable object in the html page above... In [1]: import lxml.html as H In [2]: f = open("test.html","r") In [3]: c = f.read() In [4]: doc = H.document_fromstring(c) In [5]: doc.xpath('//a') Out[5]: [<Element a at a01d17c>] In [6]: a = doc.xpath('//a')[0] In [7]: a.getparent() Out[7]: <Element div at a01d41c> I only get one don't generate by js~ but firefox xpath checker can find all lable!? http://i.imgur.com/0hSug.png how to do that??? thx~! <html> <head> </head> <body> <script language="javascript"> function over(){ a.innerHTML="mouse me" } function out(){ a.innerHTML="<a href='http://www.google.com'>google</a>" } </script> <body><li id="a"onmouseover="over()" onmouseout="out()">mouse me</li> </body> </html>

    Read the article

  • Rollback doesn't work in MySQLdb

    - by Anton Barycheuski
    I have next code ... db = MySQLdb.connect(host=host, user=user, passwd=passwd, db=db, charset='utf8', use_unicode=True) db.autocommit(False) cursor = db.cursor() ... for col in ws.columns[1:]: data = (col[NUM_ROW_GENERATION].value, 1, type_topliv_dict[col[NUM_ROW_FUEL].value]) fullgeneration_id = data[0] type_topliv = data[2] if data in completions_set: compl_id = completions_dict[data] else: ... sql = u"INSERT INTO completions (type, mark, model, car_id, type_topliv, fullgeneration_id, mark_id, model_id, production_period, year_from, year_to, production_period_url) VALUES (1, '%s', '%s', 0, %s, %s, %s, %s, '%s', '%s', '%s', '%s')" % (marks_dict[mark_id], models_dict[model_id], type_topliv, fullgeneration_id, mark_id, model_id, production_period, year_from, year_to, production_period.replace(' ', '_').replace(u'?.?.', 'nv') ) inserted_completion += cursor.execute(sql) cursor.execute("SELECT fullgeneration_id, type, type_topliv, id FROM completions where fullgeneration_id = %s AND type_topliv = %s" % (fullgeneration_id, type_topliv)) row = cursor.fetchone() compl_id = row[3] if is_first_car: deleted_compl_rus = cursor.execute("delete from compl_rus where compl_id = %s" % compl_id) for param, row_id in params: sql = u"INSERT INTO compl_rus (compl_id, modification, groupparam, param, paramvalue) VALUES (%s, '%s', '%s', '%s', %s)" % (compl_id, col[NUM_ROW_MODIFICATION].value, param[0], param[1], col[row_id].value) inserted_compl_rus += cursor.execute(sql) is_first_car = False db.rollback() print '\nSTATISTICS:' print 'Inserted completion:', inserted_completion print 'Inserted compl_rus:', inserted_compl_rus print 'Deleted compl_rus:', deleted_compl_rus ans = raw_input('Commit changes? (y/n)') db.close() I has manually deleted records from table and than run script two times. See https://dpaste.de/MwMa . I think, that rollback in my code doesn't work. Why?

    Read the article

  • Extracting a number from a 1-word string

    - by Kyle
    In this program I am trying to make, I have an expression (such as "I=23mm", or "H=4V") and I am trying to extract the 23 (or the 4) out of it, so that I can turn it into an integer. The problem I keep running into is that since the expression I am trying to take the numbers out of is 1 word, I cannot use split() or anything. One example I saw but wouldnt work was - I="I=2.7A" [int(s) for s in I.split() if s.isdigit()] This wouldnt work because it only takes the numbers are are delimited by spaces. If there was a number in the word int078vert, it wouldnt extract it. Also, mine doesnt have spaces to delimit. I tried one that looked like this, re.findall("\d+.\d+", "Amps= 1.4 I") but it didnt work either, because the number that is being passed is not always 2 digits. It could be something like 5, or something like 13.6. What code do I need to write so that if I pass a string, such as I="I=2.4A" or I="A=3V" So that I can extract only the number out of this string? (and do operations on it)? There are no spaces or other constant chars that I can delimit by.

    Read the article

  • What are good uses for Python3's "Function Annotations"

    - by agscala
    Function Annotations: PEP-3107 I ran across a snippet of code demonstrating Python3's function annotations. The concept is simple but I can't think of why these were implemented in Python3 or any good uses for them. Perhaps SO can enlighten me? How it works: def foo(a: 'x', b: 5 + 6, c: list) -> max(2, 9): ... function body ... Everything following the colon after an argument is an 'annotation', and the information following the -> is an annotation for the function's return value. foo.func_annotations would return a dictionary: {'a': 'x', 'b': 11, 'c': list, 'return': 9} What's the significance of having this available?

    Read the article

  • Lighttpd + fastcgi + python (for django) slow on first request

    - by EagleOne
    I'm having a problem with a django website I host with lighttpd + fastcgi. It works great but it seems that the first request always takes up to 3seconds. Subsequent requests are much faster (<1s). I activated access logs in lighttpd in order to track the issue. But I'm kind of stuck. Here are logs where I 'lose' 4s (from 10:04:17 to 10:04:21): 2012-12-01 10:04:17: (mod_fastcgi.c.3636) handling it in mod_fastcgi 2012-12-01 10:04:17: (response.c.470) -- before doc_root 2012-12-01 10:04:17: (response.c.471) Doc-Root : /var/www 2012-12-01 10:04:17: (response.c.472) Rel-Path : /finderauto.fcgi 2012-12-01 10:04:17: (response.c.473) Path : 2012-12-01 10:04:17: (response.c.521) -- after doc_root 2012-12-01 10:04:17: (response.c.522) Doc-Root : /var/www 2012-12-01 10:04:17: (response.c.523) Rel-Path : /finderauto.fcgi 2012-12-01 10:04:17: (response.c.524) Path : /var/www/finderauto.fcgi 2012-12-01 10:04:17: (response.c.541) -- logical -> physical 2012-12-01 10:04:17: (response.c.542) Doc-Root : /var/www 2012-12-01 10:04:17: (response.c.543) Rel-Path : /finderauto.fcgi 2012-12-01 10:04:17: (response.c.544) Path : /var/www/finderauto.fcgi 2012-12-01 10:04:21: (response.c.128) Response-Header: HTTP/1.1 200 OK Last-Modified: Sat, 01 Dec 2012 09:04:21 GMT Expires: Sat, 01 Dec 2012 09:14:21 GMT Content-Type: text/html; charset=utf-8 Cache-Control: max-age=600 Transfer-Encoding: chunked Date: Sat, 01 Dec 2012 09:04:21 GMT Server: lighttpd/1.4.28 I guess that if there is a problem, it's whith my configuration. So here is the way I launch my django app: python manage.py runfcgi method=threaded host=127.0.0.1 port=3033 And here is my lighttpd conf: server.modules = ( "mod_access", "mod_alias", "mod_compress", "mod_redirect", "mod_rewrite", "mod_fastcgi", "mod_accesslog", ) server.document-root = "/var/www" server.upload-dirs = ( "/var/cache/lighttpd/uploads" ) server.errorlog = "/var/log/lighttpd/error.log" server.pid-file = "/var/run/lighttpd.pid" server.username = "www-data" server.groupname = "www-data" accesslog.filename = "/var/log/lighttpd/access.log" debug.log-request-header = "enable" debug.log-response-header = "enable" debug.log-file-not-found = "enable" debug.log-request-handling = "enable" debug.log-timeouts = "enable" debug.log-ssl-noise = "enable" debug.log-condition-cache-handling = "enable" debug.log-condition-handling = "enable" fastcgi.server = ( "/finderauto.fcgi" => ( "main" => ( # Use host / port instead of socket for TCP fastcgi "host" => "127.0.0.1", "port" => 3033, #"socket" => "/home/finderadmin/finderauto.sock", "check-local" => "disable", "fix-root-scriptname" => "enable", ) ), ) alias.url = ( "/media" => "/home/user/django/contrib/admin/media/", ) url.rewrite-once = ( "^(/media.*)$" => "$1", "^/favicon\.ico$" => "/media/favicon.ico", "^(/.*)$" => "/finderauto.fcgi$1", ) index-file.names = ( "index.php", "index.html", "index.htm", "default.htm", " index.lighttpd.html" ) url.access-deny = ( "~", ".inc" ) static-file.exclude-extensions = ( ".php", ".pl", ".fcgi" ) ## Use ipv6 if available #include_shell "/usr/share/lighttpd/use-ipv6.pl" dir-listing.encoding = "utf-8" server.dir-listing = "enable" compress.cache-dir = "/var/cache/lighttpd/compress/" compress.filetype = ( "application/x-javascript", "text/css", "text/html", "text/plain" ) include_shell "/usr/share/lighttpd/create-mime.assign.pl" include_shell "/usr/share/lighttpd/include-conf-enabled.pl" If any of you could help me finding out where I lose these 3 or 4 s. I would much appreciate. Thanks in advance!

    Read the article

  • Sharing base object with inheritance

    - by max
    I have class Base. I'd like to extend its functionality in a class Derived. I was planning to write: class Derived(Base): def __init__(self, base_arg1, base_arg2, derived_arg1, derived_arg2): super().__init__(base_arg1, base_arg2) # ... def derived_method1(self): # ... Sometimes I already have a Base instance, and I want to create a Derived instance based on it, i.e., a Derived instance that shares the Base object (doesn't re-create it from scratch). I thought I could write a static method to do that: b = Base(arg1, arg2) # very large object, expensive to create or copy d = Derived.from_base(b, derived_arg1, derived_arg2) # reuses existing b object but it seems impossible. Either I'm missing a way to make this work, or (more likely) I'm missing a very big reason why it can't be allowed to work. Can someone explain which one it is? [Of course, if I used composition rather than inheritance, this would all be easy to do. But I was hoping to avoid the delegation of all the Base methods to Derived through __getattr__.]

    Read the article

< Previous Page | 143 144 145 146 147 148 149 150 151 152 153 154  | Next Page >