Search Results

Search found 7586 results on 304 pages for 'header'.

Page 153/304 | < Previous Page | 149 150 151 152 153 154 155 156 157 158 159 160  | Next Page >

  • How to generate real UTF-8 XML with grails without the escape characters?

    - by AngeDeLaMort
    I have been wondering why when I set the encoding to UTF-8 and rendering the XML it replace the extended characters by escape characters (or character reference) like &#x2019; instead of '? I'm using the Render method render(contentType:"text/xml", encoding:"UTF-8") {...} with a proper header render(contentType:"text/xml", encoding:"UTF-8", text:"<?xml version=\"1.0\" encoding=\"UTF-8\"?>\n") Any idea if there is a way to write it properly? Thanks.

    Read the article

  • TCP sequence number question

    - by Meta
    This is more of a theoretical question than an actual problem I have. If I understand correctly, the sequence number in the TCP header of a packet is the index of the first byte in the packet in the whole stream, correct? If that is the case, since the sequence number is an unsigned 32-bit integer, then what happens after more than FFFFFFFF = 4294967295 bytes are transferred? Will the sequence number wrap around, or will the sender send a SYN packet to restart at 0?

    Read the article

  • pandas read rotated csv files

    - by EricCoding
    Is there any function in pandas that can directly read a rotated csv file? To be specific, the header information in the first col instead of the first row. For example: A 1 2 B 3 5 C 6 7 and I would like the final DataFrame this way A B C 1 3 5 2 5 7 Of corse we can get around this problem using some data wangling techniques like transpose and slicing. I am wondering there should be a quick way in API but I could not find it.

    Read the article

  • Deleting Multiple rows from a TableView

    - by Sid
    hi Frnz, i want to delete multiple rows from a table view based on users selection.obviously i cant use didSelectRowAtIndexPath method coz it will be called for every row selected. i want to allow user to select multiple rows for deletion and then delete them in one go...Is it possible if yes then how to go about it.Also i am using a single view based project and i want the header of table view changed to "Delete" on the same view when the user want to delete the rows from the view. Thx

    Read the article

  • Detect if HTTP request is from browser / Flex asynchronous request?

    - by Andree
    Hi there! When Flex application make an asynchronus HTTP request, does it add a special header to the request, like some JavaScript framework does? Something that indicates whether this request is an AJAX call/not. I just want my server side code to return different response format, depending on whether the request is made from browser/flex. Regards, Andree.

    Read the article

  • extra white line under li items that have no border

    - by isabel018
    I have a problem with extra white lines showing up under my list items. It's not a border as I haven't set any borders, except the one under My Account, it's just to show that the white line is not a border. The one under it is -- a 4px border the same color as the background. This problem occurred after I had resolved a conflict between my Nivo Slider and the Woocommerce plugin on my WP site. I got both of them to work together, but then this other issue with the list cropped up. Any ideas as to what caused this and how to fix it? Here's my CSS if that helps: #header #navigation ul.nav > li.current_page_item > a { color: #D4145A;} #header #navigation ul.nav > li:hover a { border-width: 0px 0px 4px; border-style: none none solid; border-color: -moz-use-text-color -moz-use-text-color rgb(212, 20, 90); -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; background: none repeat scroll 0% 0% rgb(212, 20, 90);} and the HTML for it too: <nav id="navigation" class="col-full parent" role="navigation"> <ul id="main-nav" class="nav fl parent"> <li class="page_item"></li> <li class="page_item page-item-11"></li> <li class="page_item page-item-12"></li> <li class="page_item page-item-13 parent"></li> <li class="page_item page-item-15 current_page_item parent"> <a href=""></a> <ul class="children"></ul></li> </ul> </nav> Help please! I'm at my wits' end! Thanks!

    Read the article

  • Using libssl in xCode

    - by kanedo
    Hello, I have tried to include openssl (I try to implement a ssh client) and I've added libssl.dylib to my XCode Project. But I don't know which header I have to include to use it. Can anyone show me a tutorial how to use libssl in xcode? thanks

    Read the article

  • Apache serving wrong Content-Type for Rails files

    - by NudeCanalTroll
    Apache keeps serving up my Rails files with a Content-Type of 'text/plain' in the header. I have mod_mime installed, a mime.types files with all the correct MIME assignments, and the following code in my configuration. Any thoughts? DefaultType text/plain <IfModule mime_module> TypesConfig /etc/apache2/mime.types AddType application/x-compress .Z AddType application/x-gzip .gz .tgz </IfModule>

    Read the article

  • How to output image via php from another domain

    - by Beck
    Image tag inside email message: <img src="http://www.mydomain.com/image.php?lastest=1"> Part of image.php script: case 'image/gif': header('Content-type: image/gif');$img=@imagecreatefromgif($image['src']);if($img) {imagegif($img);imagedestroy($img);} break; But how i can do the same with this image? http://www.anotherdomain.com/image.gif Thanks.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Checking type sizes in C with macros.

    - by Seisatsu
    I'm writing a program that needs to have unsigned types with definite sizes. I need a uint8, uint16, uint32, and uint64, and I need them defined in types.h, in a way that they will always be defined correctly regardless of platform. My question is, how can I check the sizes of different types on each platform using preprocessor macros, so that I can define my custom types correctly in the types.h header?

    Read the article

  • Looping through array in PHP to post several multipart form-data

    - by Léon Pelletier
    I'm trying in an asp web application to code a function that would loop through a list of files in a multiple upload form and send them one by one. Is this something that can be done in ASP? Because I've read some posts about how to attach several files together, but saw nothing about looping through the files. I can easily imagine it in C# via HttpWebRequest or with socket, but in php, I guess there are already function designed to handle it? // This is false/pseudo-code :) for (int index = 0; index < number_of_files; index++) { postfile(file[index]); } And in each iteration, it should send a multipart form-data POST. postfile(TheFileInfos) should make a POST like it: POST /afs.aspx?fn=upload HTTP/1.1 [Header stuff] Content-Type: multipart/form-data; boundary=----------Ef1Ef1cH2Ij5GI3ae0gL6KM7GI3GI3 [Header stuff] ------------Ef1Ef1cH2Ij5GI3ae0gL6KM7GI3GI3 Content-Disposition: form-data; name="Filename" myimage1.png ------------Ef1Ef1cH2Ij5GI3ae0gL6KM7GI3GI3 Content-Disposition: form-data; name="fileid" 58e21ede4ead43a5201206101806420000007667212251 ------------Ef1Ef1cH2Ij5GI3ae0gL6KM7GI3GI3 Content-Disposition: form-data; name="Filedata"; filename="myimage1.png" Content-Type: application/octet-stream [Octet Stream] [Edit] I'll try it: <html> <head> <title>Untitled Document</title> <meta http-equiv="Content-Type" content="text/html; charset=iso-8859-1"> </head> <body> <form name="form1" enctype="multipart/form-data" method="post" action="processFiles.php"> <p> <? // start of dynamic form $uploadNeed = $_POST['uploadNeed']; for($x=0;$x<$uploadNeed;$x++){ ?> <input name="uploadFile<? echo $x;?>" type="file" id="uploadFile<? echo $x;?>"> </p> <? // end of for loop } ?> <p><input name="uploadNeed" type="hidden" value="<? echo $uploadNeed;?>"> <input type="submit" name="Submit" value="Submit"> </p> </form> </body> </html>

    Read the article

  • C++ DLL creation for C# project - No functions exported

    - by Yeti
    I am working on a project that requires some image processing. The front end of the program is C# (cause the guys thought it is a lot simpler to make the UI in it). However, as the image processing part needs a lot of CPU juice I am making this part in C++. The idea is to link it to the C# project and just call a function from a DLL to make the image processing part and allow to the C# environment to process the data afterwards. Now the only problem is that it seems I am not able to make the DLL. Simply put the compiler refuses to put any function into the DLL that I compile. Because the project requires some development time testing I have created two projects into a C++ solution. One is for the Dll and another console application. The console project holds all the files and I just include the corresponding header into my DLL project file. I thought the compiler should take out the functions that I marked as to be exported and make the DLL from them. Nevertheless this does not happens. Here it is how I defined the function in the header: extern "C" __declspec(dllexport) void _stdcall RobotData(BYTE* buf, int** pToNewBackgroundImage, int* pToBackgroundImage, bool InitFlag, ObjectInformation* robot1, ObjectInformation* robot2, ObjectInformation* robot3, ObjectInformation* robot4, ObjectInformation* puck); extern "C" __declspec(dllexport) CvPoint _stdcall RefPointFinder(IplImage* imgInput, CvRect &imgROI, CvScalar &refHSVColorLow, CvScalar &refHSVColorHi ); Followed by the implementation in the cpp file: extern "C" __declspec(dllexport) CvPoint _stdcall RefPointFinder(IplImage* imgInput, CvRect &imgROI,&refHSVColorLow, CvScalar &refHSVColorHi ) { \\... return cvPoint((int)( M10/M00) + imgROI.x, (int)( M01/M00 ) + imgROI.y) ;} extern "C" __declspec(dllexport) void _stdcall RobotData(BYTE* buf, int** pToNewBackgroundImage, int* pToBackgroundImage, bool InitFlag, ObjectInformation* robot1, ObjectInformation* robot2, ObjectInformation* robot3, ObjectInformation* robot4, ObjectInformation* puck) { \\ ...}; And my main file for the DLL project looks like: #ifdef _MANAGED #pragma managed(push, off) #endif /// <summary> Include files. </summary> #include "..\ImageProcessingDebug\ImageProcessingTest.h" #include "..\ImageProcessingDebug\ImageProcessing.h" BOOL APIENTRY DllMain( HMODULE hModule, DWORD ul_reason_for_call, LPVOID lpReserved) { return TRUE; } #ifdef _MANAGED #pragma managed(pop) #endif Needless to say it does not work. A quick look with DLL export viewer 1.36 reveals that no function is inside the library. I don't get it. What I am doing wrong ? As side not I am using the C++ objects (and here it is the C++ DLL part) such as the vector. However, only for internal usage. These will not appear in the headers of either function as you can observe from the previous code snippets. Any ideas? Thx, Bernat

    Read the article

  • JAVA SDK Modifying Table Column

    - by tathamr
    I have the ReportBlock from the type VTable that I am modifying. I am able to get the horizonatal block axis to modify the cells but, I cannot seem to modify the column header (different object). I started to look into trying to get back a smalltable but, I am not confident in this approach. Any idea?

    Read the article

  • How to enable MALLOC_PROTECT_BEFORE in Xcode?

    - by Daniel S.
    After switching on some debug options in Xcode, it now tells me the following in the output: GuardMalloc[Roadcast-4010]: free: magic is 0x0000090b, not 0xdeadbeef. GuardMalloc[Roadcast-4010]: free: header magic value at 0x43f49bf0, for block 0x43f49c00-0x43f50000, has been trashed by a buffer underrun. GuardMalloc[Roadcast-4010]: Try running with MALLOC_PROTECT_BEFORE to catch this error immediately as it happens. How do I switch on MALLOC_PROTECT_BEFORE?

    Read the article

  • Gridview tooltip

    - by Geetha
    Hi All, if (e.Row.RowType == DataControlRowType.Header) { int i = 0; foreach (TableCell cell in e.Row.Cells) { cell.Attributes.Add("title", reason[i]); i++; } } i am using this code to show tool tip in grid view.Tool tip is getting displayed when the page loads but after a click event the tool tip is not working.

    Read the article

  • change password code error

    - by ejah85
    I've created a code to change a password. Now it seem contain an error. When I fill in the form to change password, and click save the error message: Warning: mysql_real_escape_string() expects parameter 2 to be resource, null given in C:\Program Files\xampp\htdocs\e-Complaint(FYP)\userChangePass.php on line 103 Warning: mysql_real_escape_string() expects parameter 2 to be resource, null given in C:\Program Files\xampp\htdocs\e-Complaint(FYP)\userChangePass.php on line 103 I really don’t know what the error message means. Please guys. Help me fix it. Here's is the code: <?php session_start(); ?> <?php # change password.php //set the page title and include the html header. $page_title = 'Change Your Password'; //include('templates/header.inc'); if(isset($_POST['submit'])){//handle the form require_once('connectioncomplaint.php');//connect to the db. //include "connectioncomplaint.php"; //create a function for escaping the data. function escape_data($data){ global $dbc;//need the connection. if(ini_get('magic_quotes_gpc')){ $data=stripslashes($data); } return mysql_real_escape_string($data, $dbc); }//end function $message=NULL;//create the empty new variable. //check for a username if(empty($_POST['userid'])){ $u=FALSE; $message .='<p> You forgot enter your userid!</p>'; }else{ $u=escape_data($_POST['userid']); } //check for existing password if(empty($_POST['password'])){ $p=FALSE; $message .='<p>You forgot to enter your existing password!</p>'; }else{ $p=escape_data($_POST['password']); } //check for a password and match againts the comfirmed password. if(empty($_POST['password1'])) { $np=FALSE; $message .='<p> you forgot to enter your new password!</p>'; }else{ if($_POST['password1'] == $_POST['password2']){ $np=escape_data($_POST['password1']); }else{ $np=FALSE; $message .='<p> your new password did not match the confirmed new password!</p>'; } } if($u && $p && $np){//if everything's ok. $query="SELECT userid FROM access WHERE (userid='$u' AND password=PASSWORD('$p'))"; $result=@mysql_query($query); $num=mysql_num_rows($result); if($num == 1){ $row=mysql_fetch_array($result, MYSQL_NUM); //make the query $query="UPDATE access SET password=PASSWORD('$np') WHERE userid=$row[0]"; $result=@mysql_query($query);//run the query. if(mysql_affected_rows() == 1) {//if it run ok. //send an email,if desired. echo '<p><b>your password has been changed.</b></p>'; include('templates/footer.inc');//include the HTML footer. exit();//quit the script. }else{//if it did not run OK. $message= '<p>Your password could not be change due to a system error.We apolpgize for any inconvenience.</p><p>' .mysql_error() .'</p>'; } }else{ $message= '<p> Your username and password do not match our records.</p>'; } mysql_close();//close the database connection. }else{ $message .='<p>Please try again.</p>'; } }//end oh=f the submit conditional. //print the error message if there is one. if(isset($message)){ echo'<font color="red">' , $message, '</font>'; } ?> <form action="<?php echo $_SERVER['PHP_SELF']; ?>" method="post"> <body> <script language="JavaScript1.2">mmLoadMenus();</script> <table width="604" height="599" border="0" align="center" cellpadding="0" cellspacing="0"> <tr> <td height="130" colspan="7"><img src="images/banner(E-Complaint)-.jpg" width="759" height="130" /></td> </tr> <tr> <td width="100" height="30" bgcolor="#ABD519"></td> <td width="100" bgcolor="#ABD519"></td> <td width="100" bgcolor="#ABD519"></td> <td width="100" bgcolor="#ABD519"></td> <td width="100" bgcolor="#ABD519"></td> <td width="160" bgcolor="#ABD519"> <?php include "header.php"; ?>&nbsp;</td> </tr> <tr> <td colspan="7" bgcolor="#FFFFFF"> <fieldset><legend> Enter your information in the form below:</legend> <p><b>User ID:</b> <input type="text" name="username" size="10" maxlength="20" value="<?php if(isset($_POST['userid'])) echo $_POST['userid']; ?>" /></p> <p><b>Current Password:</b> <input type="password" name="password" size="20" maxlength="20" /></p> <p><b>New Password:</b> <input type="password" name="password1" size="20" maxlength="20" /></p> <p><b>Confirm New Password:</b> <input type="password" name="password2" size="20" maxlength="20" /></p> </fieldset> <div align="center"> <input type="submit" name="submit" value="Change My Password" /></div> </form><!--End Form--> </td> </tr> </table> </body> </html>

    Read the article

< Previous Page | 149 150 151 152 153 154 155 156 157 158 159 160  | Next Page >