Search Results

Search found 6020 results on 241 pages for 'valid'.

Page 153/241 | < Previous Page | 149 150 151 152 153 154 155 156 157 158 159 160  | Next Page >

  • Create set of random JPGs

    - by Kylar
    Here's the scenario, I want to create a set of random, small jpg's - anywhere between 50 bytes and 8k in size - the actual visual content of the jpeg is irrelevant as long as they're valid. I need to generate a thousand or so, and they all have to be unique - even if they're only different by a single pixel. Can I just write a jpeg header/footer and some random bytes in there? I'm not able to use existing photos or sets of photos from the web. The second issue is that the set of images has to be different for each run of the program. I'd prefer to do this in python, as the wrapping scripts are in Python. I've looked for python code to generate jpg's from scratch, and didn't find anything, so pointers to libraries are just as good.

    Read the article

  • How can I filter out the "My Computer"-option in a SWT DirectoryDialog?

    - by Superfisi
    Hello *, in our Eclipse RCP application running on Windows XP we use a DirectoryDialog, in which the user should... ahmm... choose a directory! :D The problem is: If the user selects the "My Computer"-option (in German Windows "Arbeitsplatz") the Dialog returns null. The DirectoryDialog provides a method setFilterPath(String path) in which I put the File.pathSeparatorChar (to remain OS-independant). My suggestion was that if there has to be a file separator in the directory the "My Computer"-option would be ignored cause it is null - for example the "OK"-button would be greyed out or sth. like that... but it is also valid to klick "OK". Any suggestions from your side? :D Thanks in advance! Alex

    Read the article

  • Enableeventvalidation in web user control

    - by Khushi
    Hi, i have a web user control containing a repeater. The repeater contains three buttons. On button click it gives the following error : Invalid postback or callback argument. Event validation is enabled using in configuration or <%@ Page EnableEventValidation="true" % in a page. For security purposes, this feature verifies that arguments to postback or callback events originate from the server control that originally rendered them. If the data is valid and expected, use the ClientScriptManager.RegisterForEventValidation method in order to register the postback or callback data for validation. Since user control does not have page directive, so i changed the enableEventValidation to false, but it restricted the itemcommand event of the repeater. Can someone guide me, how to solve this problem?

    Read the article

  • AJAX Panel not throwing exceptions

    - by Grant
    Hi, i have just noticed something strange in some asp.net markup. I have a standard form with a couple of textboxes and a submit button. When clicked the code behind will attempt to perform some logic and then return. If the input values are not valid it used to throw an exception. The moment i wrapped the controls in an AJAX update panel and try to submit bad data, no exception is thrown and the panel returns like nothing was wrong. Does anyone know how to return this to the previous behavior whilst keeping the update panel?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Do not want Form to display over other application windows

    - by Cat
    I am displaying a Form from one process by passing the Show method a window handle from another process. I only want this new Form to display above the passed Form, like a MessageBox. However, this newly launched Form appears above other application windows, despite: Setting Process.WindowStyle.Hidden to the Form-displaying process Overriding the ShowWithoutActivation and CreateParams properties of the Form. Making sure Form.TopMost is not true I have checked that the window handle is valid from the second process. Focus is not stolen, however. Process A: Pass (Form) window handle to a new Process B via the command line Process B: Display a new Form using Form.Show(anotherProcessWindowHandle)

    Read the article

  • Entity Framework: Attached Entities not Saving

    - by blog
    Hello: I can't figure out why calling SaveChanges() on the following code results in no changes to the objects I attached: // delete existing user roles before re-attaching if (accountUser.AccountRoles.Count > 0) { foreach (AccountRole role in accountUser.AccountRoles.ToList()) { accountUser.AccountRoles.Remove(role); } } // get roles to add List<int> roleIDs = new List<int>(); foreach (UserRole r in this.AccountRoles) { roleIDs.Add(r.RoleID); } var roleEntities = from roles in db.AccountRoles where roleIDs.Contains(roles.id) select roles; accountUser.AccountRoles.Attach(roleEntities); db.SaveChanges(); In the debugger, I see that the correct roleEntities are being loaded, and that they are valid objects. However, if I use SQL Profiler I see no UPDATE or INSERT queries coming in, and as a result none of my attached objects are being saved.

    Read the article

  • Weird "?>" being displayed

    - by Jaxkr
    I have the following navigation bar script: <?php session_start(); require('includepath.inc.php'); require($include_path.'loginsysfunc.inc.php'); $current_page = $_SERVER['REQUEST_URI']; ?> <div class="navbar"> <img class="navlogo" src="logo.png"> <div class="navbutton"><a href="index.php">Home</a></div> <div class="navbutton"><a href="about.php">About</a></div> <div class="navbutton"><a href="donate.php">Donate</a></div> <?php if (loggedIn()){ ?> <div class="navusername"><a href="profile.php?user=<?php echo $_SESSION['username'];?>"><?php echo $_SESSION['username']; ?></a></div> <div class="navtoolsettings"><a href="settings.php">Settings</a></div> <div class="navtoollogout"><a href="logout.php">Log out</a> <?php } elseif ($current_page == '/login.php') { ?> <div class="navregister"><a href="register.php">Register</a></div> <?php } else { ?> <div class="navusername"><a href="login.php">Log in</a></div> <?php } ?> </div> For some reason, a strange "?" is being displayed. I am super confused, so please help. Here is includepath.inc.php (the only I reason it's there is because I am on a shared host, and I don't want to type '/home/bigdumbhash/public_html/include' everytime. But, here it is: <?php $include_path = '/home/a6595899/public_html/include/'; ?> Here is loginsysfunc.inc.php. These are functions that go with my login system to save time: <?php function valUser() { session_regenerate_id(); $_SESSION['valid'] = true; $_SESSION['username'] = $userid; echo '<meta http-equiv="refresh" content="0;URL=\'index.php\'">'; } function loggedIn() { if($_SESSION['valid'] == true) { return true; } else { return false; } } function createSalt() { $string = $string = md5(uniqid(rand(), true)); return substr($string, 0, 3); } function logout() { $_SESSION = array(); session_destroy(); echo '<meta http-equiv="refresh" content="0;URL=\'index.php\'">'; } ?> Here is the actual HTML of the page: <!DOCTYPE html> <html> <head> <link href="style.css" rel="stylesheet" type="text/css"> <title> Log in </title> </head> <body> <div class="navbar"> <img class="navlogo" src="logo.png"> <div class="navbutton"><a href="index.php">Home</a></div> <div class="navbutton"><a href="about.php">About</a></div> <div class="navbutton"><a href="donate.php">Donate</a></div> <div class="navregister"><a href="register.php">Register</a></div> </div> ?> <div class="loginbox"> <h1>Log in</h1> <form action="logingo.php" method="POST"> <input class="userpass" type="text" name="username" value="Username" onFocus="this.value='';"> <br> <input class="userpass" type="password" name="password" value="Password" onFocus="this.value='';"> <br> <input class="loginbutton" type="submit" value="Log in!"> </form> </div> </body> </html>

    Read the article

  • Problems when trying to submit iphone app

    - by ryug
    I'm a fairly new developer. When I try to submit my iphone app with xcode, I've got error as follows; Code Sign error: The identity 'iPhone Distribution' doesn't match any valid, non-expired certificate/private key pair in the default keychain After searching, I found out that I have to create a Distribution Provisioning Profile. However, my distribution provisioning profile doesn't work, even though my Development Provisioning Profile works perfectly. Could someone please help me with this problem? I'm stuck all day... and please forgive me that my English is not great. Thank you in advance.

    Read the article

  • When can we say that we have mastered something

    - by Thinking
    I donot know if this is a valid question to ask here or not but I have asked this as because i have the doubt In many interviews , the interviewer ask as how much you want ot rate yourself on a scale of 10 in C#, Jave etc. Some says 6 some 7 .... My question is how to judge where I am standing at present? And when can we say that we have mastered a language or a topic. As everything is huge and everyday we learn something.. so there is no end to it... so how can I judge that? Thanks

    Read the article

  • Get result type of function

    - by Robert
    I want to specialize a template function declared as: template<typename Type> Type read(std::istream& is); I then have a lot of static implementations static int read_integer(std::istream& is); a.s.o. Now I'd like to do a macro so that specialization of read is as simple as: SPECIALIZE_READ(read_integer) So I figured I'd go the boost::function_traits way and declare SPECIALIZE_READ as: #define SPECIALIZE_READ(read_function) \ template<> boost::function_traits<read_function>::result_type read(std::istream& is) { \ return read_function(is); \ } but VC++ (2008) compiler complains with: 'boost::function_traits' : 'read_integer' is not a valid template type argument for parameter 'Function' Ideas ?

    Read the article

  • About Attributes member of LUID_AND_ATTRIBUTES used in TOKEN_PRIVILEGES structure

    - by Astaroth
    MSDN article, Enabling and Disabling Privileges in C++, provided the a code example to show how to enable or disable a privilege in an access token. I quote the part in questioned: tp.PrivilegeCount = 1; tp.Privileges[0].Luid = luid; if (bEnablePrivilege) tp.Privileges[0].Attributes = SE_PRIVILEGE_ENABLED; else tp.Privileges[0].Attributes = 0; What is the meaning of zero value for Attributes member? According to the documentation of TOKEN_PRIVILEGES structure, the attributes of a privilege can be a combination of the following values: SE_PRIVILEGE_ENABLED  (it is 0x00000002L in WinNT.h) SE_PRIVILEGE_ENABLED_BY_DEFAULT  (it is 0x00000001L in WinNT.h) SE_PRIVILEGE_REMOVED  (it is 0x00000004L in WinNT.h) SE_PRIVILEGE_USED_FOR_ACCESS  (it is 0x80000000L in WinNT.h) So, we don't see any valid constant with a value of zero. I guess, the zero is equal to SE_PRIVILEGE_REMOVED. Anybody here could explain what the zero value really does?

    Read the article

  • C# method contents validation

    - by user258651
    I need to validate the contents of a C# method. I do not care about syntax errors that do not affect the method's scope. I do care about characters that will invalidate parsing of the rest of the code. For example: method() { /* valid comment */ /* <-- bad for (i..) { } for (i..) { <-- bad } I need to validate/fix any non-paired characters. This includeds /* */, { }, and maybe others. How should I go about this? My first thought was Regex, but that clearly isn't going to get the job done.

    Read the article

  • Include not functioning like I am expecting

    - by bobber205
    The below gives me a fatal error saying that "mymail" was not found. Any ideas why? Looks right to me. mailreq.php include("mail.php"); $r = mymail("test","test"); mail.php function mymail($body, $reqtype) { //blah blah } EDIT: For some reason, this version of php doesn't see <? ?> as valid shorthand tags. I changed it to <?php ?> and it sees the functions now.

    Read the article

  • Why is i-- faster than i++ in loops? [closed]

    - by Afshin Mehrabani
    Possible Duplicate: JavaScript - Are loops really faster in reverse…? I don't know if this question is valid in other languages or not, but I'm asking this specifically for JavaScript. I see in some articles and questions that the fastest loop in JavaScript is something like: for(var i = array.length; i--; ) Also in Sublime Text 2, when you try to write a loop, it suggests: for (var i = Things.length - 1; i >= 0; i--) { Things[i] }; I want to know, why is i-- faster than i++ in loops?

    Read the article

  • jQuery Nested Droppables

    - by John
    I have a nested set of jQuery droppables...one outer droppable that encompasses most of the page and an a set of nested inner droppables on the page. The functionality I want is: If a draggable is dropped outside of any of the inner droppables it should be accepted by the outer droppable. If a draggable is dropped onto any of the inner droppables it should NOT be accepted by the outer droppable, regardless of whether the inner droppable accepts the draggable. So that would be easy if I could guarantee 1+ inner droppables would accept the draggable, because the greedy attribute would make sure it would only get triggered once. Unfortunately the majority of the time the inner droppable will also reject the draggable, meaning the greedy option doesn't really help. Summary: The basic functionality is a set of valid/invalid inner droppables to accept the draggable, but when you toss the draggable outside any of the draggables it gets destroyed by the outer droppable. What's the best way of doing this?

    Read the article

  • c++ link temporary allocations in fuction to custom allocator?

    - by user300713
    Hi, I am currently working on some simple custom allocators in c++ which generally works allready. I also overloaded the new/delete operators to allocate memory from my own allocator. Anyways I came across some scenarios where I don't really know where the memory comes from like this: void myFunc(){ myObj testObj(); ....do something with it } In this case testObj would only be valid inside the function, but where would its memory come from? Is there anyway I could link it to my allocator? Would I have to create to object using new and delete or is there another way? Thanks

    Read the article

  • Apache redirect when users home directory is completely empty.

    - by Scott M
    I work for an ISP and I have a server with thousands of users 10MB of free storage. They get this free storage with every e-mail account they have with us. An example of a users storage address: http://users.example.com/~username/ One problem I can see is scanning the server for user names to see what accounts are available, basically getting a list of all our customers valid e-mail addresses. This would be very, very bad. So I'm wanting to redirect to our homepage if someone comes across a users account that is empty (I'd say 90% of them are completely empty). I also do not want to simply -Indexes them and use a custom 403 because the few customers that do use them, want +Indexes. I know I can always just tell the customers to put a htaccess file in their directory with Options +indexes if they want directory listing, but that's a last resort. How can I make it pretty much impossible to tell what accounts are on the server but not in use at all?

    Read the article

  • Nesting if else statements in PHP to validate a URL

    - by John
    I'm currently writing up a function in order to validate a URL by exploding it into different parts and matching those parts with strings I've defined. This is the function I'm using so far: function validTnet($tnet_url) { $tnet_2 = "defined2"; $tnet_3 = "defined3"; $tnet_5 = "defined5"; $tnet_7 = ""; if($exp_url[2] == $tnet_2) { #show true, proceed to next validation if($exp_url[3] == $tnet_3) { #true, and next if($exp_url[5] == $tnet_5) { #true, and last if($exp_url[7] == $tnet_7) { #true, valid } } } } else { echo "failed on tnet_2"; } } For some reason I'm unable to think of the way to code (or search for the proper term) of how to break out of the if statements that are nested. What I would like to do check each part of the URL, starting with $tnet_2, and if it fails one of the checks ($tnet_2, $tnet_3, $tnet_5 or $tnet_7), output that it fails, and break out of the if statement. Is there an easy way to accomplish this using some of the code I have already?

    Read the article

  • Java application return codes

    - by doele
    I have a Java program that processes one file at a time. This Java program is called from a wrapper script which logs the return code from the Java program. There are 2 types of errors. Expected errors and unexpected errors. In both cases I just need to log them. My wrapper knows about 3 different states. 0-OK, 1-PROCESSING_FAILED, 2- ERROR. Is this a valid approach? Here is my approach: enum ReturnCodes {OK,PROCESSING_FAILED,ERROR}; public static void main(String[] args) { ... proc.processMyFile(); ... System.exit(ReturnCodes.OK.ordinal()); } catch (Throwable t) { ... System.exit(ReturnCodes.ERROR.ordinal()); } private void processMyFile() { try { ... }catch( ExpectedException e) { ... System.exit(ReturnCodes.PROCESSING_FAILED.ordinal()); } }

    Read the article

  • How can I identify an argument as a year in Perl?

    - by dexter
    I have created a file argument.pl which takes several arguments first of which should be in form of a year For example: 2010 23 type. Here 2010 is a year my code does something like: use strict; use warning use Date::Calc qw(:all); my ($startyear, $startmonth, $startday) = Today(); my $weekofyear = (Week_of_Year ($startyear,$startmonth,$startday))[0]; my $Year = $startyear; ... ... if ($ARGV[0]) { $Year = $ARGV[0]; } Here this code fills $Year with "current year" if $ARGV[0] is null or doesn't exist. now here instead of if ($ARGV[0]) Is it possible to check that the value in $ARGV[0] is a valid year (like 2010, 1976,1999 etc.)?

    Read the article

  • escaping into php

    - by pradeep
    $valid-url = "p1=".rawurlencode($_GET['p1'])."&type=".rawurlencode($_GET['type'])."&os=".rawurlencode($_GET['os'])."&price=".rawurlencode($_GET['price'])."&sort=".rawurlencode($_GET['sort'])."&sort_order=".rawurlencode($_GET['sort_order'])."&perpage=".rawurlencode($perpage).""; i am trying to build the url and pass it to <a href=''..but its throwing escaping problem...can i get some help on this.

    Read the article

  • generate 10 UUID records and save it it database in rails

    - by user662503
    I need to create certain number of UUId records (based on the selection of a drop down) and save them in the database. Now I am generating only one unique id. Can this be done in the model in this way? Or do I need to write a helper file for that? def generate_unique_token=(value) self.secret = Base64.encode64(UUIDTools::UUID.random_create)[0..8] end My controller: def create @secretcode = Secretcode.new(params[:secretcode]) @user = User.new(params[:user]) @secretcode.user_id = @user @secretcode.generate_unique_token = params[:secretcode][:secret] if @secretcode.valid? @secretcode.save redirect_to secretcodes_path else render 'new' end end My view page <%= form_for(@secretcode) do |f| %> <%= f.select(:secret, options_for_select([['1',1], ['10',10], ['20',20],['50',50]['100',100]])) %> <%= render 'layouts/error' %> <%=f.label :secret%> <%= f.hidden_field :user %> <%=f.submit :generate %> <% end %>

    Read the article

  • Periods in Javascript function definition (function window.onload(){}) [closed]

    - by nemec
    Possible Duplicate: JavaScript Function Syntax Explanation: function object.myFunction(){..} I've seen some (legacy) javascript code recently that looks like: function window.onload(){ // some code } This doesn't look like valid javascript to me since you can't have a period in an identifier, but it seems to work in IE8. I assume it's the equivalent of: window.onload = function(){} I've tried the same code in Chrome and IE9 and both of them raise syntax exceptions, so am I correct in thinking that this "feature" of IE8 is some non-standard function definition that should be replaced? The code in question is only sent to IE browsers, so that's probably why I haven't run into this issue before.

    Read the article

  • Is this syntactically correct?

    - by Borrito
    I have code in one of the source file as follows: #include <stdio.h> #include <math.h> int a ; int b = 256 ; int c = 16 ; int d = 4 ; int main() { if ((d <= (b) && (d == ( c / sizeof(a)))) { printf("%d",sizeof(a) ); } return 0; } I have removed the casts and have simplified on the data names. The sizeof(a) can be taken as 4. I want to know if the the if syntax is a valid one and if so why doesn't it execute? PS : I haven't sat down on this for long due to time constraints. Pardon me if you find a childish error in the code.

    Read the article

< Previous Page | 149 150 151 152 153 154 155 156 157 158 159 160  | Next Page >