Search Results

Search found 7586 results on 304 pages for 'header only'.

Page 152/304 | < Previous Page | 148 149 150 151 152 153 154 155 156 157 158 159  | Next Page >

  • CSS with PHP Extension ????

    - by raj
    hi everyone,,,plz helpl me out .. i want my css to recognise as mystyle.php but inside code would be of css , and i want to access it in my index.php page with header method ,i dont want to use Link method.

    Read the article

  • newbie problems with codeigniter

    - by Patrick
    hi, i'm trying to learn codeigniter (following a book) but don't understand why the web page comes out empty. my controller is class Welcome extends Controller { function Welcome() { parent::Controller(); } function index() { $data['title'] = "Welcome to Claudia's Kids"; $data['navlist'] = $this->MCats->getCategoriesNav(); $data['mainf'] = $this->MProducts->getMainFeature(); $skip = $data['mainf']['id']; $data['sidef'] = $this->MProducts->getRandomProducts(3, $skip); $data['main'] = "home"; $this->load->vars($data); $this->load->view('template'); } the view is: <--doctype declaration etc etc.. --> </head> <body> <div id="wrapper"> <div id="header"> <?php $this->load->view('header');?> </div> <div id='nav'> <?php $this->load->view('navigation');?> </div> <div id="main"> <?php $this->load->view($main);?> </div> <div id="footer"> <?php $this->load->view('footer');?> </div> </div> </body> </html> Now I know the model is passing back the right variables, but the page appears completely blank. I would expect at least to see an error, or the basic html structure, but the page is just empty. Moreover, the controller doesn't work even if I modify it as follows: function index() { echo "hello."; } What am I doing wrong? Everything was working until I made some changes to the model - but even if I delete all those new changes, the page is still blank.. i'm really confused! thanks, P.

    Read the article

  • Silverlight DataGrid Exception Reordering Column Headers

    - by Mike
    I'm trying to set the initial display order of the column headers in a silverlight datagrid by changing the column header DisplayIndex values. If I try to set the column order at page load time, I get an out of range exception. If I set the column order (same routine) at a later time like, in a button click handler, it works. Is this just a bug in the silverlight datagrid control? Suggestions for a possible work around?

    Read the article

  • Help With LINQ: Mixed Joins and Specifying Default Values

    - by Corey O.
    I am trying to figure out how to do a mixed-join in LINQ with specific access to 2 LINQ objects. Here is an example of how the actual TSQL query might look: SELECT * FROM [User] AS [a] INNER JOIN [GroupUser] AS [b] ON [a].[UserID] = [b].[UserID] INNER JOIN [Group] AS [c] ON [b].[GroupID] = [c].[GroupID] LEFT JOIN [GroupEntries] AS [d] ON [a].[GroupID] = [d].[GroupID] WHERE [a].[UserID] = @UserID At the end, basically what I would like is an enumerable object full of GroupEntry objects. What am interested is the last two tables/objects in this query. I will be displaying Groups as a group header, and all of the Entries underneath their group heading. If there are no entries for a group, I still want to see that group as a header without any entries. Here's what I have so far: So from that I'd like to make a function: public void DisplayEntriesByUser(int user_id) { MyDataContext db = new MyDataContext(); IEnumberable<GroupEntries> entries = ( from user in db.Users where user.UserID == user_id join group_user in db.GroupUsers on user.UserID = group_user.UserID into a from join1 in a join group in db.Groups on join1.GroupID equals group.GroupID into b from join2 in b join entry in db.Entries.DefaultIfEmpty() on join2.GroupID equals entry.GroupID select entry ); Group last_group_id = 0; foreach(GroupEntry entry in entries) { if (last_group_id == 0 || entry.GroupID != last_group_id) { last_group_id = entry.GroupID; System.Console.WriteLine("---{0}---", entry.Group.GroupName.ToString().ToUpper()); } if (entry.EntryID) { System.Console.WriteLine(" {0}: {1}", entry.Title, entry.Text); } } } The example above does not work quite as expected. There are 2 problems that I have not been able to solve: I still seem to be getting an INNER JOIN instead of a LEFT JOIN on the last join. I am not getting any empty results, so groups without entries do not appear. I need to figure out a way so that I can fill in the default values for blank sets of entries. That is, if there is a group without an entry, I would like to have a mostly blank entry returned, except that I'd want the EntryID to be null or 0, the GroupID to be that of of the empty group that it represents, and I'd need a handle on the entry.Group object (i.e. it's parent, empty Group object). Any help on this would be greatly appreciated. Note: Table names and real-world representation were derived purely for this example, but their relations simplify what I'm trying to do.

    Read the article

  • Why does firefox round-trip to the server to determine whether my files are modifed?

    - by erikkallen
    I have some static content on my web site that I have set up caching for (using Asp.NET MVC). According to Firebug, the first time I open the page, Firefox sends this request: GET /CoreContent/Core.css?asm=0.7.3614.34951 Host: 127.0.0.1:3916 User-Agent: Mozilla/5.0 (Windows; U; Windows NT 6.1; en-US; rv:1.9.1.5) Gecko/20091102 Firefox/3.5.5 (.NET CLR 3.5.30729) Accept: text/css,*/*;q=0.1 Accept-Language: en-us,en;q=0.5 Accept-Encoding: gzip,deflate Accept-Charset: ISO-8859-1,utf-8;q=0.7,*;q=0.7 Keep-Alive: 300 Connection: keep-alive Referer: http://127.0.0.1:3916/Edit/1/101 Cookie: .ASPXAUTH=52312E5A802C1A079E2BA29AA2BFBC5A38058977B84452D62ED52855D4164659B4307661EC73A307BFFB2ED3871C67CB3A9AAFDB3A75A99AC0A21C63A6AADE9A11A7138C672E75125D9FF3EFFBD9BF62 Pragma: no-cache Cache-Control: no-cache Which my server replies to with this: Server: ASP.NET Development Server/9.0.0.0 Date: Mon, 23 Nov 2009 18:44:41 GMT X-AspNet-Version: 2.0.50727 X-AspNetMvc-Version: 1.0 Cache-Control: public, max-age=31535671 Expires: Tue, 23 Nov 2010 18:39:12 GMT Last-Modified: Mon, 23 Nov 2009 18:39:12 GMT Vary: * Content-Type: text/css Content-Length: 15006 Connection: Close So far, so good. However, if I refresh Firefox (not a cache-clearing refresh, just a normal one), during that refresh cycle Firefox will once again go to the server with this request: GET /CoreContent/Core.css?asm=0.7.3614.34951 Host: 127.0.0.1:3916 User-Agent: Mozilla/5.0 (Windows; U; Windows NT 6.1; en-US; rv:1.9.1.5) Gecko/20091102 Firefox/3.5.5 (.NET CLR 3.5.30729) Accept: text/css,*/*;q=0.1 Accept-Language: en-us,en;q=0.5 Accept-Encoding: gzip,deflate Accept-Charset: ISO-8859-1,utf-8;q=0.7,*;q=0.7 Keep-Alive: 300 Connection: keep-alive Referer: http://127.0.0.1:3916/Edit/1/101 Cookie: .ASPXAUTH=52312E5A802C1A079E2BA29AA2BFBC5A38058977B84452D62ED52855D4164659B4307661EC73A307BFFB2ED3871C67CB3A9AAFDB3A75A99AC0A21C63A6AADE9A11A7138C672E75125D9FF3EFFBD9BF62 If-Modified-Since: Mon, 23 Nov 2009 18:39:20 GMT Cache-Control: max-age=0 to which my server responds 304 Not Modified. Why does Firefox issue this second request? In the first response, I said that the cache does not expire for a year (I intend to use query parameters whenever things change). Do I have to add another response header to prevent this extra roundtrip? Edit: It does not matter whether I press refresh, or whether I go to the page again (or a different URL, which references the same external files). Firefox does the same again. Also, I don't claim this to be a bug in FF, I just wonder if there is another header I can set which means "This document will never change, don't bother me again".

    Read the article

  • How can i bind parent's property to its child's property?

    - by walkor
    I have a GroupBox, which is defined like this <ResourceDictionary xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" xmlns:local="clr-namespace:Groupbox" > <Style TargetType="local:GroupBox"> <Setter Property="BorderBrush" Value="DarkGray"/> <Setter Property="BorderThickness" Value="1"/> <Setter Property="Padding" Value="6"/> <Setter Property="Template"> <Setter.Value> <ControlTemplate TargetType="local:GroupBox"> <Grid Background="{TemplateBinding Background}"> <Grid.RowDefinitions> <RowDefinition Height="Auto"/> <RowDefinition Height="Auto"/> <RowDefinition Height="*"/> </Grid.RowDefinitions> <Border BorderThickness="{TemplateBinding BorderThickness}" Grid.Row="1" Grid.RowSpan="2" BorderBrush="{TemplateBinding BorderBrush}" CornerRadius="3"> <Border.Clip> <GeometryGroup FillRule="EvenOdd"> <RectangleGeometry x:Name="FullRect" Rect="0,0,300,200"/> <RectangleGeometry x:Name="HeaderRect" Rect="6,0,100,100"/> </GeometryGroup> </Border.Clip> </Border> <ContentPresenter Grid.Row="2" ContentTemplate="{TemplateBinding ContentTemplate}" Content="{TemplateBinding Content}" Margin="{TemplateBinding Padding}"/> <ContentControl x:Name="HeaderContainer" Margin="6,0,0,0" Grid.Row="0" Grid.RowSpan="2" HorizontalAlignment="Left"> <ContentPresenter Margin="3,0,3,0" ContentTemplate="{TemplateBinding HeaderTemplate}" Content="{TemplateBinding Header}"/> </ContentControl> </Grid> </ControlTemplate> </Setter.Value> </Setter> </Style> </ResourceDictionary> And i'm using this control like this <Controls:GroupBox x:Name="GroupBox"> <Controls:GroupBox.HeaderTemplate> <DataTemplate> <CheckBox "Header" x:Name="cbHeader"/> </DataTemplate> </Controls:GroupBox.HeaderTemplate> <Controls:GroupBox> So, well, my questions - how can i bind property IsEnabled of GroupBox to the Checkbox property IsChecked? Thanks in advance.

    Read the article

  • how to display numbers without garbage numbers?

    - by Medeti Naveen Kumar
    Hi friends, whenever i press the numbers in text filed upto 9 numbers my textfield has taken right values but i press 10 th number.i have found duplicate number. in my header file i declare a pressnumber is "long long int" -(IBAction)press:(id)sender{ pressNumber = pressNumber*10 + (int)[sender tag]; phonenumber.text = [NSString stringWithFormat:@"%d",currentNumber]; } i want to enter a phone number in my textfiled but it is not taken 10 right numbers. Thanking you,

    Read the article

  • Checking type sizes in C with macros.

    - by Seisatsu
    I'm writing a program that needs to have unsigned types with definite sizes. I need a uint8, uint16, uint32, and uint64, and I need them defined in types.h, in a way that they will always be defined correctly regardless of platform. My question is, how can I check the sizes of different types on each platform using preprocessor macros, so that I can define my custom types correctly in the types.h header?

    Read the article

  • extra white line under li items that have no border

    - by isabel018
    I have a problem with extra white lines showing up under my list items. It's not a border as I haven't set any borders, except the one under My Account, it's just to show that the white line is not a border. The one under it is -- a 4px border the same color as the background. This problem occurred after I had resolved a conflict between my Nivo Slider and the Woocommerce plugin on my WP site. I got both of them to work together, but then this other issue with the list cropped up. Any ideas as to what caused this and how to fix it? Here's my CSS if that helps: #header #navigation ul.nav > li.current_page_item > a { color: #D4145A;} #header #navigation ul.nav > li:hover a { border-width: 0px 0px 4px; border-style: none none solid; border-color: -moz-use-text-color -moz-use-text-color rgb(212, 20, 90); -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; background: none repeat scroll 0% 0% rgb(212, 20, 90);} and the HTML for it too: <nav id="navigation" class="col-full parent" role="navigation"> <ul id="main-nav" class="nav fl parent"> <li class="page_item"></li> <li class="page_item page-item-11"></li> <li class="page_item page-item-12"></li> <li class="page_item page-item-13 parent"></li> <li class="page_item page-item-15 current_page_item parent"> <a href=""></a> <ul class="children"></ul></li> </ul> </nav> Help please! I'm at my wits' end! Thanks!

    Read the article

  • Exporting classes containing std:: objects (vector, map, etc) from a dll

    - by RnR
    I'm trying to export classes from a DLL that contain objects such as std::vectors and std::stings - the whole class is declared as dll export through: class DLL_EXPORT FontManager { The problem is that for members of the complex types I get this warning: warning C4251: 'FontManager::m__fonts' : class 'std::map<_Kty,_Ty' needs to have dll-interface to be used by clients of class 'FontManager' with [ _Kty=std::string, _Ty=tFontInfoRef ] I'm able to remove some of the warnings by putting the following forward class declaration before them even though I'm not changing the type of the member variables themselves: template class DLL_EXPORT std::allocator<tCharGlyphProviderRef>; template class DLL_EXPORT std::vector<tCharGlyphProviderRef,std::allocator<tCharGlyphProviderRef> >; std::vector<tCharGlyphProviderRef> m_glyphProviders; Looks like the forward declaration "injects" the DLL_EXPORT for when the member is compiled but is it safe? Does it realy change anything when the client compiles this header and uses the std container on his side? Will it make all future uses of such a container DLL_EXPORT (and possibly not inline?)? And does it really solve the problem that the warning tries to warn about? Is this warning anything I should be worried about or would it be best to disable it in the scope of these constructs? The clients and the dll will always be built using the same set of libraries and compilers and those are header only classes... I'm using Visual Studio 2003 with the standard STD library. ---- Update ---- I'd like to target you more though as I see the answers are general and here we're talking about std containers and types (such as std::string) - maybe the question really is: Can we disable the warning for standard containers and types available to both the client and the dll through the same library headers and treat them just as we'd treat an int or any other built-in type? (It does seem to work correctly on my side.) If so would should be the conditions under which we can do this? Or should maybe using such containers be prohibited or at least ultra care taken to make sure no assignment operators, copy constructors etc will get inlined into the dll client? In general I'd like to know if you feel designing a dll interface having such objects (and for example using them to return stuff to the client as return value types) is a good idea or not and why - I'd like to have a "high level" interface to this functionality... maybe the best solution is what Neil Butterworth suggested - creating a static library?

    Read the article

  • how to run vibrate continuously in iphone?

    - by aman-gupta
    Hi, In my application I m using following coding pattern to vibrate my iPhone device Header File:- AudioServices.h AudioServicesPlaySystemSound(kSystemSoundID_Vibrate); //////////////////////////////////////////////////////////////// My problem is that when I run my application it gets vibrate but only for second but I want that it will vibrate continuously until I will stop it. How it could be possible .Please help me out its urgent Thanks in Advance

    Read the article

  • Nginx: check content-length before file upload takes place

    - by robw
    I'm trying to prevent users from uploading (accidentally or maliciously) very large files to my website. I have nginx max_client_body_size set to 4M, but if a file larger than this is uploaded, then it uploads the entire file before returning 413 (entity too large). I want to make nginx check the Content-Length header, so that it rejects the request before it's uploaded. Alternatively, a Rails solution would also be acceptable. Any help appreciated.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Looping through array in PHP to post several multipart form-data

    - by Léon Pelletier
    I'm trying in an asp web application to code a function that would loop through a list of files in a multiple upload form and send them one by one. Is this something that can be done in ASP? Because I've read some posts about how to attach several files together, but saw nothing about looping through the files. I can easily imagine it in C# via HttpWebRequest or with socket, but in php, I guess there are already function designed to handle it? // This is false/pseudo-code :) for (int index = 0; index < number_of_files; index++) { postfile(file[index]); } And in each iteration, it should send a multipart form-data POST. postfile(TheFileInfos) should make a POST like it: POST /afs.aspx?fn=upload HTTP/1.1 [Header stuff] Content-Type: multipart/form-data; boundary=----------Ef1Ef1cH2Ij5GI3ae0gL6KM7GI3GI3 [Header stuff] ------------Ef1Ef1cH2Ij5GI3ae0gL6KM7GI3GI3 Content-Disposition: form-data; name="Filename" myimage1.png ------------Ef1Ef1cH2Ij5GI3ae0gL6KM7GI3GI3 Content-Disposition: form-data; name="fileid" 58e21ede4ead43a5201206101806420000007667212251 ------------Ef1Ef1cH2Ij5GI3ae0gL6KM7GI3GI3 Content-Disposition: form-data; name="Filedata"; filename="myimage1.png" Content-Type: application/octet-stream [Octet Stream] [Edit] I'll try it: <html> <head> <title>Untitled Document</title> <meta http-equiv="Content-Type" content="text/html; charset=iso-8859-1"> </head> <body> <form name="form1" enctype="multipart/form-data" method="post" action="processFiles.php"> <p> <? // start of dynamic form $uploadNeed = $_POST['uploadNeed']; for($x=0;$x<$uploadNeed;$x++){ ?> <input name="uploadFile<? echo $x;?>" type="file" id="uploadFile<? echo $x;?>"> </p> <? // end of for loop } ?> <p><input name="uploadNeed" type="hidden" value="<? echo $uploadNeed;?>"> <input type="submit" name="Submit" value="Submit"> </p> </form> </body> </html>

    Read the article

  • Export data to word from php with the headers on all the pages

    - by udaya
    Hi I am exporting data from php page to word document I received the result in word format but when the data's are in excess number then the header are not available for the consecutive page ex my first page has title Country Name Country uday India akila India my second page has no title such as name and title kiran pakisthan vikie america how to get the titles on the consecutive pagess

    Read the article

  • change password code error

    - by ejah85
    I've created a code to change a password. Now it seem contain an error. When I fill in the form to change password, and click save the error message: Warning: mysql_real_escape_string() expects parameter 2 to be resource, null given in C:\Program Files\xampp\htdocs\e-Complaint(FYP)\userChangePass.php on line 103 Warning: mysql_real_escape_string() expects parameter 2 to be resource, null given in C:\Program Files\xampp\htdocs\e-Complaint(FYP)\userChangePass.php on line 103 I really don’t know what the error message means. Please guys. Help me fix it. Here's is the code: <?php session_start(); ?> <?php # change password.php //set the page title and include the html header. $page_title = 'Change Your Password'; //include('templates/header.inc'); if(isset($_POST['submit'])){//handle the form require_once('connectioncomplaint.php');//connect to the db. //include "connectioncomplaint.php"; //create a function for escaping the data. function escape_data($data){ global $dbc;//need the connection. if(ini_get('magic_quotes_gpc')){ $data=stripslashes($data); } return mysql_real_escape_string($data, $dbc); }//end function $message=NULL;//create the empty new variable. //check for a username if(empty($_POST['userid'])){ $u=FALSE; $message .='<p> You forgot enter your userid!</p>'; }else{ $u=escape_data($_POST['userid']); } //check for existing password if(empty($_POST['password'])){ $p=FALSE; $message .='<p>You forgot to enter your existing password!</p>'; }else{ $p=escape_data($_POST['password']); } //check for a password and match againts the comfirmed password. if(empty($_POST['password1'])) { $np=FALSE; $message .='<p> you forgot to enter your new password!</p>'; }else{ if($_POST['password1'] == $_POST['password2']){ $np=escape_data($_POST['password1']); }else{ $np=FALSE; $message .='<p> your new password did not match the confirmed new password!</p>'; } } if($u && $p && $np){//if everything's ok. $query="SELECT userid FROM access WHERE (userid='$u' AND password=PASSWORD('$p'))"; $result=@mysql_query($query); $num=mysql_num_rows($result); if($num == 1){ $row=mysql_fetch_array($result, MYSQL_NUM); //make the query $query="UPDATE access SET password=PASSWORD('$np') WHERE userid=$row[0]"; $result=@mysql_query($query);//run the query. if(mysql_affected_rows() == 1) {//if it run ok. //send an email,if desired. echo '<p><b>your password has been changed.</b></p>'; include('templates/footer.inc');//include the HTML footer. exit();//quit the script. }else{//if it did not run OK. $message= '<p>Your password could not be change due to a system error.We apolpgize for any inconvenience.</p><p>' .mysql_error() .'</p>'; } }else{ $message= '<p> Your username and password do not match our records.</p>'; } mysql_close();//close the database connection. }else{ $message .='<p>Please try again.</p>'; } }//end oh=f the submit conditional. //print the error message if there is one. if(isset($message)){ echo'<font color="red">' , $message, '</font>'; } ?> <form action="<?php echo $_SERVER['PHP_SELF']; ?>" method="post"> <body> <script language="JavaScript1.2">mmLoadMenus();</script> <table width="604" height="599" border="0" align="center" cellpadding="0" cellspacing="0"> <tr> <td height="130" colspan="7"><img src="images/banner(E-Complaint)-.jpg" width="759" height="130" /></td> </tr> <tr> <td width="100" height="30" bgcolor="#ABD519"></td> <td width="100" bgcolor="#ABD519"></td> <td width="100" bgcolor="#ABD519"></td> <td width="100" bgcolor="#ABD519"></td> <td width="100" bgcolor="#ABD519"></td> <td width="160" bgcolor="#ABD519"> <?php include "header.php"; ?>&nbsp;</td> </tr> <tr> <td colspan="7" bgcolor="#FFFFFF"> <fieldset><legend> Enter your information in the form below:</legend> <p><b>User ID:</b> <input type="text" name="username" size="10" maxlength="20" value="<?php if(isset($_POST['userid'])) echo $_POST['userid']; ?>" /></p> <p><b>Current Password:</b> <input type="password" name="password" size="20" maxlength="20" /></p> <p><b>New Password:</b> <input type="password" name="password1" size="20" maxlength="20" /></p> <p><b>Confirm New Password:</b> <input type="password" name="password2" size="20" maxlength="20" /></p> </fieldset> <div align="center"> <input type="submit" name="submit" value="Change My Password" /></div> </form><!--End Form--> </td> </tr> </table> </body> </html>

    Read the article

  • C++ Class Access Specifier Verbosity

    - by PolyTex
    A "traditional" C++ class (just some random declarations) might resemble the following: class Foo { public: Foo(); explicit Foo(const std::string&); ~Foo(); enum FooState { Idle, Busy, Unknown }; FooState GetState() const; bool GetBar() const; void SetBaz(int); private: struct FooPartialImpl; void HelperFunction1(); void HelperFunction2(); void HelperFunction3(); FooPartialImpl* m_impl; // smart ptr FooState m_state; bool m_bar; int m_baz; }; I always found this type of access level specification ugly and difficult to follow if the original programmer didn't organize his "access regions" neatly. Taking a look at the same snippet in a Java/C# style, we get: class Foo { public: Foo(); public: explicit Foo(const std::string&); public: ~Foo(); public: enum FooState { Idle, Busy, Unknown }; public: FooState GetState() const; public: bool GetBar() const; public: void SetBaz(int); private: struct FooPartialImpl; private: void HelperFunction1(); private: void HelperFunction2(); private: void HelperFunction3(); private: FooPartialImpl* m_impl; // smart ptr private: FooState m_state; private: bool m_bar; private: int m_baz; }; In my opinion, this is much easier to read in a header because the access specifier is right next to the target, and not a bunch of lines away. I found this especially true when working with header-only template code that wasn't separated into the usual "*.hpp/*.inl" pair. In that scenario, the size of the function implementations overpowered this small but important information. My question is simple and stems from the fact that I've never seen anyone else actively do this in their C++ code. Assuming that I don't have a "Class View" capable IDE, are there any obvious drawbacks to using this level of verbosity? Any other style recommendations are welcome!

    Read the article

  • TCP sequence number question

    - by Meta
    This is more of a theoretical question than an actual problem I have. If I understand correctly, the sequence number in the TCP header of a packet is the index of the first byte in the packet in the whole stream, correct? If that is the case, since the sequence number is an unsigned 32-bit integer, then what happens after more than FFFFFFFF = 4294967295 bytes are transferred? Will the sequence number wrap around, or will the sender send a SYN packet to restart at 0?

    Read the article

  • How to enable MALLOC_PROTECT_BEFORE in Xcode?

    - by Daniel S.
    After switching on some debug options in Xcode, it now tells me the following in the output: GuardMalloc[Roadcast-4010]: free: magic is 0x0000090b, not 0xdeadbeef. GuardMalloc[Roadcast-4010]: free: header magic value at 0x43f49bf0, for block 0x43f49c00-0x43f50000, has been trashed by a buffer underrun. GuardMalloc[Roadcast-4010]: Try running with MALLOC_PROTECT_BEFORE to catch this error immediately as it happens. How do I switch on MALLOC_PROTECT_BEFORE?

    Read the article

< Previous Page | 148 149 150 151 152 153 154 155 156 157 158 159  | Next Page >