Search Results

Search found 17845 results on 714 pages for 'python social auth'.

Page 153/714 | < Previous Page | 149 150 151 152 153 154 155 156 157 158 159 160  | Next Page >

  • Documenting module/class/function bodies in python sphinx docs

    - by perrierism
    Is there a way with Sphinx documentation to output a function or class body (the code itself) with the autodoc feature? I'm using autodoc to much success. In addition to the docstrings getting pulled in to the documentation I want like a link to click for each function where it will show you the source... is that possible? This is about what most of my documentation looks like now: .. module:`foo.mymodule` Title =================== .. automodule:: foo.mymodule .. autoclass:: MyModulesClass :members: :undoc-members:

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Listing all possible values for SOAP enumeration with Python SUDS

    - by bdk
    I'm connecting with a SUDS client to a SOAP Server whose wsdl contains manu enumerations like the following: </simpleType> <simpleType name="FOOENUMERATION"> <restriction base="xsd:string"> <enumeration value="ALPHA"><!-- enum const = 0 --> <enumeration value="BETA"/><!-- enum const = 1 --> <enumeration value="GAMMA"/><!-- enum const = 2 --> <enumeration value="DELTA"/><!-- enum const = 3 --> </restriction> </simpleType> In my client I am receiving sequences which contain elements of these various enumeration types. My need is that given a member variable, I need to know all possible enumeration values. Basically I need a function which takes an instance of one of these enums and returns a list of strings which are all the possible values. When I have an instance, running: print type(foo.enumInstance) I get: <class 'suds.sax.text.Text'> I'm not sure how to get the actual simpleType name from this, and then get the possible values from that short of parsing the WSDL myself.

    Read the article

  • Opening SSL URLs with Python

    - by RadiantHex
    Hi folks, I'm using mechanize to navigate pages, it works pretty well. Unfortunately I have a random error come up, by random I mean it occasionally appears. URLError at /test/ urlopen error [Errno 1] _ssl.c:1325: error:140943FC:SSL routines:SSL3_READ_BYTES:sslv3 alert bad record mac I really need help on this one :) any ideas?

    Read the article

  • Python - urllib2 & cookielib

    - by Adrian
    I am trying to open the following website and retrieve the initial cookie and use it for the second url-open BUT if you run the following code it outputs 2 different cookies. How do I use the initial cookie for the second url-open? import cookielib, urllib2 cj = cookielib.CookieJar() opener = urllib2.build_opener(urllib2.HTTPCookieProcessor(cj)) home = opener.open('https://www.idcourts.us/repository/start.do') print cj search = opener.open('https://www.idcourts.us/repository/partySearch.do') print cj Output shows 2 different cookies every time as you can see: <cookielib.CookieJar[<Cookie JSESSIONID=0DEEE8331DE7D0DFDC22E860E065085F for www.idcourts.us/repository>]> <cookielib.CookieJar[<Cookie JSESSIONID=E01C2BE8323632A32DA467F8A9B22A51 for www.idcourts.us/repository>]>

    Read the article

  • Python TKinter connect variable to entry widget

    - by Sano98
    Hi everyone, I'm trying to associate a variable with a Tkinter entry widget, in a way that: Whenever I change the value (the "content") of the entry, mainly by typing something into it, the variable automatically gets assigned the value of what I've typed. Without me having to push a button "Update value " or something like that first. Whenever the variable gets changed (by some other part of the programm), I want the entry value displayed to be adjusted automatically. I believe that this could work via the textvariable. I read the example on http://effbot.org/tkinterbook/entry.htm, but it is not exactly helping me for what I have in mind. I have a feeling that there is a way of ensuring the first condition with using entry's "validate". Any ideas? Thank you for your input! Sano

    Read the article

  • Python, a smarter way of string to integer conversion

    - by Hellnar
    Hello I have written this code to convert string in such format "0(532) 222 22 22" to integer such as 05322222222 . class Phone(): def __init__(self,input): self.phone = input def __str__(self): return self.phone #convert to integer. def to_int(self): return int((self.phone).replace(" ","").replace("(","").replace(")","")) test = Phone("0(532) 222 22 22") print test.to_int() It feels very clumsy to use 3 replace methods to solve this. I am curious if there is a better solution?

    Read the article

  • Python learner needs help spotting an error

    - by Protean
    This piece of code gives a syntax error at the colon of "elif process.loop(i, len(list_i) != 'repeat':" and I can't seem to figure out why. class process: def loop(v1, v2): if v1 < v2 - 1: return 'repeat' def isel(chr_i, list_i): for i in range(len(list_i)): if chr_i == list_i[i]: return list_i[i] elif process.loop(i, len(list_i) != 'repeat': return 'error'()

    Read the article

  • Converting string to datetime object in python

    - by Gussi
    Given this string: "Fri, 09 Apr 2010 14:10:50 +0000" how does one convert it to a datetime object? After doing some reading I feel like this should work, but it doesn't... >>> from datetime import datetime >>> >>> str = 'Fri, 09 Apr 2010 14:10:50 +0000' >>> fmt = '%a, %d %b %Y %H:%M:%S %z' >>> datetime.strptime(str, fmt) Traceback (most recent call last): File "<stdin>", line 1, in <module> File "/usr/lib64/python2.6/_strptime.py", line 317, in _strptime (bad_directive, format)) ValueError: 'z' is a bad directive in format '%a, %d %b %Y %H:%M:%S %z' It should be noted that this works without a problem >>> from datetime import datetime >>> >>> str = 'Fri, 09 Apr 2010 14:10:50' >>> fmt = '%a, %d %b %Y %H:%M:%S' >>> datetime.strptime(str, fmt) datetime.datetime(2010, 4, 9, 14, 10, 50) But I'm stuck with "Fri, 09 Apr 2010 14:10:50 +0000", I would prefer to convert exactly that without changing (or slicing) that string in any way.

    Read the article

  • Python: how to enclose strings in a list with < and >

    - by Michael Konietzny
    Hello, i would like to enclose strings inside of list into < (formatted like <%s). The current code does the following: def create_worker (general_logger, general_config): arguments = ["worker_name", "worker_module", "worker_class"] __check_arguments(arguments) def __check_arguments(arguments): if len(sys.argv) < 2 + len(arguments): print "Usage: %s delete-project %s" % (__file__," ".join(arguments)) sys.exit(10) The current output looks like this: Usage: ...\handler_scripts.py delete-project worker_name worker_module worker_class and should look like this: Usage: ...\handler_scripts.py delete-project <worker_name> <worker_module> <worker_class> Is there any short way to do this ? Greetings, Michael

    Read the article

  • python search replace using wildcards

    - by tom smith
    hi somewhat confused.. but trying to do a search/repace using wildcards if i have something like: <blah.... ssf ff> <bl.... ssf dfggg ff> <b.... ssf ghhjj fhf> and i want to replace all of the above strings with say, <hh >t any thoughts/comments on how this can be accomplished? thanks update (thanks for the comments!) i'm missing something... my initial sample text are: Soo Choi</span>LONGEDITBOX">Apryl Berney Soo Choi</span>LONGEDITBOX">Joel Franks Joel Franks</span>GEDITBOX">Alexander Yamato and i'm trying to get Soo Choi foo Apryl Berney Soo Choi foo Joel Franks Joel Franks foo Alexander Yamato i've tried derivations of name=re.sub("</s[^>]*\">"," foo ",name) but i'm missing something... thoughts... thanks

    Read the article

  • Python web scraping involving HTML tags with attributes

    - by rohanbk
    I'm trying to make a web scraper that will parse a web-page of publications and extract the authors. The skeletal structure of the web-page is the following: <html> <body> <div id="container"> <div id="contents"> <table> <tbody> <tr> <td class="author">####I want whatever is located here ###</td> </tr> </tbody> </table> </div> </div> </body> </html> I've been trying to use BeautifulSoup and lxml thus far to accomplish this task, but I'm not sure how to handle the two div tags and td tag because they have attributes. In addition to this, I'm not sure whether I should rely more on BeautifulSoup or lxml or a combination of both. What should I do? At the moment, my code looks like what is below: import re import urllib2,sys import lxml from lxml import etree from lxml.html.soupparser import fromstring from lxml.etree import tostring from lxml.cssselect import CSSSelector from BeautifulSoup import BeautifulSoup, NavigableString address='http://www.example.com/' html = urllib2.urlopen(address).read() soup = BeautifulSoup(html) html=soup.prettify() html=html.replace('&nbsp', '&#160') html=html.replace('&iacute','&#237') root=fromstring(html) I realize that a lot of the import statements may be redundant, but I just copied whatever I currently had in more source file. EDIT: I suppose that I didn't make this quite clear, but I have multiple tags in page that I want to scrape.

    Read the article

  • python: using __import__ to import a module which in turn generates an ImportError

    - by bbb
    Hi there, I have a funny problem I'd like to ask you guys ('n gals) about. I'm importing some module A that is importing some non-existent module B. Of course this will result in an ImportError. This is what A.py looks like import B Now let's import A >>> import A Traceback (most recent call last): File "<stdin>", line 1, in <module> File "/tmp/importtest/A.py", line 1, in <module> import B ImportError: No module named B Alright, on to the problem. How can I know if this ImportError results from importing A or from some corrupt import inside A without looking at the error's string representation. The difference is that either A is not there or does have incorrect import statements. Hope you can help me out... Cheers bb

    Read the article

  • Using Python and Mechanize with ASP Forms

    - by tchaymore
    I'm trying to submit a form on an .asp page but Mechanize does not recognize the name of the control. The form code is: <form id="form1" name="frmSearchQuick" method="post"> .... <input type="button" name="btSearchTop" value="SEARCH" class="buttonctl" onClick="uf_Browse('dledir_search_quick.asp');" > My code is as follows: br = mechanize.Browser() br.open(BASE_URL) br.select_form(name='frmSearchQuick') resp = br.click(name='btSearchTop') I've also tried the last line as: resp = br.submit(name='btSearchTop') The error I get is: raise ControlNotFoundError("no control matching "+description) ControlNotFoundError: no control matching name 'btSearchTop', kind 'clickable' If I print br I get this: IgnoreControl(btSearchTop=) But I don't see that anywhere in the HTML. Any advice on how to submit this form?

    Read the article

  • recursively implementing 'minimum number of coins' in python

    - by user5198
    This problem is same as asked in here. Given a list of coins, their values (c1, c2, c3, ... cj, ...), and the total sum i. Find the minimum number of coins the sum of which is i (we can use as many coins of one type as we want), or report that it's not possible to select coins in such a way that they sum up to S. I"m just introduced to dynamic programming yesterday and I tried to make a code for it. # Optimal substructure: C[i] = 1 + min_j(C[i-cj]) cdict = {} def C(i, coins): if i <= 0: return 0 if i in cdict: return cdict[i] else: answer = 1 + min([C(i - cj, coins) for cj in coins]) cdict[i] = answer return answer Here, C[i] is the optimal solution for amount of money 'i'. And available coins are {c1, c2, ... , cj, ...} for the program, I've increased the recursion limit to avoid maximum recursion depth exceeded error. But, this program gives the right answer only someones and when a solution is not possible, it doesn't indicate that. What is wrong with my code and how to correct it?

    Read the article

  • Python: unable to inherit from a C extension.

    - by celil
    I am trying to add a few extra methods to a matrix type from the pysparse library. Apart from that I want the new class to behave exactly like the original, so I chose to implement the changes using inheritance. However, when I try from pysparse import spmatrix class ll_mat(spmatrix.ll_mat): pass this results in the following error TypeError: Error when calling the metaclass bases cannot create 'builtin_function_or_method' instances What is this causing this error? Is there a way to use delegation so that my new class behaves exactly the same way as the original?

    Read the article

  • Using Tkinter in python to edit the title bar

    - by Dan
    I am trying to add a custom title to a window but I am having troubles with it. I know my code isn't right but when I run it, it creates 2 windows instead, one with just the title tk and another bigger window with "Simple Prog". How do I make it so that the tk window has the title "Simple Prog" instead of having a new additional window. I dont think I'm suppose to have the Tk() part because when i have that in my complete code, there's an error from tkinter import Tk, Button, Frame, Entry, END class ABC(Frame): def __init__(self,parent=None): Frame.__init__(self,parent) self.parent = parent self.pack() ABC.make_widgets(self) def make_widgets(self): self.root = Tk() self.root.title("Simple Prog")

    Read the article

  • how to send file via http with python

    - by ep45
    Hello, I have a problem. I use Apache with mod_wsgi and webpy, and when i send a file on http, a lot packets are lost. This is my code : web.header('Content-Type','video/x-flv') web.header('Content-length',sizeFile) f = file(FILE_PATH, 'rb') while True: buffer = f.read(4*1024) if buffer : yield buffer else : break f.close() What in my code is wrong ? thanks.

    Read the article

  • Python turtle module confusion

    - by John
    Hi, I'm trying to to add more lines to the triangle, so instead of 3 leading off there will be 5 depending on the parameter given but I really have no idea what to do at this stage and any help would be very welcome. Thanks in advance!:) def draw_sierpinski_triangle(tracer_on, colour, initial_modulus, line_width, initial_heading,initial_x, initial_y, steps): turtle=Turtle() turtle.name = 'Mother of all turtles' turtle.reset () turtle.tracer (tracer_on) turtle.speed ('fastest') turtle.color (colour) turtle.width (line_width) turtle.up() turtle.goto (initial_x, initial_y) turtle.down() turtle.set_heading (initial_heading) draw_sub_pattern (tracer_on, turtle, initial_modulus, 0, steps) def draw_sub_pattern (tracer_on, turtle, modulus, depth, steps): if (depth >= steps): return; x, y = turtle.position () heading = turtle.heading () # draw the pattern turtle.up() turtle.down() turtle.forward (modulus) draw_sub_pattern(tracer_on, turtle, modulus * 0.5, depth + 1, steps) turtle.up() turtle.goto(x, y) turtle.down() turtle.set_heading (heading + 120) turtle.forward (modulus) draw_sub_pattern(tracer_on, turtle, modulus * 0.5, depth + 1, steps) turtle.up() turtle.goto(x, y) turtle.down() turtle.set_heading (heading + 240) turtle.forward (modulus) draw_sub_pattern(tracer_on, turtle, modulus * 0.5, depth + 1, steps)

    Read the article

< Previous Page | 149 150 151 152 153 154 155 156 157 158 159 160  | Next Page >