Search Results

Search found 39788 results on 1592 pages for 'action method'.

Page 1538/1592 | < Previous Page | 1534 1535 1536 1537 1538 1539 1540 1541 1542 1543 1544 1545  | Next Page >

• JButton Image Ignoring GridBagConstraints

  - by daemor

  I am working on an application and have a screen that needs to have elements (namely some custom JButtons) appear and disappear based on a user selection. However for some reason, when I add these buttons to their pane, the buttton image goes to the top corner, and leaves the text in the center, completely ignoring GridBagConstraints. I am completely stumped on this one as I have done this same exact thing dozens of times earlier in the program without any issues. Here is an image of the problem: The problem is in this method here, and occurs down towards the bottom. public void init(){ contentPane.removeAll(); // Setup jlabels JLabel countyLabel = new JLabel("County"); countyLabel.setFont(new Font("Times New Roman", Font.PLAIN, 18)); JLabel measureByLabel = new JLabel("Measure By: "); measureByLabel.setFont(new Font("Times New Roman", Font.PLAIN, 18)); String[] countyChoices = {"Washtenaw", "Oakland", "Livingston"}; // setup components JComboBox<String> countyCombo = new JComboBox<String>(countyChoices); // place baseComponents c.weightx = 0.5; c.weighty = 0.5; c.gridx = 0; c.gridy = 0; c.anchor = GridBagConstraints.NORTH; contentPane.add(countyLabel, c); c.gridx = 2; contentPane.add(countyCombo, c); c.gridy = 1; c.gridx = 0; contentPane.add(trenchButton, c); c.gridx = 2; contentPane.add(bedButton, c); c.gridy = 2; c.gridx = 1; contentPane.add(systemSelection, c); c.gridy = 3; c.gridx = 0; contentPane.add(lengthButton, c); c.fill = GridBagConstraints.BOTH; c.gridwidth = 4; c.gridy = 4; c.gridx = 0; contentPane.add(choicePane, c); GridBagConstraints con = new GridBagConstraints(); con.weightx = 0.5; con.weighty = 0.5; con.gridx = 0; con.gridy = 0; choicePane.add(lengthButton, c); // revalidate and repaint choicePane.revalidate(); choicePane.repaint(); contentPane.revalidate(); contentPane.repaint(); } I have tried doing this in separate methods, the button looks fine when added to the contentPane, the pane is for sure set to gridbagconstraints as I used the expression JPanel choicePane = new JPanel(new GridBagLayout()) to initialize it.

  Read the article

• Spring.Net Message Selectors with compound statements don't seem to be working

  - by Jonathan Beerhalter

  I'm using Spring.NET to connect to ActiveMQ and do some fairly simple pub sub routing. Everything works fine when my selector is a simple expression like Car='Honda' but if I try a compound expression like Car='Honda' AND Make='Pilot' I never get any matches on my subscription. Here's the code to generate the subscription, does anyone see where I might be doing something wrong? public bool AddSubscription(string topicName, Dictionary<string,string> selectorList, GDException exp) { try { ActiveMQTopic topic = new ActiveMQTopic(topicName); string selectorString = ""; if (selectorList.Keys.Count == 0) { // Select all items for this topic selectorString = "2>1"; } else { foreach (string key in selectorList.Keys) { selectorString += key + " = '" + selectorList[key] + "'" + " AND "; } selectorString = selectorString.Remove(selectorString.Length - 5, 5); } IMessageConsumer consumer = this._subSession.CreateConsumer(topic, selectorString, false); if (consumer != null) { _consumers.Add(consumer); consumer.Listener += new MessageListener(HandleRecieveMessage); return true; } else { exp.SetValues("Error adding subscription, null consumer returned"); return false; } } catch (Exception ex) { exp.SetValues(ex); return false; } } And then the code to send the message, which seems simple enough to me public void SendMessage(GDPubSubMessage messageToSend) { if (!this.isDisposed) { if (_producers.ContainsKey(messageToSend.Topic)) { IBytesMessage bytesMessage = this._pubSession.CreateBytesMessage(messageToSend.Payload); foreach (string key in messageToSend.MessageProperties.Keys) { bytesMessage.Properties.SetString(key, messageToSend.MessageProperties[key]); } _producers[messageToSend.Topic].Send(bytesMessage, false, (byte)255, TimeSpan.FromSeconds(1)); } else { ActiveMQTopic topic = new ActiveMQTopic(messageToSend.Topic); _producers.Add(messageToSend.Topic, this._pubSession.CreateProducer(topic)); IBytesMessage bytesMessage = this._pubSession.CreateBytesMessage(messageToSend.Payload); foreach (string key in messageToSend.MessageProperties.Keys) { bytesMessage.Properties.SetString(key, messageToSend.MessageProperties[key]); } _producers[messageToSend.Topic].Send(bytesMessage); } } else { throw new ObjectDisposedException(this.GetType().FullName); } } 07/102009: Update Ok, found the problem bytesMessage.Properties.SetString(key, messageToSend.MessageProperties[key]); This justs sets a single property, so my messages are only being tagged with a single property, hence the combo subscription never gets hit. Anyone know how to add more properties? You'd think bytesMessage.Properties would have a Add method, but it doesn't.

  Read the article

• Changing Data in ListView

  - by legr3c

  Hi In my app I use a ListView to display data from the database. The data changes sometimes, for example when the user applies new filters or changes the sorting method. I use AsyncTask to get the databsase cursor that points to the new data set because sometimes data needs to be loaded from the net which can take some time. What I do now looks something like this: private class updateTask extends AsyncTask<Void, Void, Void> { /* * runs on the UI thread before doInBackground */ @Override protected void onPreExecute(){ // prepare some stuff... } /* * runs in a separate thread * used for time-consuming loading operation */ @Override protected Void doInBackground() { //get new database cursor mCursor = mDbAdapter.getCursor(); return null; } /* * runs on the UI thread after doInBackground */ @Override protected void onPostExecute(Void result){ if(mCursor!=null){ MyActivity.this.startManagingCursor(mCursor); mCursorAdapter = new MyCustomCursorAdapter(MyActivity.this, mCursor); mListView.setAdapter(mCursorAdapter); } } } This works so far but I realize that creating a new CursorAdapter and calling setAdapter on my ListView each time isn't the correct way to do it. Also, after setAdapter the scroll position of the list is set back to the top. I found this post which describes how to do it properly. So now I want to do something like this: onCreate(){ // ... // create the CursorAdapter using null as the initial cursor MyCustomCursorAdapter cursorAdapter = new MyCustomCursorAdapter(this, null); mListView.setAdapter(cursorAdapter); // ... } private class updateTask extends AsyncTask<Void, Void, Void> { /* * runs on the UI thread before doInBackground */ @Override protected void onPreExecute(){ // prepare some stuff... } /* * runs in a separate thread * used for time-consuming loading operation */ @Override protected Void doInBackground() { //get new database cursor mCursor = mDbAdapter.getCursor(); return null; } /* * runs on the UI thread after doInBackground */ @Override protected void onPostExecute(Void result){ // this returns null! MyCustomCursorAdapter cursorAdapter = (MyCustomCursorAdapter)mListView.getAdapter(); Cursor oldCursor = cursorAdapter.getCursor(); if(oldCursor!=null){ MyActivity.this.stopManagingCursor(oldCursor); oldCursor.close(); } if(mCursor!=null){ MyActivity.this.startManagingCursor(mCursor); cursorAdapter.changeCursor(mCursor); } } } This however doesn't work for me because (MyCustomCursorAdapter)mListView.getAdapter(); always returns null. Why does this happen? What am I doing wrong? Edit: Some additional information: my adapter implements SectionIndexer. I don't really think that this has anything to do with my problem but it has caused me some troubles before so I thought I'd mention it.

  Read the article

• HttpWebRequest possibly slowing website

  - by Steven Smith

  Using Visual studio 2012, C#.net 4.5 , SQL Server 2008, Feefo, Nopcommerce Hey guys I have Recently implemented a new review service into a current site we have. When the change went live the first day all worked fine. Since then though the sending of sales to Feefo hasnt been working, There are no logs either of anything going wrong. In the OrderProcessingService.cs in Nop Commerce's Service, i call a HttpWebrequest when an order has been confirmed as completed. Here is the code. var email = HttpUtility.UrlEncode(order.Customer.Email.ToString()); var name = HttpUtility.UrlEncode(order.Customer.GetFullName().ToString()); var description = HttpUtility.UrlEncode(productVariant.ProductVariant.Product.MetaDescription != null ? productVariant.ProductVariant.Product.MetaDescription.ToString() : "product"); var orderRef = HttpUtility.UrlEncode(order.Id.ToString()); var productLink = HttpUtility.UrlEncode(string.Format("myurl/p/{0}/{1}", productVariant.ProductVariant.ProductId, productVariant.ProductVariant.Name.Replace(" ", "-"))); string itemRef = ""; try { itemRef = HttpUtility.UrlEncode(productVariant.ProductVariant.ProductId.ToString()); } catch { itemRef = "0"; } var url = string.Format("feefo Url", login, password,email,name,description,orderRef,productLink,itemRef); var request = (HttpWebRequest)WebRequest.Create(url); request.KeepAlive = false; request.Timeout = 5000; request.Proxy = null; using (var response = (HttpWebResponse)request.GetResponse()) { if (response.StatusDescription == "OK") { var stream = response.GetResponseStream(); if(stream != null) { using (var reader = new StreamReader(stream)) { var content = reader.ReadToEnd(); } } } } So as you can see its a simple webrequest that is processed on an order, and all product variants are sent to feefo. Now: this hasnt been happening all week since the 15th (day of the implementation) the site has been grinding to a halt recently. The stream and reader in the the var content is there for debugging. Im wondering does the code redflag anything to you that could relate to the process of website? Also note i have run some SQL statements to see if there is any deadlocks or large escalations, so far seems fine, Logs have also been fine just the usual logging of Bots. Any help would be much appreciated! EDIT: also note that this code is in a method that is called and wrapped in A try catch UPDATE: well forget about the "not sending", thats because i was just told my code was rolled back last week

  Read the article

• How to dispose off custom object from within custom membership provider

  - by IrfanRaza

  I have created my custom MembershipProvider. I have used an instance of the class DBConnect within this provider to handle database functions. Please look at the code below: public class SGIMembershipProvider : MembershipProvider { #region "[ Property Variables ]" private int newPasswordLength = 8; private string connectionString; private string applicationName; private bool enablePasswordReset; private bool enablePasswordRetrieval; private bool requiresQuestionAndAnswer; private bool requiresUniqueEmail; private int maxInvalidPasswordAttempts; private int passwordAttemptWindow; private MembershipPasswordFormat passwordFormat; private int minRequiredNonAlphanumericCharacters; private int minRequiredPasswordLength; private string passwordStrengthRegularExpression; private MachineKeySection machineKey; **private DBConnect dbConn;** #endregion ....... public override bool ChangePassword(string username, string oldPassword, string newPassword) { if (!ValidateUser(username, oldPassword)) return false; ValidatePasswordEventArgs args = new ValidatePasswordEventArgs(username, newPassword, true); OnValidatingPassword(args); if (args.Cancel) { if (args.FailureInformation != null) { throw args.FailureInformation; } else { throw new Exception("Change password canceled due to new password validation failure."); } } SqlParameter[] p = new SqlParameter[3]; p[0] = new SqlParameter("@applicationName", applicationName); p[1] = new SqlParameter("@username", username); p[2] = new SqlParameter("@password", EncodePassword(newPassword)); bool retval = **dbConn.ExecuteSP("User_ChangePassword", p);** return retval; } //ChangePassword public override void Initialize(string name, NameValueCollection config) { if (config == null) { throw new ArgumentNullException("config"); } ...... ConnectionStringSettings ConnectionStringSettings = ConfigurationManager.ConnectionStrings[config["connectionStringName"]]; if ((ConnectionStringSettings == null) || (ConnectionStringSettings.ConnectionString.Trim() == String.Empty)) { throw new ProviderException("Connection string cannot be blank."); } connectionString = ConnectionStringSettings.ConnectionString; **dbConn = new DBConnect(connectionString); dbConn.ConnectToDB();** ...... } //Initialize ...... } // SGIMembershipProvider I have instantiated dbConn object within Initialize() event. My problem is that how could i dispose off this object when object of SGIMembershipProvider is disposed off. I know the GC will do this all for me, but I need to explicitly dispose off that object. Even I tried to override Finalize() but there is no such overridable method. I have also tried to create destructor for SGIMembershipProvider. Can anyone provide me solution.

  Read the article

• Need help helping in converting jquery, ajax, json and asp.net

  - by Haja Mohaideen

  I am tying out this tutorial, http://www.ezzylearning.com/tutorial.aspx?tid=5869127. It works perfectly. What I am now trying to do is to host the aspx contents as html file. This html file is hosted on my wampserver which is on my laptop. The asp.net code hosted on my test server. When I try to access, I get the following error, Resource interpreted as Script but transferred with MIME type text/html: "http://201.x.x.x/testAjax/Default.aspx/AddProductToCart?callback=jQuery17103264484549872577_1346923699990&{%20pID:%20%226765%22,%20qty:%20%22100%22,%20lblType:%20%2220%22%20}&_=1346923704482". jquery.min.js:4 Uncaught SyntaxError: Unexpected token < I am not sure how to solve this problem. index.html code $(function () { $('#btnAddToCart').click(function () { var result = $.ajax({ type: "POST", url: "http://202.161.45.124/testAjax/Default.aspx/AddProductToCart", crossDomain: true, data: '{ pID: "6765", qty: "100", lblType: "20" }', contentType: "application/json; charset=utf-8", dataType: "jsonp", success: succeeded, failure: function (msg) { alert(msg); }, error: function (xhr, err) { alert(err); } }); }); }); function succeeded(msg) { alert(msg.d); } function btnAddToCart_onclick() { } </script> </head> <body> <form name="form1" method="post"> <div> <input type="button" id="btnAddToCart" onclick="return btnAddToCart_onclick()" value="Button" /> </div> </form> aspx.vb Imports System.Web.Services Imports System.Web.Script.Services <ScriptService()> Public Class WebForm1 Inherits Page Protected Sub Page_Load(ByVal sender As Object, ByVal e As System.EventArgs) Handles Me.Load Session("test") = "" End Sub <WebMethod()> <ScriptMethod(UseHttpGet:=False, ResponseFormat:=ResponseFormat.Json)> Public Shared Function AddProductToCart(pID As String, qty As String, lblType As String) As String Dim selectedProduct As String = String.Format("+ {0} - {1} - {2}", pID, qty, lblType) HttpContext.Current.Session("test") += selectedProduct Return HttpContext.Current.Session("test").ToString() End Function End Class

  Read the article

• php download file slows

  - by hobbywebsite

  OK first off thanks for your time I wish I could give more than one point for this question. Problem: I have some music files on my site (.mp3) and I am using a php file to increment a database to count the number of downloads and to point to the file to download. For some reason this method starts at 350kb/s then slowly drops to 5kb/s which then the file says it will take 11hrs to complete. BUT if I go directly to the .mp3 file my browser brings up a player and then I can right click and "save as" which works fine complete download in 3mins. (Yes both during the same time for those that are thinking it's my connection or ISP and its not my server either.) So the only thing that I've been playing around with recently is the php.ini and the .htcaccess files. So without further ado, the php file, php.ini, and the .htcaccess: download.php <?php include("config.php"); include("opendb.php"); $filename = 'song_name'; $filedl = $filename . '.mp3'; $query = "UPDATE songs SET song_download=song_download+1 WHER song_linkname='$filename'"; mysql_query($query); header('Content-Disposition: attachment; filename='.basename($filedl)); header('Content-type: audio/mp3'); header('Content-Length: ' . filesize($filedl)); readfile('/music/' . $filename . '/' . $filedl); include("closedb.php"); ?> php.ini register_globals = off allow_url_fopen = off expose_php = Off max_input_time = 60 variables_order = "EGPCS" extension_dir = ./ upload_tmp_dir = /tmp precision = 12 SMTP = relay-hosting.secureserver.net url_rewriter.tags = "a=href,area=href,frame=src,input=src,form=,fieldset=" ; Defines the default timezone used by the date functions date.timezone = "America/Los_Angeles" .htaccess Options +FollowSymLinks RewriteEngine on RewriteCond %{HTTP_HOST} !^(www.MindCollar.com)?$ [NC] RewriteRule (.*) http://www.MindCollar.com/$1 [R=301,L] <IfModule mod_rewrite.c> RewriteEngine On ErrorDocument 404 /errors/404.php ErrorDocument 403 /errors/403.php ErrorDocument 500 /errors/500.php </IfModule> Options -Indexes Options +FollowSymlinks <Files .htaccess> deny from all </Files> thanks for you time

  Read the article

• error with redirect using listener JSF 2.0

  - by Ray

  I have a index.xhtml page <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" xmlns:h="http://java.sun.com/jsf/html" xmlns:f="http://java.sun.com/jsf/core" xmlns:ui="http://java.sun.com/jsf/facelets"> <f:view> <ui:insert name="metadata" /> <f:event type="preRenderView" listener="#{item.show}" /> <h:body></h:body> </f:view> </html> And in bean class with scope session this method public void show() throws IOException, DAOException { ExternalContext externalContext = FacesContext.getCurrentInstance() .getExternalContext(); //smth String rootPath = externalContext.getRealPath("/"); String realPath = rootPath + "pages\\template\\body\\list.xhtml"; externalContext.redirect(realPath); } i think that I should redirect to next page but I have "browser can't show page" and list.xhtml (if I do this page as welcome-page I haven't error, it means that error connected with redirect) <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" xmlns:h="http://java.sun.com/jsf/html" xmlns:f="http://java.sun.com/jsf/core" xmlns:ui="http://java.sun.com/jsf/facelets"> <h:body> <ui:composition template="/pages/layouts/mainLayout.xhtml"> <ui:define name="content"> <h:form></h:form></ui:define></ui:composition> </h:body> </html> in consol i didn't have any error. in web.xml <welcome-file-list> <welcome-file>index.xhtml</welcome-file> </welcome-file-list> <servlet> <servlet-name>Faces Servlet</servlet-name> <servlet-class>javax.faces.webapp.FacesServlet</servlet-class> <load-on-startup>1</load-on-startup> </servlet> <servlet-mapping> <servlet-name>Faces Servlet</servlet-name> <url-pattern>*.xhtml</url-pattern> </servlet-mapping> What can be the reason this problem?

  Read the article

• Javascript Converter Coding Error ~ Showing Bug

  - by olivia

  Please help~! <HTML> <HEAD> <TITLE>Bra Size to Chest Size Converter - CM</TITLE> <SCRIPT LANGUAGE="JavaScript"> function CalculateSum(Atext, Btext, form) { var A = BratoNum(Btext); var B = parseFloat(CuptoNum(Btext)); form.Answer.value = A + B; } function ClearForm(form) { form.input_A.value = ""; form.input_B.value = ""; form.Answer.value = ""; } function BratoNum(str) { switch(str.toUpperCase()) { case "32": return 70; case "34": return 75; case "36": return 80; case "38": return 85; case "40": return 90; default: alert('You must enter a number between 32 and 40!'); return 'X'; } } function CuptoNum(str) { switch(str.toUpperCase()) { case "A": return 4; case "B": return 5; case "C": return 6; case "D": return 7; case "E": return 8; case "F": return 9; default: alert('You must enter a letter between A and F!'); return 'X'; } } // end of JavaScript functions --> </SCRIPT> </HEAD> <BODY> <P><FONT SIZE="+2">Bra Size to Chest Size Converter</FONT></P> <FORM NAME="Calculator" METHOD="post"> <P>Enter Bra Size: <INPUT TYPE=TEXT NAME="input_A" SIZE=8></P> <P>Enter Cup Size: <INPUT TYPE=TEXT NAME="input_B" SIZE=8></P> <P><INPUT TYPE="button" VALUE="Get Chest Size" name="AddButton" onClick="CalculateSum(this.form.input_A.value, this.form.input_B.value, this.form)"></P> <P>Your Chest Size is <INPUT TYPE=TEXT NAME="Answer" SIZE=8> inch</P> <P><INPUT TYPE="button" VALUE="Clear" name="ClearButton" onClick="ClearForm(this.form)"></P> </FORM> </BODY> </HTML>

  Read the article

• Any thoughts on how to create a true 'punch-out' area in a Sprite?

  - by rhtx

  I've been working on this for awhile, now. You might also call it a 'reverse mask', or an 'inverse mask'. Basically, I'm creating a view window within a display object. I need to allow objects on the stage that are under the window to be able to interact with the mouse. This is similar to a WPF question: http://stackoverflow.com/questions/740994/use-wpf-object-to-punch-hole-in-another, which has a much shorter write-up. I've got a Class called PunchOutShield, which creates a Sprite that covers the stage (or over some desired area). The Sprite's Graphics object is filled using the color and transparency of Flex's modal screen. The result is a screen that looks like the screen which appears behind a modal PopUp. PunchOutShield has a method called punch, which takes two arguments - the first is a Shape object, which defines the shape of the punch-through area; the second is a Point object, which indicates where to position the punch-through area. It took some experimenting, but I found that I can successfully create a punch-out area (i.e. - the modal screen does not display within the bounds of the given Shape). To do this, I set cacheAsBitmap to true on the Sprite that is used to create the modal screen, and also on the Shape object, which is added to the modal screen Sprite's displayList. If I set the blend mode of the Shape to ERASE, a completely transparent area is created in the modal screen. So far, great. The problem is that Shape does not subclass InteractiveObject, so there is no way to set mouseEnabled = false on it. And so, it prevents interaction between the mouse and any objects that are visible through the punch-out area. On top of that, InteractiveObject isn't available to look at, so I can't see if there is a way to borrow what it's doing to provide the mouseEnabled functionality and apply it to a subclass of Shape. I've tried using another Sprite object, rather than a Shape object, but the blending doesn't work out correctly. I'm not sure why there is a difference, but the Shape object seems to somehow combine with the parenting Sprite, allowing the ERASE blendMode to effect the desired punch-out visual appearance. It wouldn't be the end of the world if I had to draw up the screen with a series of rectangles so that the punch-out area was just simply not drawn, but that approach won't work if the punch-out area is complex. Or round. Any thoughts on this approach, or on an alternative approach?

  Read the article

• Loading images to UIScrollview crashes

  - by Icky

  Hello All. I have a Navigationcontroller pushing a UIViewController with a scrollview inside. Within the scrollview I download a certain number of images around 20 (sometimes more) each sized around 150 KB. All these images are added to the scrollview so that their origin is x +imageSize and the following is sorted right to the one before. All in all I think its a lot of data (3-4 MB). On an I pod Touch this sometimes crashes, the IPhone can handle it once, if it has to load the data again (some other images) , it crashes too. I guess its a memory issue but within my code, I download the image, save it to a file on the phone as NSData, read it again from file and add it to a UIImageview which I release. So I have freed the memory I allocated, nevertheless it still crashes. Can anyone help me out? Since Im new to this, I dont know the best way to handle the Images in a scrollview. Besides I create the controller at start from nib, which means I dont have to release it, since I dont use alloc - right? Code: In my rootviewcontroller I do: -(void) showImages { [[self naviController] pushViewController:imagesViewController animated:YES]; [imagesViewController viewWillAppear:YES]; } Then in my Controller handling the scroll View, this is the method to load the images: - (void) loadOldImageData { for (int i = 0; i < 40 ; i++) { NSArray *paths = NSSearchPathForDirectoriesInDomains(NSDocumentDirectory, NSUserDomainMask, YES); NSString *documentsDirectory = [paths objectAtIndex:0]; NSString *filePath = [documentsDirectory stringByAppendingPathComponent:[NSString stringWithFormat:@"img%d.jpg", i]]; NSData *myImg = [NSData dataWithContentsOfFile:filePath]; UIImage *im = [UIImage imageWithData:myImg]; if([im isKindOfClass:[UIImage class]]) { NSLog(@"IM EXISTS"); UIImageView *imgView = [[UIImageView alloc] initWithImage:im]; CGRect frame = CGRectMake(i*320, 0, 320, 416); imgView.frame = frame; [myScrollView addSubview:imgView]; [imgView release]; //NSLog(@"Adding img %d", i); numberImages = i; NSLog(@"setting numberofimages to %d", numberImages); //NSLog(@"scroll subviews %d", [myScrollView.subviews count]); } } myScrollView.contentSize = CGSizeMake(320 * (numberImages + 1), 416); }

  Read the article

• How would you implement this "WorkerChain" functionality in .NET?

  - by Dan Tao

  Sorry for the vague question title -- not sure how to encapsulate what I'm asking below succinctly. (If someone with editing privileges can think of a more descriptive title, feel free to change it.) The behavior I need is this. I am envisioning a worker class that accepts a single delegate task in its constructor (for simplicity, I would make it immutable -- no more tasks can be added after instantiation). I'll call this task T. The class should have a simple method, something like GetToWork, that will exhibit this behavior: If the worker is not currently running T, then it will start doing so right now. If the worker is currently running T, then once it is finished, it will start T again immediately. GetToWork can be called any number of times while the worker is running T; the simple rule is that, during any execution of T, if GetToWork was called at least once, T will run again upon completion (and then if GetToWork is called while T is running that time, it will repeat itself again, etc.). Now, this is pretty straightforward with a boolean switch. But this class needs to be thread-safe, by which I mean, steps 1 and 2 above need to comprise atomic operations (at least I think they do). There is an added layer of complexity. I have need of a "worker chain" class that will consist of many of these workers linked together. As soon as the first worker completes, it essentially calls GetToWork on the worker after it; meanwhile, if its own GetToWork has been called, it restarts itself as well. Logically calling GetToWork on the chain is essentially the same as calling GetToWork on the first worker in the chain (I would fully intend that the chain's workers not be publicly accessible). One way to imagine how this hypothetical "worker chain" would behave is by comparing it to a team in a relay race. Suppose there are four runners, W1 through W4, and let the chain be called C. If I call C.StartWork(), what should happen is this: If W1 is at his starting point (i.e., doing nothing), he will start running towards W2. If W1 is already running towards W2 (i.e., executing his task), then once he reaches W2, he will signal to W2 to get started, immediately return to his starting point and, since StartWork has been called, start running towards W2 again. When W1 reaches W2's starting point, he'll immediately return to his own starting point. If W2 is just sitting around, he'll start running immediately towards W3. If W2 is already off running towards W3, then W2 will simply go again once he's reached W3 and returned to his starting point. The above is probably a little convoluted and written out poorly. But hopefully you get the basic idea. Obviously, these workers will be running on their own threads. Also, I guess it's possible this functionality already exists somewhere? If that's the case, definitely let me know!

  Read the article

• Will this ever result in a stack overflow error?

  - by David

  Will incrementing the instance variables of an object ever lead to a stack overflow error? For example: This method (java) will cause a stack overflow error: class StackOverflow { public static void StackOverflow (int x) { System.out.println (x) ; StackOverflow(x+1) ; } public static void main (String[]arg) { StackOverflow (0) ; } but will this?: (..... is a gap that i've put in to shorten the code. its long enough as it is.) import java.util.*; class Dice { String name ; int x ; int[] sum ; .... public Dice (String name) { this.name = name ; this.x = 0 ; this.sum = new int[7] ; } .... public static void main (String[] arg) { Dice a1 = new Dice ("a1") ; for (int i = 0; i<6000000; i++) { a1.roll () ; printDice(a1) ; } } .... public void roll () { this.x = randNum(1, this.sum.length) ; this.sum[x] ++ ; } public static int randNum (int a, int b) { Random random = new Random() ; int c = (b-a) ; int randomNumber = ((random.nextInt(c)) + a) ; return randomNumber ; } public static void printDice (Dice Dice) { System.out.println (Dice.name) ; System.out.println ("value: "+Dice.x) ; printValues (Dice) ; } public static void printValues (Dice Dice) { for (int i = 0; i<Dice.sum.length; i++) System.out.println ("#of "+i+"'s: "+Dice.sum[i]) ; } } The above doesn't currently cause a stack overflow error but could i get it too if i changed this line in main: for (int i = 0; i<6000000; i++) so that instead of 6 million something sufficiently high were there?

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• html5 uploader + jquery drag & drop: how to store file data with FormData?

  - by lauthiamkok

  I am making a html5 drag and drop uploader with jquery, below is my code so far, the problem is that I get an empty array without any data. Is this line incorrect to store the file data - fd.append('file', $thisfile);? $('#div').on( 'dragover', function(e) { e.preventDefault(); e.stopPropagation(); } ); $('#div').on( 'dragenter', function(e) { e.preventDefault(); e.stopPropagation(); } ); $('#div').on( 'drop', function(e){ if(e.originalEvent.dataTransfer){ if(e.originalEvent.dataTransfer.files.length) { e.preventDefault(); e.stopPropagation(); // The file list. var fileList = e.originalEvent.dataTransfer.files; //console.log(fileList); // Loop the ajax post. for (var i = 0; i < fileList.length; i++) { var $thisfile = fileList[i]; console.log($thisfile); // HTML5 form data object. var fd = new FormData(); //console.log(fd); fd.append('file', $thisfile); /* var file = {name: fileList[i].name, type: fileList[i].type, size:fileList[i].size}; $.each(file, function(key, value) { fd.append('file['+key+']', value); }) */ $.ajax({ url: "upload.php", type: "POST", data: fd, processData: false, contentType: false, success: function(response) { // .. do something }, error: function(jqXHR, textStatus, errorMessage) { console.log(errorMessage); // Optional } }); } /*UPLOAD FILES HERE*/ upload(e.originalEvent.dataTransfer.files); } } } ); function upload(files){ console.log('Upload '+files.length+' File(s).'); }; then if I use another method is that to make the file data into an array inside the jquery code, var file = {name: fileList[i].name, type: fileList[i].type, size:fileList[i].size}; $.each(file, function(key, value) { fd.append('file['+key+']', value); }); but where is the tmp_name data inside e.originalEvent.dataTransfer.files[i]? php, print_r($_POST); $uploaddir = './uploads/'; $file = $uploaddir . basename($_POST['file']['name']); if (move_uploaded_file($_POST['file']['tmp_name'], $file)) { echo "success"; } else { echo "error"; } as you can see that tmp_name is needed to upload the file via php... html, <div id="div">Drop here</div>

  Read the article

• WPF data templates

  - by imekon

  I'm getting started with WPF and trying to get my head around connecting data to the UI. I've managed to connect to a class without any issues, but what I really want to do is connect to a property of the main window. Here's the XAML: <Window x:Class="test3.MainWindow" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" xmlns:custom="clr-namespace:test3" Title="MainWindow" Height="350" Width="525"> <Window.Resources> <CollectionViewSource Source="{Binding Source={x:Static Application.Current}, Path=Platforms}" x:Key="platforms"/> <DataTemplate DataType="{x:Type custom:Platform}"> <StackPanel> <CheckBox IsChecked="{Binding Path=Selected}"/> <TextBlock Text="{Binding Path=Name}"/> </StackPanel> </DataTemplate> </Window.Resources> <Grid> <ListBox ItemsSource="{Binding Source={StaticResource platforms}}"/> </Grid> Here's the code for the main window: public partial class MainWindow : Window { ObservableCollection<Platform> m_platforms; public MainWindow() { m_platforms = new ObservableCollection<Platform>(); m_platforms.Add(new Platform("PC")); InitializeComponent(); } public ObservableCollection<Platform> Platforms { get { return m_platforms; } set { m_platforms = value; } } } Here's the Platform class: public class Platform { private string m_name; private bool m_selected; public Platform(string name) { m_name = name; m_selected = false; } public string Name { get { return m_name; } set { m_name = value; } } public bool Selected { get { return m_selected; } set { m_selected = value; } } } This all compiles and runs fine but the list box displays with nothing in it. If I put a breakpoint on the get method of Platforms, it doesn't get called. I don't understand as Platforms is what the XAML should be connecting to!

  Read the article

• SOAP WCF Webservice behaves differently when called locally or remotely

  - by Idriss

  I have a WCF SOAP 1.1 Webservice with the configuration specified below. A concurrent call to any method of this endpoint hangs until the other returns when called remotely (from another computer on the network). I cannot replicate this when these methods are called locally (with a client located on the same machine). I tried to increase the maxConcurrentCalls with no luck ... the service behavior seems to be different according to the client local/remote location. Any guess? Thanks, <?xml version="1.0" encoding="utf-8"?> <configuration> <system.serviceModel> <services> <service behaviorConfiguration="MyCustomBehavior" name="CONTOSO.CONTOSOServerApi.IContosoServiceApiImplV1"> <endpoint address="" binding="customBinding" bindingConfiguration="WebBinding" bindingNamespace="http://contoso.com" contract="CONTOSO.CONTOSOServerApiInterfaceV1.IContosoServiceApiV1" /> </service> </services> <behaviors> <serviceBehaviors> <behavior name="MyCustomBehavior"> <serviceMetadata httpGetEnabled="true" httpGetUrl="http://localhost:8080/MyEndPointV1" /> <serviceDebug httpHelpPageEnabled="false" includeExceptionDetailInFaults="true" /> <serviceThrottling maxConcurrentSessions="10000" maxConcurrentCalls="1000"/> <dataContractSerializer maxItemsInObjectGraph="2147483647" /> </behavior> </serviceBehaviors> </behaviors> <bindings> <customBinding> <binding name="WebBinding"> <textMessageEncoding messageVersion="Soap11" maxReadPoolSize="2147483647" maxWritePoolSize="2147483647"> <readerQuotas maxDepth="2147483647" maxStringContentLength="2147483647" maxArrayLength="2147483647" maxBytesPerRead="2147483647" maxNameTableCharCount="2147483647" /> </textMessageEncoding> <httpsTransport /> </binding> </customBinding> </bindings> </system.serviceModel> </configuration>

  Read the article

• jframe adding own design jinternal frame error

  - by Van Minh

  I designed a title bar color on my JInternal frame. Then I took attempt to add it to my JFrame, but I cannot. Here is the code of my title bar: public class MyIFtitleBar extends BasicInternalFrameTitlePane { public MyIFtitleBar(JInternalFrame jif) { super(jif); } protected void paintTitleBackground(Graphics g){ g.setColor(Color.pink); g.fillRect(0, 0, getWidth(), getHeight()); } } Here is my JInternal frame. I tried running it in its psvm method, that worked! public class FitnessProg_Frame extends javax.swing.JInternalFrame { public FitnessProg_Frame() { initComponents(); this.setUI(new BasicInternalFrameUI(this){ @Override protected JComponent createNorthPane(JInternalFrame jif) { return new MyIFtitleBar(jif); } }); } @SuppressWarnings("unchecked") private void initComponents() { setBackground(new java.awt.Color(255, 255, 255)); setBorder(new javax.swing.border.MatteBorder(null)); setTitle("Fitness Progarm"); setPreferredSize(new java.awt.Dimension(507, 304)); pack(); } } But when I add it to my JFrame I get an error: Exception in thread "AWT-EventQueue-0" java.lang.NullPointerException Here is my JFrame code: public class NewJFrame extends javax.swing.JFrame { public NewJFrame() { initComponents(); FitnessProg_Frame ff = new FitnessProg_Frame(); ff.setVisible(true); mydes.add(ff); // this line made errors } @SuppressWarnings("unchecked") private void initComponents() { mydes = new javax.swing.JDesktopPane(); setDefaultCloseOperation(javax.swing.WindowConstants.EXIT_ON_CLOSE); javax.swing.GroupLayout mydesLayout = new javax.swing.GroupLayout(mydes); mydes.setLayout(mydesLayout); mydesLayout.setHorizontalGroup( mydesLayout.createParallelGroup(javax.swing.GroupLayout.Alignment.LEADING) .addGap(0, 400, Short.MAX_VALUE) ); mydesLayout.setVerticalGroup( mydesLayout.createParallelGroup(javax.swing.GroupLayout.Alignment.LEADING) .addGap(0, 300, Short.MAX_VALUE) ); getContentPane().add(mydes, java.awt.BorderLayout.CENTER); pack(); } public static void main(String args[]) { try { for (javax.swing.UIManager.LookAndFeelInfo info : javax.swing.UIManager.getInstalledLookAndFeels()) { if ("Nimbus".equals(info.getName())) { javax.swing.UIManager.setLookAndFeel(info.getClassName()); break; } } } catch (ClassNotFoundException ex) { java.util.logging.Logger.getLogger(NewJFrame.class.getName()).log(java.util.logging.Level.SEVERE, null, ex); } catch (InstantiationException ex) { java.util.logging.Logger.getLogger(NewJFrame.class.getName()).log(java.util.logging.Level.SEVERE, null, ex); } catch (IllegalAccessException ex) { java.util.logging.Logger.getLogger(NewJFrame.class.getName()).log(java.util.logging.Level.SEVERE, null, ex); } catch (javax.swing.UnsupportedLookAndFeelException ex) { java.util.logging.Logger.getLogger(NewJFrame.class.getName()).log(java.util.logging.Level.SEVERE, null, ex); } java.awt.EventQueue.invokeLater(new Runnable() { public void run() { new NewJFrame().setVisible(true); } }); } private javax.swing.JDesktopPane mydes; }

  Read the article

• Catching error caused by InitialContext.lookup

  - by Martin Schröder

  I'm developing a command line client (Java SE6) that now needs to talk to a Glassfish 2.1 server. The code for setting up this connection is try { final InitialContext context = new InitialContext(); final String ejbName = GeneratorCancelledRemote.class.getName(); generatorCancelled = (GeneratorCancelledRemote) context.lookup(ejbName); } catch (Throwable t) { System.err.println("--> Could not call server:"); t.printStackTrace(System.err); runWithOutEJB = true; } I'm now testing it without a running server and the client (when run from Eclipse 4.2) just bombs with 31.10.2012 10:40:09 com.sun.corba.ee.impl.transport.SocketOrChannelConnectionImpl WARNUNG: "IOP00410201: (COMM_FAILURE) Connection failure: socketType: IIOP_CLEAR_TEXT; hostname: localhost; port: 3700" org.omg.CORBA.COMM_FAILURE: vmcid: SUN minor code: 201 completed: No at com.sun.corba.ee.impl.logging.ORBUtilSystemException.connectFailure(ORBUtilSystemException.java:2783) at com.sun.corba.ee.impl.logging.ORBUtilSystemException.connectFailure(ORBUtilSystemException.java:2804) at com.sun.corba.ee.impl.transport.SocketOrChannelConnectionImpl.(SocketOrChannelConnectionImpl.java:261) at com.sun.corba.ee.impl.transport.SocketOrChannelConnectionImpl.(SocketOrChannelConnectionImpl.java:274) at com.sun.corba.ee.impl.transport.SocketOrChannelContactInfoImpl.createConnection(SocketOrChannelContactInfoImpl.java:130) at com.sun.corba.ee.impl.protocol.CorbaClientRequestDispatcherImpl.beginRequest(CorbaClientRequestDispatcherImpl.java:192) at com.sun.corba.ee.impl.protocol.CorbaClientDelegateImpl.request(CorbaClientDelegateImpl.java:184) at com.sun.corba.ee.impl.protocol.CorbaClientDelegateImpl.is_a(CorbaClientDelegateImpl.java:328) at org.omg.CORBA.portable.ObjectImpl._is_a(ObjectImpl.java:112) at org.omg.CosNaming.NamingContextHelper.narrow(NamingContextHelper.java:69) at com.sun.enterprise.naming.SerialContext.narrowProvider(SerialContext.java:134) at com.sun.enterprise.naming.SerialContext.getCachedProvider(SerialContext.java:259) at com.sun.enterprise.naming.SerialContext.getRemoteProvider(SerialContext.java:204) at com.sun.enterprise.naming.SerialContext.getProvider(SerialContext.java:159) at com.sun.enterprise.naming.SerialContext.lookup(SerialContext.java:409) at javax.naming.InitialContext.lookup(InitialContext.java:392) at com.werkii.latex.generator.Generator.main(Generator.java:344) Caused by: java.lang.RuntimeException: java.net.ConnectException: Connection refused: connect at com.sun.enterprise.iiop.IIOPSSLSocketFactory.createSocket(IIOPSSLSocketFactory.java:347) at com.sun.corba.ee.impl.transport.SocketOrChannelConnectionImpl.(SocketOrChannelConnectionImpl.java:244) ... 14 more Caused by: java.net.ConnectException: Connection refused: connect at sun.nio.ch.Net.connect(Native Method) at sun.nio.ch.SocketChannelImpl.connect(SocketChannelImpl.java:532) at com.sun.corba.ee.impl.orbutil.ORBUtility.openSocketChannel(ORBUtility.java:105) at com.sun.enterprise.iiop.IIOPSSLSocketFactory.createSocket(IIOPSSLSocketFactory.java:332) ... 15 more It's o.k. for now (while I'm still in development) that it bombs, but it does this repeatedly and the catch clause is never reached (even though I'm catching Throwable) - the message is not printed. So how can I handle connection errors during lookup in my program?

  Read the article

• deallocated memory in tableview: message sent to deallocated instance

  - by Kirn

  I tried looking up other issues but couldn't find anything to match so here goes: I'm trying to display text in the table view so I use this bit of code: // StockData is an object I created and it pulls information from Yahoo APIs based on // a stock ticker stored in NSString *heading NSArray* tickerValues = [heading componentsSeparatedByString:@" "]; StockData *chosenStock = [[StockData alloc] initWithContents:[tickerValues objectAtIndex:0]]; [chosenStock getData]; // Set up the cell... NSDictionary *tempDict = [chosenStock values]; NSArray *tempArr = [tempDict allValues]; cell.textLabel.text = [tempArr objectAtIndex:indexPath.row]; return cell; This is all under cellForRowAtIndexPath When I try to release the chosenStock object though I get this error: [CFDictionary release]: message sent to deallocated instance 0x434d3d0 Ive tried using NSZombieEnabled and Build and Analyze to detect problems but no luck thus far. Ive even gone so far as to comment bits and pieces of the code with NSLog but no luck. I'll post the code for StockData below this. As far as I can figure something is getting deallocated before I do the release but I'm not sure how. The only place I've got release in my code is under dealloc method call. Here's the StockData code: // StockData contains all stock information pulled in through Yahoo! to be displayed @implementation StockData @synthesize ticker, values; - (id) initWithContents: (NSString *)newName { if(self = [super init]){ ticker = newName; } return self; } - (void) getData { NSURL *url = [NSURL URLWithString: [NSString stringWithFormat:@"http://download.finance.yahoo.com/d/quotes.csv?s=%@&f=%@&e=.csv", ticker, @"chgvj1"]]; NSError *error; NSURLResponse *response; NSURLRequest *request = [NSURLRequest requestWithURL:url]; NSData *stockData = [NSURLConnection sendSynchronousRequest:request returningResponse:&response error:&error]; if(stockData) { NSString *tempStr = [[NSString alloc] initWithData:stockData encoding:NSASCIIStringEncoding]; NSArray *receivedValuesArr = [tempStr componentsSeparatedByString:@","]; [tempStr release]; values = [NSDictionary dictionaryWithObjects:receivedValuesArr forKeys:[@"change, high, low, volume, market" componentsSeparatedByString:@", "]]; } else { NSLog(@"Connection failed: %@", error); } } - (void)dealloc { [ticker release]; [values release]; [super dealloc]; NSLog(@"Release took place fine"); } @end

  Read the article

• how to count checked checkboxes in different divs

  - by KMKMAHESH

  <head><title>STUDENT WISE EXAM BACKLOGS DISPLAY FOR EXAM REGISTRATION</title> <style type="text/css"> th { font-family:Arial; color:black; border:1px solid #000; } thead { display:table-header-group; } tbody { display:table-row-group; } td { border:1px solid #000; } </style> <script type="text/javascript" > function check_value(year,sem){ ysem="ys"+year+sem; var reg=document.registration.regulation.value; subjectsys="subjects"+year+sem; amountsys="amount"+year+sem; if(year==1){ if(sem==1){ var value_list = document.getElementById("ys11").getElementsByTagName('input'); } if(sem==2){ var value_list = document.getElementById("ys12").getElementsByTagName('input'); } }elseif(year==2){ if(sem==1){ var value_list = document.getElementById("ys21").getElementsByTagName('input'); } if(sem==2){ var value_list = document.getElementById("ys22").getElementsByTagName('input'); } }elseif(year==3){ if(sem==1){ var value_list = document.getElementById("ys31").getElementsByTagName('input'); } if(sem==2){ var value_list = document.getElementById("ys32").getElementsByTagName('input'); } }elseif(year==4){ if(sem==1){ var value_list = document.getElementById("ys41").getElementsByTagName('input'); } if(sem==2){ var value_list = document.getElementById("ys42").getElementsByTagName('input'); } } values = 0; for (var i=0; i<value_list.length; i++){ if (value_list[i].checked) { values=values+1; } } document.getElementById(subjectsys).value=values; if (values=="0") { document.getElementById(amountsys).innerHTML=""; return; } if (window.XMLHttpRequest) {// code for IE7+, Firefox, Chrome, Opera, Safari xmlhttp=new XMLHttpRequest(); } else {// code for IE6, IE5 xmlhttp=new ActiveXObject("Microsoft.XMLHTTP"); } xmlhttp.onreadystatechange=function() { if (xmlhttp.readyState==4 && xmlhttp.status==200) { document.getElementById(amountsys).innerHTML=xmlhttp.responseText; } } xmlhttp.open("GET","fee.php?year="+year+"&reg="+reg+"&sem="+sem+"&sub="+values,true); xmlhttp.send(); } </script> </head> <form id="registration" name="registration" action=subverify.php method=POST></br></br> <center> Backlog Subjects for <b>08KN1A1219</b> </br></br> <table border='1'><tr> <th width='40'>&nbsp;</th><th width='90'>Regulation</th><th width='40'>Year</th> <th width='40'>Sem</th><th width='350'>Subname</th> <th width='70'>Internals</th><th width='70'>Externals</th> </tr><div id="ys41"><tr> <td width='40'><center><input type="checkbox" name="sub[]" value="344" onclick="check_value(4,1)"></center></td> <td width='90'><center>R07</center></td><td width='40'><center>4</center></td><td width='40'><center>1</center></td> <td width='350'>EMBEDDED SYSTEMS</td><td width='70'><center>18</center></td> <td width='70'><center>17</center></td></tr><tr><td colspan=5 align=right><b>Subjects: </b><input size=2 type=textbox id=subjects41 name=subjects41 value=0 maxlength=2 readonly=readonly></td> <td align=right><b>Amount :</b></td> <input type='hidden' name='regulation' id=regulationsubjects41 value='R07'> <td><div id="amount41"><input type="textbox" name="amountval41" value="0" size="5" maxlength="5" readonly="readonly"></div></td></tr></div><div id="ys42"><tr> <td width='40'><center><input type="checkbox" name="sub[]" value="527" onclick="check_value(4,2)"></center></td> <td width='90'><center>R07</center></td><td width='40'><center>4</center></td><td width='40'><center>2</center></td> <td width='350'>DESIGN PATTERNS</td><td width='70'><center>12</center></td> <td width='70'><center>14</center></td></tr><tr><td colspan=5 align=right><b>Subjects: </b><input size=2 type=textbox id=subjects42 name=subjects42 value=0 maxlength=2 readonly=readonly></td> <td align=right><b>Amount :</b></td> <input type='hidden' name='regulation' id=regulationsubjects42 value='R07'> <td><div id="amount42"><input type="textbox" name="amountval42" value="0" size="5" maxlength="5" readonly="readonly"></div></td></tr></div><tr><td colspan=7><center><b><div id="maintotal"><input type="textbox" name="maintotal" value="0" size="5" maxlength="5" readonly="readonly"></div></center></b></td></tr><tr></tr></table></br></br> <center><input type='hidden' name='htno' value='08KN1A1219'> <input type='submit' value='Register'></center></form></br> this is a output of a php file with using dynamic data in the form i want to count only the checkboxes in the div and it has to display in that subjectsdiv like subjects41 and subjects42 can any one please help me to update this javascript it passes some ajax request for displaying the fee

  Read the article

• How to tag photos in facebook-api?

  - by Camillo

  Hey, I wanted to ask if/how is it possible to tag a photo using the FB API (Graph or REST). I've managed to create an album and also to upload a photo in it, but I stuck on tagging. I've got the permissions and the correct session key. My code until now: try { $uid = $facebook->getUser(); $me = $facebook->api('/me'); $token = $session['access_token'];//here I get the token from the $session array $album_id = $album[0]; //upload photo $file= 'images/hand.jpg'; $args = array( 'message' => 'Photo from application', ); $args[basename($file)] = '@' . realpath($file); $ch = curl_init(); $url = 'https://graph.facebook.com/'.$album_id.'/photos?access_token='.$token; curl_setopt($ch, CURLOPT_URL, $url); curl_setopt($ch, CURLOPT_HEADER, false); curl_setopt($ch, CURLOPT_RETURNTRANSFER, true); curl_setopt($ch, CURLOPT_POST, true); curl_setopt($ch, CURLOPT_POSTFIELDS, $args); $data = curl_exec($ch); //returns the id of the photo you just uploaded print_r(json_decode($data,true)); $search = array('{"id":', "}"); $delete = array("", ""); // picture id call with $picture $picture = str_replace($search, $delete, $data); //here should be the photos.addTag, but i don't know how to solve this //above code works, below i don't know what is the error / what's missing $json = 'https://api.facebook.com/method/photos.addTag?pid='.urlencode($picture).'&tag_text=Test&x=50&y=50&access_token='.urlencode($token); $ch = curl_init(); $url = $json; curl_setopt($ch, CURLOPT_URL, $url); curl_setopt($ch, CURLOPT_HEADER, false); curl_setopt($ch, CURLOPT_RETURNTRANSFER, true); curl_setopt($ch, CURLOPT_POST, true); curl_exec($ch); } catch(FacebookApiException $e){ echo "Error:" . print_r($e, true); } I really searched a long time, if you know something that might help me, please post it here :) Thanks for all your help, Camillo

  Read the article

• PHP - JSON Steam API query

  - by Hunter

  First time using "JSON" and I've just been working away at my dissertation and I'm integrating a few features from the steam API.. now I'm a little bit confused as to how to create arrays. function test_steamAPI() { $api = ('http://api.steampowered.com/ISteamUser/GetPlayerSummaries/v0002/?key='.get_Steam_api().'&steamids=76561197960435530'); $test = decode_url($api); var_dump($test['response']['players'][0]['personaname']['steamid']); } //Function to decode and return the data. function decode_url($url) { $decodeURL = $url; $data = file_get_contents($url); $data_output = json_decode($data, true); return $data_output; } So ea I've wrote a simple method to decode Json as I'll be doing a fair bit.. But just wondering the best way to print out arrays.. I can't for the life of me get it to print more than 1 element without it retunring an error e.g. Warning: Illegal string offset 'steamid' in /opt/lampp/htdocs/lan/lan-includes/scripts/class.steam.php on line 48 string(1) "R" So I can print one element, and if I add another it returns errors. EDIT -- Thanks for help, So this was my solution: function test_steamAPI() { $api = ('http://api.steampowered.com/ISteamUser/GetPlayerSummaries/v0002/?key='.get_Steam_api().'&steamids=76561197960435530,76561197960435530'); $data = decode_url($api); foreach($data ['response']['players'] as $player) { echo "Steam id:" . $player['steamid'] . "\n"; echo "Community visibility :" . $player['communityvisibilitystate'] . "\n"; echo "Player profile" . $player['profileurl'] ."\n"; } } //Function to decode and return the data. function decode_url($url) { $decodeURL = $url; $json = file_get_contents($decodeURL); $data_output = json_decode($json, true); return $data_output; } Worked this out by taking a look at the data.. and a couple json examples, this returns an array based on the Steam API URL (It works for multiple queries.... just FYI) and you can insert loops inside for items etc.. (if anyone searches for this).

  Read the article

• Google Maps rendering locally but not in live environment

  - by marcusstarnes

  I have a page that renders a simple google map for a specified location. This map renders without any problems at all when I run it locally on localhost, however, when I deploy this code to our live web servers (using our LIVE google API key for the appropriate domain) it fails to render, and upon putting a series of alerts within the javascript on the page, it appears that the 'Initialize' method (which should be called within body onLoad) is not being called. When I view the HTML source that is rendered on the live server it appears exactly as per the local version of the site (including the call to initialize() within the body onLoad event), albeit with the different maps API key. I have output the host (alert(window.location.host);) to ensure that the key I generated via the google maps api site, corresponds exactly to the live server, which it does. Does anyone have any ideas why it would be working locally but not when deployed to the live servers? The live site is hosted on 2 load-balanced web servers. This is the javascript that is rendered: <script src="http://maps.google.com/maps?file=api&amp;v=2&amp;sensor=false&amp;key=ABQIAAAA-BU8POZj19wRlTaKIXVM9xTz76xxk4yAELG9u79oXrhnLTB5NRRvAZ-bkKn1x8J68nfRTVOIWNPJEA" type="text/javascript"></script> <script type="text/javascript"> var map; var geocoder; alert(window.location.host); function initialize() { if (GBrowserIsCompatible()) { map = new GMap2(document.getElementById("businessMap")); map.setUIToDefault(); geocoder = new GClientGeocoder(); showAddress('St Margarets Street SW1P 3 London'); } } function showAddress(address) { geocoder.getLatLng( address, function(point) { if (!point) { // Address could not be located. jQuery('#googleMap').hide(); } else { map.setCenter(point, 13); var marker = new GMarker(point); map.addOverlay(marker); var html = 'Address info for the marker'; marker.openInfoWindow(html); GEvent.addListener(marker, "click", function() { marker.openInfoWindowHtml(html); }); } } ); } </script> Any help would be much appreciated. Thanks.

  Read the article

• JSON object array to store data of a form in local storage temporary (PhoneGap project)

  - by Nadeesha

  I am building a data aqusition system using PhoneGap. .I am trying to store my form data temporary on local storage using JSON,Data should be visible after I close and reopen the application (after pressing Get Data button),But after I close it only the lastly entered record is visible This is my code <!DOCTYPE html> <html> <head> <title>Household Profile DB storage</title> <meta charset="utf-8"> <meta name="viewport" content="user-scalable=no, initial-scale=1, maximum-scale=1, minimum-scale=1,width=device-width" /> <link rel="stylesheet" href="jquery.mobile-1.4.2/jquery.mobile-1.4.2.min.css"> <link rel="stylesheet" href="css/table.css"> <script type="text/javascript" src="js/jquery-1.9.1.min.js"></script> <script type="text/javascript" src="jquery.mobile-1.4.2/jquery.mobile-1.4.2.min.js"></script> <script type="text/javascript" src="js/iscroll.js"></script> <script type="text/javascript" charset="utf-8"> function onDeviceReady() { persistData(homeId,owner,gramaND,contactNo,address,race); } function saveLocal(form){ if (window.localStorage) { var fhomeId = form.homeId.value, fowner = form.owner.value, fgramaND = form.gramaND.value, fcontactNo= form.contactNo.value, faddress = form.address.value, frace = form.race.value; alert("hi"); var highscores = [{"homeId": fhomeId, "owner":fowner, "gramaND":fgramaND, "contactNo":fcontactNo, "address":faddress, "race":frace}]; localStorage.setItem("highscores",JSON.stringify(highscores)); alert("The data has been stored successfully."); } else { alert("Your Browser does not support LocalStorage."); } } function readLocal(){ if (window.localStorage) { var scores =[]; //Get the highscores object scores = localStorage.getItem("highscores"); scores = JSON.parse(scores); for (i=0;i<scores.length;i++){ var text = "homeId :"+scores[i].homeId +"<br>"+ "owner:"+ scores[i].owner+"<br>"+ "address"+scores[i].address +"<br>"+ "gramaND"+scores[i].gramaND +"<br>"+ "contactNo"+scores[i].contactNo+"<br>" + '<Button value="DELETE" onclick="'+scores.splice(i, 0)+'><>/Button>'; var tbodyx = document.getElementsByTagName("tbody"); var tr=document.createElement("TR"); var td=document.createElement("TD"); td.innerHTML = text; tr.appendChild(td); tbody.appendChild(tr); } } } </script> </head> <body> <div data-role="page" id="page1"> <!--/header--> <div data-role="header" data-position="inline" data-theme="b"> <a href="#" data-icon="back" data-rel="back" title="Go back">Back</a> <h1>Household Profile</h1> <a href="index.html" data-icon="home">Menu</a> </div> <!--/header--> <div id="wrapper"> <form id="userInput" action ="" method="GET"> <div data-role="content"> <div data-role="fieldcontain"> <label > Home ID </label> <input class="inputClass" id="homeId" placeholder="H0001" value="" data-mini="true" type="text"> </div> <div data-role="fieldcontain"> <label > Owner </label> <input class="inputClass" id="owner" placeholder="Aberathne" value="" type="text"> </div> <div data-role="fieldcontain"> <label class="select">GramaNiladhari Division</label> <select class="inputClass" id="gramaND"> <option value="GramaNiladhari Division 1">GramaNiladhari Division 1</option> <option value="GramaNiladhari Division 2">GramaNiladhari Division 2</option> <option value="GramaNiladhari Division 3">GramaNiladhari Division 3</option> <option value="GramaNiladhari Division 4">GramaNiladhari Division 4</option> </select> </div> <div data-role="fieldcontain"> <label > Contact No </label> <input class="inputClass" id="contactNo" placeholder="071-9545-073" value="" type="number"> </div> <div data-role="fieldcontain"> <label >Address:</label> <textarea cols="40" rows="8" class="inputClass" id="address"></textarea> </div> <div class="ui-block-a"><button type="submit" data-theme="d">Location in a Map</button></div> <div data-role="fieldcontain"> <label >Race</label> <select class="inputClass" id="race"> <option value=" Sinhalese"> Sinhalese</option> <option value=" Sri Lanka Tamils"> Sri Lanka Tamils</option> <option value=" Moors"> Moors</option> <option value=" Indian Tamils "> Indian Tamils </option> <option value=" Malays "> Malays </option> <option value=" Burghers "> Burghers </option> </select> </div> <input class="buttonClass" type="button" value="Insert Data" onclick="saveLocal(this.form);"> </div> </form> </div> <input class="buttonClass" type="button" value="get Data" onclick="readLocal();"> <!-- <p id="dhomeId"></p> <p id="downer"></p> <p id="dgramaND"></p> <p id="dcontactNo"></p> <p id="daddress"></p> <p id="drace"></p>--> <table border="1"> <tbody id="tbody"> <tr><td>test1</td></tr> <tr><td>test2</td></tr> </tbody> </table> </div> </body> </html> Also I need to expand my code to edit and delete record from local storage.

  Read the article

< Previous Page | 1534 1535 1536 1537 1538 1539 1540 1541 1542 1543 1544 1545  | Next Page >