Search Results

Search found 8391 results on 336 pages for 'partial hash arguments'.

Page 155/336 | < Previous Page | 151 152 153 154 155 156 157 158 159 160 161 162  | Next Page >

  • how get fully result from Asynchronism communication?

    - by rima
    Hi all refer to these post : here1 and here2 at last I solve my problem by build a asynchronous solution,and it work well!!! but there is a problem that i face with it,now my code is like this: class MyProcessStarter { private Process process; private StreamWriter myStreamWriter; private static StringBuilder shellOutput = null; public String GetShellOutput { get { return shellOutput.ToString(); }} public MyProcessStarter(){ shellOutput = new StringBuilder(""); process = new Process(); process.StartInfo.FileName = "sqlplus"; process.StartInfo.UseShellExecute = false; process.StartInfo.CreateNoWindow = true; process.OutputDataReceived += new DataReceivedEventHandler(ShellOutputHandler); process.StartInfo.RedirectStandardInput = true; process.StartInfo.RedirectStandardOutput = true; //process.StartInfo.RedirectStandardError = true; process.Start(); myStreamWriter = process.StandardInput; process.BeginOutputReadLine(); } private static void ShellOutputHandler(object sendingProcess,DataReceivedEventArgs outLine) { if (!String.IsNullOrEmpty(outLine.Data)) shellOutput.Append(Environment.NewLine + outLine.Data); } public void closeConnection() { myStreamWriter.Close(); process.WaitForExit(); process.Close(); } public void RunCommand(string arguments) { myStreamWriter.WriteLine(arguments); myStreamWriter.Flush(); process.WaitForExit(100); Console.WriteLine(shellOutput); Console.WriteLine("============="+Environment.NewLine); process.WaitForExit(2000); Console.WriteLine(shellOutput); } } and my input is like this: myProcesStarter.RunCommand("myusername/mypassword"); Console.writeline(myProcesStarter.GetShellOutput); but take a look at my out put: SQL*Plus: Release 11.1.0.6.0 - Production on Thu May 20 11:57:38 2010 Copyright (c) 1982, 2007, Oracle. All rights reserved. ============= SQL*Plus: Release 11.1.0.6.0 - Production on Thu May 20 11:57:38 2010 Copyright (c) 1982, 2007, Oracle. All rights reserved. Enter user-name: Connected to: Oracle Database 11g Enterprise Edition Release 11.1.0.6.0 - Production With the Partitioning, OLAP, Data Mining and Real Application Testing options as u see the output for run a function is not same in different time!So now would you do me a faver and help me that how I can wait until all the output done in other mean how I can customize my process to wait until output finishing ?? because I want to write a sqlcompiler so I need the exact output of shell. plz help me soon.thanxxxxxxxxxxxx :X

    Read the article

  • Good policy to force all developers in a company to use the same IDE?

    - by Henrik
    In my organization they are thinking about rolling out Eclipse company wide but I prefer using another editor (UltraEdit). I do not have any good arguments against this except subjective opinions that a developer should get to use whatever he/she wants as long as he's productive enough. This to make the developer a happy employee :-) Do you guys think its a good policy to force all developers in the same company to use the same IDE? Would there be any technical (dis)advantages of this decision?

    Read the article

  • Start a git commit message with a hashmark (#)

    - by knittl
    Git treats lines starting with # as comment lines when committing. this is very annoying when working with a ticket tracking system, and trying to write the ticket number at the beginning of the line, e.g. #123 salt hashed passwords git will simply remove the line from the commit message. is there any way to escape the hash? i tried \ and !, but nothing works. whitespaces before # are preserved, so they aren't a working solution to the problem either.

    Read the article

  • Passing BLOB/CLOB as parameter to PL/SQL function

    - by Ula Krukar
    I have this procedure i my package: PROCEDURE pr_export_blob( p_name IN VARCHAR2, p_blob IN BLOB, p_part_size IN NUMBER); I would like for parameter p_blob to be either BLOB or CLOB. When I call this procedure with BLOB parameter, everything is fine. When I call it with CLOB parameter, I get compilation error: PLS-00306: wrong number or types of arguments in call to 'pr_export_blob' Is there a way to write a procedure, that can take either of those types as parameter? Some kind of a superclass maybe?

    Read the article

  • Running Java CORBA Client on Unix

    - by Benny
    I'm trying to run a Java application I wrote to subscribe to a CORBA event service. It runs OK on my Windows machine, but as soon as I deploy it to the UNIX server, it gives me an org.omg.CORBA.NO_IMPLEMENT exception. Any ideas as to why this might be happening? I'm using JacORB on my Windows machine and passing VM arguments to initialize the client ORB, but I'm not sure how to do that on UNIX and if it's even necessary. Thanks in advance!

    Read the article

  • mounting ext4 fs with block size of 65536

    - by seaquest
    I am doing some benchmarking on EXT4 performance on Compact Flash media. I have created an ext4 fs with block size of 65536. however I can not mount it on ubuntu-10.10-netbook-i386. (it is already mounting ext4 fs with 4096 bytes of block sizes) According to my readings on ext4 it should allow such big block sized fs. I want to hear your comments. root@ubuntu:~# mkfs.ext4 -b 65536 /dev/sda3 Warning: blocksize 65536 not usable on most systems. mke2fs 1.41.12 (17-May-2010) mkfs.ext4: 65536-byte blocks too big for system (max 4096) Proceed anyway? (y,n) y Warning: 65536-byte blocks too big for system (max 4096), forced to continue Filesystem label= OS type: Linux Block size=65536 (log=6) Fragment size=65536 (log=6) Stride=0 blocks, Stripe width=0 blocks 19968 inodes, 19830 blocks 991 blocks (5.00%) reserved for the super user First data block=0 1 block group 65528 blocks per group, 65528 fragments per group 19968 inodes per group Writing inode tables: done Creating journal (1024 blocks): done Writing superblocks and filesystem accounting information: done This filesystem will be automatically checked every 37 mounts or 180 days, whichever comes first. Use tune2fs -c or -i to override. root@ubuntu:~# tune2fs -l /dev/sda3 tune2fs 1.41.12 (17-May-2010) Filesystem volume name: <none> Last mounted on: <not available> Filesystem UUID: 4cf3f507-e7b4-463c-be11-5b408097099b Filesystem magic number: 0xEF53 Filesystem revision #: 1 (dynamic) Filesystem features: has_journal ext_attr resize_inode dir_index filetype extent flex_bg sparse_super large_file huge_file uninit_bg dir_nlink extra_isize Filesystem flags: signed_directory_hash Default mount options: (none) Filesystem state: clean Errors behavior: Continue Filesystem OS type: Linux Inode count: 19968 Block count: 19830 Reserved block count: 991 Free blocks: 18720 Free inodes: 19957 First block: 0 Block size: 65536 Fragment size: 65536 Blocks per group: 65528 Fragments per group: 65528 Inodes per group: 19968 Inode blocks per group: 78 Flex block group size: 16 Filesystem created: Sat Feb 5 14:39:55 2011 Last mount time: n/a Last write time: Sat Feb 5 14:40:02 2011 Mount count: 0 Maximum mount count: 37 Last checked: Sat Feb 5 14:39:55 2011 Check interval: 15552000 (6 months) Next check after: Thu Aug 4 14:39:55 2011 Lifetime writes: 70 MB Reserved blocks uid: 0 (user root) Reserved blocks gid: 0 (group root) First inode: 11 Inode size: 256 Required extra isize: 28 Desired extra isize: 28 Journal inode: 8 Default directory hash: half_md4 Directory Hash Seed: afb5b570-9d47-4786-bad2-4aacb3b73516 Journal backup: inode blocks root@ubuntu:~# mount -t ext4 /dev/sda3 /mnt/ mount: wrong fs type, bad option, bad superblock on /dev/sda3, missing codepage or helper program, or other error In some cases useful info is found in syslog - try dmesg | tail or so

    Read the article

  • Is there simple way how to join two RouteValueDictionary values to pass parameters to Html.ActionLin

    - by atagaew
    Hi. Look on my code that i created in a partial View: <% foreach (Customer customerInfo in Model.DataRows) {%> <tr> <td> <%=Html.ActionLink( customerInfo.FullName , ((string)ViewData["ActionNameForSelectedCustomer"]) , JoinParameters(customerInfo.id, (RouteValueDictionary) ViewData["AdditionalSelectionParameters"]) , null)%> </td> <td> <%=customerInfo.LegalGuardianName %> </td> <td> <%=customerInfo.HomePhone %> </td> <td> <%=customerInfo.CellPhone %> </td> </tr> <%}%> Here I'm building simple table that showing customer's details. As you may see, in each row, I'm trying to build a link that will redirect to another action. That action requires customerId and some additional parameters. Additional parameters are different for each page where this partial View is using. So, i decided to make Action methods to pass that additional parameters in the ViewData as RouteValueDictionary instance. Now, on the view i have a problem, i need to pass customerId and that RouteValueDictionary together into Html.ActionLink method. That makes me to figure out some way of how to combine all that params into one object (either object or new RouteValueDictionary instance) Because of the way the MVC does, i can't create create a method in the codebehind class (there is no codebihind in MVC) that will join that parameters. So, i used ugly way - inserted inline code: ...script runat="server"... private RouteValueDictionary JoinParameters(int customerId, RouteValueDictionary defaultValues) { RouteValueDictionary routeValueDictionary = new RouteValueDictionary(defaultValues); routeValueDictionary.Add("customerId", customerId); return routeValueDictionary; } ...script... This way is very ugly for me, because i hate to use inline code in the View part. My question is - is there any better way of how i can mix parameters passed from the action (in ViewData, TempData, other...) and the parameter from the view when building action links. May be i can build this link in other way ? Thanks!

    Read the article

  • Write a PLIST file in Groovy

    - by Joe Cannatti
    I have a Groovy application for Windows and am trying to convert a Hash object to an Apple plist file. What is the best way to go about this? Seems like this is something that must already be solved in Java but I can't seem to find any examples. Thanks in advance

    Read the article

  • Simulating "focus" and "blur" in jQuery .live() method...

    - by Jonathan Sampson
    Update: As of jQuery 1.4, $.live() now supports focusin and focusout events. jQuery currently1 doesn't support "blur" or "focus" as arguments for the $.live() method. What type of work-around could I implement to achieve the following: $("textarea") .live("focus", function() { foo = "bar"; }) .live("blur", function() { foo = "fizz"; }); 1. 07/29/2009, version 1.3.2

    Read the article

  • Memory Allocation Error in MySQL

    - by Chinjoo
    I am using MySql ODBC driver with .Net 3.5. I have created a stored procedure in MySQl which accepts around 15 parameters with types like datetime, varchar, Int32, Int64 etc.. When I run the SP from the query window with the arguments provided, it runs fine. But whwn I test using the .Net application, it gives exception with "Memory allocation error", MySQL native error code is 4001. Any help will be much appreciated.

    Read the article

  • How can I implement NotOfType<T> in LINQ that has a nice calling syntax?

    - by Lette
    I'm trying to come up with an implementation for NotOfType, which has a readable call syntax. NotOfType should be the complement to OfType<T> and would consequently yield all elements that are not of type T My goal was to implement a method which would be called just like OfType<T>, like in the last line of this snippet: public abstract class Animal {} public class Monkey : Animal {} public class Giraffe : Animal {} public class Lion : Animal {} var monkey = new Monkey(); var giraffe = new Giraffe(); var lion = new Lion(); IEnumerable<Animal> animals = new Animal[] { monkey, giraffe, lion }; IEnumerable<Animal> fewerAnimals = animals.NotOfType<Giraffe>(); However, I can not come up with an implementation that supports that specific calling syntax. This is what I've tried so far: public static class EnumerableExtensions { public static IEnumerable<T> NotOfType<T>(this IEnumerable<T> sequence, Type type) { return sequence.Where(x => x.GetType() != type); } public static IEnumerable<T> NotOfType<T, TExclude>(this IEnumerable<T> sequence) { return sequence.Where(x => !(x is TExclude)); } } Calling these methods would look like this: // Animal is inferred IEnumerable<Animal> fewerAnimals = animals.NotOfType(typeof(Giraffe)); and // Not all types could be inferred, so I have to state all types explicitly IEnumerable<Animal> fewerAnimals = animals.NotOfType<Animal, Giraffe>(); I think that there are major drawbacks with the style of both of these calls. The first one suffers from a redundant "of type/type of" construct, and the second one just doesn't make sense (do I want a list of animals that are neither Animals nor Giraffes?). So, is there a way to accomplish what I want? If not, could it be possible in future versions of the language? (I'm thinking that maybe one day we will have named type arguments, or that we only need to explicitly supply type arguments that can't be inferred?) Or am I just being silly?

    Read the article

  • Deterministic key serialization

    - by Mike Boers
    I'm writing a mapping class which uses SQLite as the storage backend. I am currently allowing only basestring keys but it would be nice if I could use a couple more types hopefully up to anything that is hashable (ie. same requirements as the builtin dict). To that end I would like to derive a deterministic serialization scheme. Ideally, I would like to know if any implementation/protocol combination of pickle is deterministic for hashable objects (e.g. can only use cPickle with protocol 0). I noticed that pickle and cPickle do not match: >>> import pickle >>> import cPickle >>> def dumps(x): ... print repr(pickle.dumps(x)) ... print repr(cPickle.dumps(x)) ... >>> dumps(1) 'I1\n.' 'I1\n.' >>> dumps('hello') "S'hello'\np0\n." "S'hello'\np1\n." >>> dumps((1, 2, 'hello')) "(I1\nI2\nS'hello'\np0\ntp1\n." "(I1\nI2\nS'hello'\np1\ntp2\n." Another option is to use repr to dump and ast.literal_eval to load. This would only be valid for builtin hashable types. I have written a function to determine if a given key would survive this process (it is rather conservative on the types it allows): def is_reprable_key(key): return type(key) in (int, str, unicode) or (type(key) == tuple and all( is_reprable_key(x) for x in key)) The question for this method is if repr itself is deterministic for the types that I have allowed here. I believe this would not survive the 2/3 version barrier due to the change in str/unicode literals. This also would not work for integers where 2**32 - 1 < x < 2**64 jumping between 32 and 64 bit platforms. Are there any other conditions (ie. do strings serialize differently under different conditions)? (If this all fails miserably then I can store the hash of the key along with the pickle of both the key and value, then iterate across rows that have a matching hash looking for one that unpickles to the expected key, but that really does complicate a few other things and I would rather not do it.) Any insights?

    Read the article

  • Python modify an xml file

    - by michele
    I have this xml model. link text So I have to add some node (see the text commented) to this file. How I can do it? I have writed this partial code but it doesn't work: xmldoc=minidom.parse(directory) child = xmldoc.createElement("map") for node in xmldoc.getElementsByTagName("Environment"): node.appendChild(child) Thanks in advance.

    Read the article

  • How to set the returnURL manually when using Ajax.ActionLink

    - by Roge
    I have this link @Ajax.ActionLink("create poll question", "CreatePoll", new { id = Model.DebateID }, new AjaxOptions { UpdateTargetId = "poll-entry-box", InsertionMode = InsertionMode.Replace, HttpMethod = "GET" }) which is pointing at a action with the [Authorize] Attribute. The login works, but the returnURL is empty so it just redirects to the index page. Is there some way to manually set the returnURL ? NOTE I am using the method described here http://haacked.com/archive/2011/10/04/prevent-forms-authentication-login-page-redirect-when-you-donrsquot-want.aspx because the login page was loading inside my partial.

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Facebook Like box and Like buttons return Error

    - by spartan
    I'm integrating FB social plugins - Like box and Like buttons (as iframes) - on a web page, but they don't work. When I click on Like in "Like box", I get "Error" text with link, which displays a message dialog "The page at https://www.facebook.com/provocateur.eu could not be reached.". JSON response is: for (;;);{"__ar":1,"payload":{"requires_login":false,"success":false,"already_connected":false,"is_admin":false,"show_error":true,"error_info":{"brief":"Website Inaccessible","full":"The page at https:\/\/www.facebook.com\/provocateur.eu could not be reached.","errorUri":"\/connect\/connect_to_node_error.php?title=Website+Inaccessible&body=The+page+at+https\u00253A\u00252F\u00252Fwww.facebook.com\u00252Fprovocateur.eu+could+not+be+reached.&hash=AQARp73z7huT0Eiu"}}} When I click on the Like button, the JSON response is: for (;;);{"__ar":1,"payload":{"requires_login":false,"success":false,"already_connected":false,"is_admin":false,"show_error":true,"error_info":{"brief":"An error occurred.","full":"There was an error liking the page. If you are the page owner, please try running your page through the linter on the Facebook devsite (https:\/\/developers.facebook.com\/tools\/lint\/) and fixing any errors.","errorUri":"\/connect\/connect_to_node_error.php?title=An+error+occurred.&body=There+was+an+error+liking+the+page.+If+you+are+the+page+owner\u00252C+please+try+running+your+page+through+the+linter+on+the+Facebook+devsite+\u002528https\u00253A\u00252F\u00252Fdevelopers.facebook.com\u00252Ftools\u00252Flint\u00252F\u002529+and+fixing+any+errors.&hash=AQAFI_8ieMUGPPxS"}}} This is the "Like box" iframe code: <iframe frameborder="0" scrolling="no" style="border:none; overflow:hidden; width:240px; height:70px;" src="//www.facebook.com/plugins/likebox.php?href=http%3A%2F%2Fwww.facebook.com%2Fprovocateur.eu&width=240&height=70&colorscheme=dark&show_faces=false&border_color&stream=false&header=true&appId=283499041689204"></iframe> and this is the "Like button" iframe code: <iframe frameborder="0" scrolling="no" style="border:none; overflow:hidden; width:203px; height:21px;" src="//www.facebook.com/plugins/like.php?href&amp;send=false&amp;layout=button_count&amp;width=203&amp;show_faces=false&amp;action=like&amp;colorscheme=light&amp;font=arial&amp;height=21&amp;appId=283499041689204"></iframe> The behaviour is the same for admin and non-admin visitors and for any browser. I created application with the same name as FB page with appId 283499041689204. Web page is XHTML transitional valid, and it contains no errors according FB debugger/linter. Formely there was age restriction (17+), but I removed it and for the moment it is accessible for anyone (13+). URL of web page: http://provocateur.eu/ URL of FB page: in the first error message Any help appriciated. Thanks in advance.

    Read the article

  • How to access a named element of a derived user control in silverlight ?

    - by Mrt
    Hello, I have a custom base user control in silverlight. <UserControl x:Class="Problemo.MyBaseControl" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" xmlns:d="http://schemas.microsoft.com/expression/blend/2008" xmlns:mc="http://schemas.openxmlformats.org/markup-compatibility/2006" mc:Ignorable="d" d:DesignHeight="300" d:DesignWidth="400"> <Grid x:Name="LayoutRoot" Background="White"> <Border Name="HeaderControl" Background="Red" /> </Grid> </UserControl> With the following code behind public partial class MyBaseControl : UserControl { public UIElement Header { get; set; } public MyBaseControl() { InitializeComponent(); Loaded += MyBaseControl_Loaded; } void MyBaseControl_Loaded(object sender, RoutedEventArgs e) { HeaderControl.Child = Header; } } I have a derived control. <me:MyBaseControl x:Class="Problemo.MyControl" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" xmlns:d="http://schemas.microsoft.com/expression/blend/2008" xmlns:mc="http://schemas.openxmlformats.org/markup-compatibility/2006" mc:Ignorable="d" xmlns:me="clr-namespace:Problemo" d:DesignHeight="300" d:DesignWidth="400"> <me:MyBaseControl.Header> <TextBlock Name="header" Text="{Binding Text}" /> </me:MyBaseControl.Header> </me:MyBaseControl> With the following code behind. public partial class MyControl : MyBaseControl { public string Text { get; set; } public MyControl(string text) { InitializeComponent(); Text = text; } } I'm trying to set the text value of the header textblock in the derived control. It would be nice to be able to set both ways, i.e. with databinding or in the derived control code behind, but neither work. With the data binding, it doesn't work. If I try in the code behind I get a null reference to 'header'. This is silverlight 4 (not sure if that makes a difference) Any suggestions on how to do with with both databinding and in code ? Cheers

    Read the article

  • Find the version of an installed npm package

    - by Laurent Couvidou
    How to find the local version of an installed node.js/npm package? This prints the version of npm itself: npm -v <package-name> This prints a cryptic error: npm version <package-name> For some reason, probably because of the weird arguments ordering, or because of the false positives mentioned above, I just can't remember the proper command. So this question is a note for self that might help others.

    Read the article

< Previous Page | 151 152 153 154 155 156 157 158 159 160 161 162  | Next Page >