Search Results

Search found 16680 results on 668 pages for 'long polling'.

Page 157/668 | < Previous Page | 153 154 155 156 157 158 159 160 161 162 163 164  | Next Page >

• How to store unlimited characters in Oracle 11g?

  - by vicky21

  We have a table in Oracle 11g with a varchar2 column. We use a proprietary programming language where this column is defined as string. Maximum we can store 2000 characters (4000 bytes) in this column. Now the requirement is such that the column needs to store more than 2000 characters (in fact unlimited characters). The DBAs don't like BLOB or LONG datatypes for maintenance reasons. The solution that I can think of is to remove this column from the original table and have a separate table for this column and then store each character in a row, in order to get unlimited characters. This tble will be joined with the original table for queries. Is there any better solution to this problem? UPDATE: The proprietary programming language allows to define variables of type string and blob, there is no option of CLOB. I understand the responses given, but I cannot take on the DBAs. I understand that deviating from BLOB or LONG will be developers' nightmare, but still cannot help it.

  Read the article

• How to use Java on Google App Engine without exceeding minute quotas?

  - by Geo

  A very simple java code inside a doGet() servlet is getting more than a second of cpu time on GAE. I have read some quota related documentation and apparently I am not doing anything wrong. //Request the user Agent info String userAgent = req.getHeader("User-Agent"); I wanted to know what was using the CPU the most, I use a google help recommendation. //The two lines below will get the CPU before requesting User-Agent Information QuotaService qs = QuotaServiceFactory.getQuotaService(); long start = qs.getCpuTimeInMegaCycles(); //Request the user Agent info String userAgent = req.getHeader("User-Agent"); //The three lines below will get the CPU after requesting User-Agent Information // and informed it to the application log. long end = qs.getCpuTimeInMegaCycles(); double cpuSeconds = qs.convertMegacyclesToCpuSeconds(end - start); log.warning("CPU Seconds on geting User Agent: " + cpuSeconds); The only thing that the code above tells me is that inspecting the header will use more than a second (1000ms) of cpu time, which for Google is a warning on the log panel. That seems to be a very simple request and still is using more than a second of cpu. What I am missing?

  Read the article

• ReaderWriterLockSlim and Pulse/Wait

  - by Jono

  Is there an equivalent of Monitor.Pulse and Monitor.Wait that I can use in conjunction with a ReaderWriterLockSlim? I have a class where I've encapsulated multi-threaded access to an underlying queue. To enqueue something, I acquire a lock that protects the underlying queue (and a couple of other objects) then add the item and Monitor.Pulse the locked object to signal that something was added to the queue. public void Enqueue(ITask task) { lock (mutex) { underlying.Enqueue(task); Monitor.Pulse(mutex); } } On the other end of the queue, I have a single background thread that continuously processes messages as they arrive on the queue. It uses Monitor.Wait when there are no items in the queue, to avoid unnecessary polling. (I consider this to be good design, but any flames (within reason) are welcome if they help me learn otherwise.) private void DequeueForProcessing(object state) { while (true) { ITask task; lock (mutex) { while (underlying.Count == 0) { Monitor.Wait(mutex); } task = underlying.Dequeue(); } Process(task); } } As more operations are added to this class (requiring read-only access to the lock protected underlying), someone suggested using ReaderWriterLockSlim. I've never used the class before, and assuming it can offer some performance benefit, I'm not against it, but only if I can keep the Pulse/Wait design.

  Read the article

• Can't iterate over a list class in Python

  - by Vicky

  I'm trying to write a simple GUI front end for Plurk using pyplurk. I have successfully got it to create the API connection, log in, and retrieve and display a list of friends. Now I'm trying to retrieve and display a list of Plurks. pyplurk provides a GetNewPlurks function as follows: def GetNewPlurks(self, since): '''Get new plurks since the specified time. Args: since: [datetime.datetime] the timestamp criterion. Returns: A PlurkPostList object or None. ''' offset = jsonizer.conv_datetime(since) status_code, result = self._CallAPI('/Polling/getPlurks', offset=offset) return None if status_code != 200 else \ PlurkPostList(result['plurks'], result['plurk_users'].values()) As you can see this returns a PlurkPostList, which in turn is defined as follows: class PlurkPostList: '''A list of plurks and the set of users that posted them.''' def __init__(self, plurk_json_list, user_json_list=[]): self._plurks = [PlurkPost(p) for p in plurk_json_list] self._users = [PlurkUser(u) for u in user_json_list] def __iter__(self): return self._plurks def GetUsers(self): return self._users def __eq__(self, other): if other.__class__ != PlurkPostList: return False if self._plurks != other._plurks: return False if self._users != other._users: return False return True Now I expected to be able to do something like this: api = plurk_api_urllib2.PlurkAPI(open('api.key').read().strip(), debug_level=1) plurkproxy = PlurkProxy(api, json.loads) user = plurkproxy.Login('my_user', 'my_pass') ps = plurkproxy.GetNewPlurks(datetime.datetime(2009, 12, 12, 0, 0, 0)) print ps for p in ps: print str(p) When I run this, what I actually get is: <plurk.PlurkPostList instance at 0x01E8D738> from the "print ps", then: for p in ps: TypeError: __iter__ returned non-iterator of type 'list' I don't understand - surely a list is iterable? Where am I going wrong - how do I access the Plurks in the PlurkPostList?

  Read the article

• Handling user interface in a multi-threaded application (or being forced to have a UI-only main thre

  - by Patrick

  In my application, I have a 'logging' window, which shows all the logging, warnings, errors of the application. Last year my application was still single-threaded so this worked [quite] good. Now I am introducing multithreading. I quickly noticed that it's not a good idea to update the logging window from different threads. Reading some articles on keeping the UI in the main thread, I made a communication buffer, in which the other threads are adding their logging messages, and from which the main thread takes the messages and shows them in the logging window (this is done in the message loop). Now, in a part of my application, the memory usage increases dramatically, because the separate threads are generating lots of logging messages, and the main thread cannot empty the communication buffer quickly enough. After the while the memory decreases again (if the other threads have finished their work and the main thread gradually empties the communication buffer). I solved this problem by having a maximum size on the communication buffer, but then I run into a problem in the following situation: the main thread has to perform a complex action the main thread takes some parts of the action and let's separate threads execute this while the seperate threads are executing their logic, the main thread processes the results from the other threads and continues with its work if the other threads are finished Problem is that in this situation, if the other threads perform logging, there is no UI-message loop, and so the communication buffer is filled, but not emptied. I see two solutions in solving this problem: require the main thread to do regular polling of the communication buffer only performing user interface logic in the main thread (no other logic) I think the second solution seems the best, but this may not that easy to introduce in a big application (in my case it performs mathematical simulations). Are there any other solutions or tips? Or is one of the two proposed the best, easiest, most-pragmatic solution? Thanks, Patrick

  Read the article

• Android: onListItemClick not opening up the .xml file

  - by Capsud

  Hi, public void onListItemClick(ListView l, View v, int position, long id) { if(position == 0){ setContentView(R.layout.cuisine); } } I have an array of Strings and i'm using the above method to try and open up a new xml file called 'cuisine' when it is clicked. but it keeps failing! Have I done this right, or what am I doing wrong? Thanks. Ok from looking at similar problems on the web, people have said to get the onListItemClick() to start a new activity and using that new activity to then open up the new view? So what i've done is this... protected void onListItemClick(ListView l, View v, int position, long id) { Intent dundrumIntent = new Intent(v.getContext(), DundrumSelector.class); dundrumIntent.putExtra("position", position); startActivityForResult(dundrumIntent, 0); } and then import android.app.Activity; import android.os.Bundle; public class DundrumSelector extends Activity { @Override public void onCreate(Bundle savedInstanceState){ super.onCreate(savedInstanceState); int position = getIntent().getExtras().getInt("position"); if(position == 0){ setContentView(R.layout.cuisine); } } } Yet i'm still getting the same problem. The program crashes when I click on an item in the listView. And yes i've added the activity to the manifest. Does anyone have a resolution to this as alot of people seem to be having the same problem. Thanks alot.

  Read the article

• Latex - Apply an operation to every character in a string

  - by hroest

  Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

  Read the article

• How can I get the type I want?

  - by Danny Chen

  There are a lot of such classes in my project (very old and stable code, I can't do many changes to them, maybe slight changes are OK) public class MyEntity { public long ID { get; set; } public string Name { get; set; } public decimal Salary { get; set; } public static GetMyEntity ( long ID ) { MyEntity e = new MyEntity(); // load data from DB and bind to this instance return e; } } For some reasons, now I need to do this: Type t = Type.GetType("XXX"); // XXX is one of the above classes' name MethodInfo staticM= t.GetMethods(BindingFlags.Public | BindingFlags.Static).FirstOrDefault();// I'm sure I can get the correct one var o = staticM.Invoke(...); //returns a object, but I want the type above! If I pass "MyEntity" at beginning, I hope I can get o as MyEntity! Please NOTE that I know the "name of the class" only. MyEntity e = staticM.Invoke(...) as MyEntity; can't be used here.

  Read the article

• trouble setting up anonymous login in ejabberd

  - by sofia

  Hi, In ejabberd.cfg I have the following {host_config, "thisislove-MacBook-2.local", [{auth_method, [internal, anonymous]}, {allow_multiple_connections, false}, {anonymous_protocol, both}]}. but when using speeqe javascript client (speeqe.com) to connect, I see it sends <body rid='1366284187' xmlns='http://jabber.org/protocol/httpbind' to='thisislove-macbook-2.local' xml:lang='en' wait='60' hold='1' window='5' content='text/xml; charset=utf-8' ver='1.6' xmpp:version='1.0' xmlns:xmpp='urn:xmpp:xbosh'/> and the server responds with <body xmlns='http://jabber.org/protocol/httpbind' sid='f89bf034b02fa6b884bb0c55be3f1f69e45e3866' wait='60' requests='2' inactivity='30' maxpause='120' polling='2' ver='1.8' from='thisislove-macbook-2.local' secure='true' authid='353072658' xmlns:xmpp='urn:xmpp:xbosh' xmlns:stream='http://etherx.jabber.org/streams' xmpp:version='1.0'><stream:features xmlns:stream='http://etherx.jabber.org/streams'><mechanisms xmlns='urn:ietf:params:xml:ns:xmpp-sasl'><mechanism>DIGEST-MD5</mechanism><mechanism>PLAIN</mechanism></mechanisms><register xmlns='http://jabber.org/features/iq-register'/></stream:features></body> Notice the mechanisms, DIGEST-MD5 & PLAIN. If I'm not mistaken it should have ANONYMOUS as a mechanism as well. So what happens is that speeqe simply terminates the connection. As such I'm thinking i must be missing something in the anonymous configuration or the muc config. In the mod_muc configg, I have {mod_muc, [ %%{host, "conference.@HOST@"}, {access, muc}, {access_create, muc}, {access_persistent, muc}, {access_admin, muc_admin}, {max_room_name, 190}, {max_room_desc, 190}, {max_users, 500} ]} So what am I missing? Thanks

  Read the article

• Spring + iBatis + Hessian caching

  - by ILya

  Hi. I have a Hessian service on Spring + iBatis working on Tomcat. I'm wondering how to cache results... I've made the following config in my sqlmap file: <sqlMap namespace="Account"> <cacheModel id="accountCache" type="MEMORY" readOnly="true" serialize="false"> <flushInterval hours="24"/> <flushOnExecute statement="Account.addAccount"/> <flushOnExecute statement="Account.deleteAccount"/> <property name="reference-type" value="STRONG" /> </cacheModel> <typeAlias alias="Account" type="domain.Account" /> <select id="getAccounts" resultClass="Account" cacheModel="accountCache"> fix all; select id, name, pin from accounts; </select> <select id="getAccount" parameterClass="Long" resultClass="Account" cacheModel="accountCache"> fix all; select id, name, pin from accounts where id=#id#; </select> <insert id="addAccount" parameterClass="Account"> fix all; insert into accounts (id, name, pin) values (#id#, #name#, #pin#); </insert> <delete id="deleteAccount" parameterClass="Long"> fix all; delete from accounts where id = #id#; </delete> </sqlMap> Then i've done some tests... I have a hessian client application. I'm calling getAccounts several times and after each call it's a query to DBMS. How to make my service to query DBMS only a first time (after server restart) getAccounts called and for the following calls to use a cache?

  Read the article

• How Can I Find a List of All Exceptions That a Given Library Function Throws in Python?

  - by b14ck

  Sorry for the long title, but it seems most descriptive for my question. Basically, I'm having a difficult time finding exception information in the official python documentation. For example, in one program I'm currently writing, I'm using the shutil libary's move function: from shutil import move move('somefile.txt', '/tmp/somefile.txt') That works fine, as long as I have write access to /tmp/, there is enough diskspace, and if all other requirements are satisfied. However, when writing generic code, it is often difficult to guarantee those factors, so one usually uses exceptions: from shutil import move try: move('somefile.txt', '/tmp/somefile.txt') except: print 'Move failed for some reason.' I'd like to actually catch the appropriate exceptions thrown instead of just catching everything, but I simply can't find a list of exceptions thrown for most python modules. Is there a way for me to see which exceptions a given function can throw, and why? This way I can make appropriate cases for each exception, eg: from shutil import move try: move('somefile.txt', '/tmp/somefile.txt') except PermissionDenied: print 'No permission.' except DestinationDoesNotExist: print "/tmp/ doesn't exist" except NoDiskSpace: print 'No diskspace available.' Answer points go to whoever can either link me to some relevant documentation that I've somehow overlooked in the official docs, or provide a sure-fire way to figure out exactly which exceptions are thrown by which functions, and why. Thanks!

  Read the article

• When to drop an IT job

  - by Nippysaurus

  In my career I have had two programming jobs. Both these jobs were in a field that I am most familiar with (C# / MSSQL) but I have quit both jobs for the same reason: unmanageable code and bad (loose) company structure. There was something in common with both these jobs: small companies (in one I was the only developer). Currently I am in the following position: being given written instructions which are almost impossible to follow (somewhat of a fools errand). we are given short time constraints, but seldom asked how long work will take, and when we do it is always too long and needs to be shorter (and when it ends up taking longer than they need it to take, it's always our fault). there is no time for proper documenting, but we get blamed for not documenting (see previous point). Management is constantly screwing me around, saying I'm underperforming on a given task (which is not true, and switching me to a task which is much more confusing). So I must ask my fellow developers: how bad does a job need to be before you would consider jumping ship? And what to look out for when considering taking a job. In future I will be asking about documented procedures, release control, bug management and adoption of new technologies. EDIT: Let me add some more fuel to the fire ... I have been in my current job for just over a year, and the work I am doing almost never uses any of the knowledge I have gained from the other work I have been doing here. Everything is a giant learning curve. Because of this about 30% of my time is learning what is going on with this new product (who's owner / original developer has left the company), 30% trying to find the relevant documentation that helps the whole thing make sense, 30% actually finding where to make the change, 10% actually making the change.

  Read the article

• Identity.Name is disposed in a IIS7 Asp.NET MVC application Thread

  - by vIceBerg

  I have made the smallest demo project to illustrate my problem. You can download the sources Here Visual Studio 2008, .NET 3.5, IIS7, Windows 7 Ultimate 32 bits. The IIS Website is configured ONLY for Windows Authentication in an Integreated pipeline app pool (DefaultAppPool). Here's the problem. I have an Asp.NET MVC 2 application. In an action, I start a thread. The View returns. The thread is doing it's job... but it needs to access Thread.CurrentPrincipal.Identity.Name BANG The worker process of IIS7 stops. I have a window that says: "Visual Studio Just-In-Time Debugger An unhandled exception ('System.Object.DisposedException') occured in w3wp.exe [5524]" I checked with the debugger and the Thread.CurrentPrincipal.Identity is valid, but the Name property is disposed. If I put a long wait in the action before it returns the view, then the Thread can do it's job and the Identity.Name is not disposed. So I think the Name gets disposed when the view is returned. For the sake of the discussion, here's the code that the thread runs (but you can also download the demo project. The link is on top of this post): private void Run() { const int SECTOWAIT = 3; //wait SECTOWAIT seconds long end = DateTime.Now.Ticks + (TimeSpan.TicksPerSecond * SECTOWAIT); while (DateTime.Now.Ticks <= end) continue; //Check the currentprincipal. BANG!!!!!!!!!!!!! var userName = Thread.CurrentPrincipal.Identity.Name; } Here's the code that starts the thread public void Start() { Thread thread = new Thread(new ParameterizedThreadStart(ThreadProc)); thread.SetApartmentState(ApartmentState.MTA); thread.Name = "TestThread"; thread.Start(this); } static void ThreadProc(object o) { try { Builder builder = (Builder)o; builder.Run(); } catch (Exception ex) { throw; } } So... what am i doing wrong? Thanks

  Read the article

• Using shared_ptr to implement RCU (read-copy-update)?

  - by yongsun

  I'm very interested in the user-space RCU (read-copy-update), and trying to simulate one via tr1::shared_ptr, here is the code, while I'm really a newbie in concurrent programming, would some experts help me to review? The basic idea is, reader calls get_reading_copy() to gain the pointer of current protected data (let's say it's generation one, or G1). writer calls get_updating_copy() to gain a copy of the G1 (let's say it's G2), and only one writer is allowed to enter the critical section. After the updating is done, writer calls update() to do a swap, and make the m_data_ptr pointing to data G2. The ongoing readers and the writer now hold the shared_ptr of G1, and either a reader or a writer will eventually deallocate the G1 data. Any new readers would get the pointer to G2, and a new writer would get the copy of G2 (let's say G3). It's possible the G1 is not released yet, so multiple generations of data my co-exists. template <typename T> class rcu_protected { public: typedef T type; typedef std::tr1::shared_ptr<type> rcu_pointer; rcu_protected() : m_data_ptr (new type()) {} rcu_pointer get_reading_copy () { spin_until_eq (m_is_swapping, 0); return m_data_ptr; } rcu_pointer get_updating_copy () { spin_until_eq (m_is_swapping, 0); while (!CAS (m_is_writing, 0, 1)) {/* do sleep for back-off when exceeding maximum retry times */} rcu_pointer new_data_ptr(new type(*m_data_ptr)); // as spin_until_eq does not have memory barrier protection, // we need to place a read barrier to protect the loading of // new_data_ptr not to be re-ordered before its construction _ReadBarrier(); return new_data_ptr; } void update (rcu_pointer new_data_ptr) { while (!CAS (m_is_swapping, 0, 1)) {} m_data_ptr.swap (new_data_ptr); // as spin_until_eq does not have memory barrier protection, // we need to place a write barrier to protect the assignments of // m_is_writing/m_is_swapping be re-ordered bofore the swapping _WriteBarrier(); m_is_writing = 0; m_is_swapping = 0; } private: volatile long m_is_writing; volatile long m_is_swapping; rcu_pointer m_data_ptr; };

  Read the article

• How can I keep an event from being delivered to the GUI until my code finished running?

  - by Frerich Raabe

  I installed a global mouse hook function like this: mouseEventHook = ::SetWindowsHookEx( WH_MOUSE_LL, mouseEventHookFn, thisModule, 0 ); The hook function looks like this: RESULT CALLBACK mouseEventHookFn( int code, WPARAM wParam, LPARAM lParam ) { if ( code == HC_ACTION ) { PMSLLHOOKSTRUCT mi = (PMSLLHOOKSTRUCT)lParam; // .. do interesting stuff .. } return ::CallNextHookEx( mouseEventHook, code, wParam, lParam ); } Now, my problem is that I cannot control how long the 'do interesting stuff' part takes exactly. In particular, it might take longer than the LowLevelHooksTimeout defined in the Windows registry. This means that, at least on Windows XP, the system no longer delivers mouse events to my hook function. I'd like to avoid this, but at the same time I need the 'do interesting stuff' part to happen before the target GUI receives the event. I attempted to solve this by doing the 'interesting stuff' work in a separate thread so that the mouseEventHookFn above can post a message to the worker thread and then do a return 1; immediately (which ends the hook function but avoids that the event is handed to the GUI). The idea was that the worker thread, when finished, performs the CallNextHookEx call itself. However, this causes a crash inside of CallNextHookEx (in fact, the crash occurs inside an internal function called PhkNextValid. I assume it's not safe to call CallNextHookEx from outside a hook function, is this true? If so, does anybody else know how I can run code (which needs to interact with the GUI thread of an application) before the GUI receives the event and avoid that my hook function blocks too long?

  Read the article

• Deserialize xml which uses attribute name/value pairs

  - by Bodyloss

  My application receives a constant stream of xml files which are more or less a direct copy of the database record <record type="update"> <field name="id">987654321</field> <field name="user_id">4321</field> <field name="updated">2011-11-24 13:43:23</field> </record> And I need to deserialize this into a class which provides nullable property's for all columns class Record { public long? Id { get; set; } public long? UserId { get; set; } public DateTime? Updated { get; set; } } I just cant seem to work out a method of doing this without having to parse the xml file manually and switch on the field's name attribute to store the values. Is their a way this can be achieved quickly using an XmlSerializer? And if not is their a more efficient way of parsing it manually? Regards and thanks My main problem is that the attribute name needs to have its value set to a property name and its value as the contents of a <field>..</field> element

  Read the article

• How to pair users? (Like Omegle.com)

  - by Carlos Dubus

  Hi, I'm trying to do an Omegle.com clone script, basically for learning purposes. I'm doing it in PHP/MySQL/AJAX. I'm having problems finding two users and connecting them. The purpose of omegle is connecting two users "randomly". What I'm doing right now is the following: When a user enters the website a session is assigned. There are 3 states for each session/user (Normal,Waiting,Chatting) At first the user has state Normal and a field "connected_to" = NULL If the users clicks the START button, a state of "Waiting" is assigned. Then it looks for another user with state Waiting, if doesn't find one then it keeps looping, waiting for the "connected_to" to change. The "connected_to" will change when other user click START and then find another user waiting and updates the sessions accordingly. Now this have several problems, like: A user only can be connected to one user at a time. In omegle you can open more than one chat simultaneously. I don't know if this is the best way. About the chat, each user is polling the events from the server with AJAX calls, I saw that omegle, instead of several HTTP requests each second (let's say), does ONE request and wait for an answer, that means that the PHP script is looping indefinitely until gets an answer.I did this using set_time_limit(30) each time the loop is started. Then when the Ajax call is done start over again. Is this approach correct? I will appreciate a LOT your answers, Thank you, Carlos

  Read the article

• With C# 3.0, how to write Interface based code with generic collection?

  - by Deecay

  I want to write code that is decouple and clean, and I know that by programming to an interface instead of the implementation, my code will be more flexible and extensible. So, instead of writing methods like: bool IsProductAvailable(ProductTypeA product); I write methods like: bool IsProductAvailable(IProduct product); As long as my products implement IProduct: class ProductTypeA : IProduct I should be OK. All is well until I start using generic collections. Since C# 3.0 doesn't support covariant and contravariant, even though both ProuctTypeA and ProductTypeB implements IProduct, you cannot put List in List. This is pretty troublesome because a lot of times I want to write something like: bool AreProductsAvailable(List<IProduct> products); So that I can check product avaialbility by writing: List<ProductA> productsArrived = GetDataFromDataabase(); bool result = AreProductsAvailable(productsArrived); And I want to write just one AreProductsAvailable() method that works with all IProduct collections. I know that C# 4.0 is going to support covariant and contravariant, but I also realize that there other libraries that seemed to have the problem solved. For instance, I was trying out ILOG Gantt the gantt chart control, and found that they have a lot of collection intefaces that looks like this: IActivityCollection ILinkCollection So it seems like their approach is wrapping the generic collection with an interface. So instead of "bool AreProductsAvailable(List products);", I can do: bool AreProductsAvailable(IProductCollection products); And then write some code so that IProductCollection takes whatever generic collection of IProduct, be it List or List. However, I don't know how to write an IProductCollection interface that does that "magic". :-< (ashame) .... Could someone shed me some light? This has been bugging me for so long, and I so wanted to do the "right thing". Well, thanks!

  Read the article

• Why doesn't java.lang.Number implement Comparable?

  - by Julien Chastang

  Does anyone know why java.lang.Number does not implement Comparable? This means that you cannot sort Numbers with Collections.sort which seems to me a little strange. Post discussion update: Thanks for all the helpful responses. I ended up doing some more research about this topic. The simplest explanation for why java.lang.Number does not implement Comparable is rooted in mutability concerns. For a bit of review, java.lang.Number is the abstract super-type of AtomicInteger, AtomicLong, BigDecimal, BigInteger, Byte, Double, Float, Integer, Long and Short. On that list, AtomicInteger and AtomicLong to do not implement Comparable. Digging around, I discovered that it is not a good practice to implement Comparable on mutable types because the objects can change during or after comparison rendering the result of the comparison useless. Both AtomicLong and AtomicInteger are mutable. The API designers had the forethought to not have Number implement Comparable because it would have constrained implementation of future subtypes. Indeed, AtomicLong and AtomicInteger were added in Java 1.5 long after java.lang.Number was initially implemented. Apart from mutability, there are probably other considerations here too. A compareTo implementation in Number would have to promote all numeric values to BigDecimal because it is capable of accommodating all the Number sub-types. The implication of that promotion in terms of mathematics and performance is a bit unclear to me, but my intuition finds that solution kludgy.

  Read the article

• MSForms.ListBox Type Mismatch in Access

  - by Jason

  I have an Access database where I use a Tab control (without tabs) to simulate a wizard. One of the tab pages has an MSForms.ListBox control called lstPorts, and a button named cmdAdd which adds the contents of a textbox to the List Box. I then try to keep the contents of the ListBox sorted. However, the call to the Sort method causes a type mismatch. Here is the cmdAdd_Click() code behind: Private Sub cmdAdd_Click() Dim test As MSForms.ListBox lstPorts2.AddItem (txtPortName) Call SortListBox(lstPorts2) End Sub Here is the SortListBox Sub: Public Sub SortListBox(ByRef oLb As MSForms.ListBox) Dim vaItems As Variant Dim i As Long, j As Long Dim vTemp As Variant 'Put the items in a variant array vaItems = oLb.List For i = LBound(vaItems, 1) To UBound(vaItems, 1) - 1 For j = i + 1 To UBound(vaItems, 1) If vaItems(i, 0) > vaItems(j, 0) Then vTemp = vaItems(i, 0) vaItems(i, 0) = vaItems(j, 0) vaItems(j, 0) = vTemp End If Next j Next i 'Clear the listbox oLb.Clear 'Add the sorted array back to the listbox For i = LBound(vaItems, 1) To UBound(vaItems, 1) oLb.AddItem vaItems(i, 0) Next i End Sub Any help out there? Since the Sort routine explicitly references the MSForms.ListBox, most of the results from Google aren't applicable. Jason

  Read the article

• Ember Data Sycn - LocalStorage+REST+RealTime+Online/Offline

  - by Miguel Madero

  We have a combination of requirements in terms o data access. Pre-load some reference data. We need reference data to survive browser restarts instead of just living in memory to avoid loading it all the time. I'm currently using the LocalStorageAdapter for that. Once we have it, we would like to sync changes (polling or using Socket.IO in the background and updating the LocalStorage could do the trick) There're other models that are more transactional, where we would need to directly go to the Server and get/save them. It would be nice to use something like the RESTAdapter for that. Lastly, there're some operations that should work off-line and changes should be synced later. To make it more concrete: * We pre-load vendor and "favorite products" into Local Storage. We work offline with those. * We need to sync server changes to vendor and product information. * If they search the full catalog, that requires them to be online. * When offline, we need to allow users to add something to their cart or even submit and order. We would like to queue this action and submit it when they have an Internet Connection. So a few questions are derived from this: * Is there a way to user RESTAdapter in combination with LocalStorage? * Is there some Socket.IO support? (Happy to do this part manually) * Is there Queueing support? Ideally at the Ember-Data level. I know we will have to do a lot of this manually and pull together the different lego pieces, but I wanted to ask for some perspective from experience Ember devs.

  Read the article

• Runnable to be run every second only runs once in Fragment onCreateView()

  - by jul

  I'm trying to update the time in a TextView with a Runnable supposed to be run every second. The Runnable is started from a Fragment's onCreateView(), but it's only executed once. Anybody can help? Thanks public class MyFragment extends Fragment { Calendar mCalendar; private Runnable mTicker; private Handler mHandler; TextView mClock; String mFormat; private boolean mClockStopped = false; @Override public View onCreateView(LayoutInflater inflater, ViewGroup container, Bundle savedInstanceState) { RelativeLayout view = (RelativeLayout) inflater.inflate(R.layout.meteo_widget, container, false); /* * Clock (from DigitalClock widget source) */ mClock = (TextView) view.findViewById(R.id.clock); mCalendar = Calendar.getInstance(); mHandler = new Handler(); mTicker = new Runnable() { public void run() { if(mClockStopped) return; mCalendar.setTimeInMillis(System.currentTimeMillis()); mClock.setText(DateFormat.format("hh:mm:ss", mCalendar)); mClock.invalidate(); long now = SystemClock.uptimeMillis(); long next = now + (1000 - now % 1000); mHandler.postAtTime(mTicker, next); } }; mTicker.run(); return view; } @Override public void onResume() { super.onResume(); mClockStopped = true; } @Override public void onPause() { mClockStopped = false; super.onPause(); } }

  Read the article

• Select statement with multiple 'where' fields using same value without duplicating text

  - by kdbdallas

  I will start by saying that I don't think what I want can be done, but that said, I am hoping I am wrong and someone knows more than me. So here is your chance... Prove you are smarter than me :) I want to do a search against a SQLite table looking for any records that "are similar" without having to write out the query in long hand. To clarify this is how I know I can write the query: select * from Articles where title like '%Bla%' or category like '%Bla%' or post like '%Bla%' This works and is not a huge deal if you are only checking against a couple of columns, but if you need to check against a bunch then your query can get really long and nasty looking really fast, not to mention the chance for typos. (ie: 'Bla%' instead of '%Bla%') What I am wondering is if there is a short hand way to do this? *This next code does not work the way I want, but just shows kind of what I am looking for select * from Articles where title or category or post like '%Bla%' Anyone know if there is a way to specify that multiple 'where' columns should use the same search value without listing that same search value for every column? Thanks in advance!

  Read the article

• Speed up an Excel Macro?

  - by N. Lucas

  Right now I have a macro PopulateYearlyValues But it seems to me it's taking way too long Sub PopulateYearlyValues(ByVal Month As Range) Dim c As Double Dim s As Double c = Application.WorksheetFunction.Match(UCase(Month.Value), ActiveSheet.Range("AA5:AX5"), 0) s = (ActiveSheet.Range("AA5").Column - 1) With ActiveSheet Dim i As Integer Dim j As Integer For i = 7 To 44 .Range("G" & i).Value = 0 .Range("H" & i).Value = 0 For j = 1 To c .Range("G" & i).Value = (.Range("G" & i).Value + .Cells(i, s).Offset(0, j)) .Range("H" & i).Value = (.Range("H" & i).Value + .Cells(i, s).Offset(0, (j + 1))) j = j + 1 Next j Next i End With End Sub I have a range G7:H44 that needs to be populated with the SUM of range AA7:AX44 but.. it's only every other column: If Month.Value = "January" G7 = SUM(AA7) H7 = SUM(AB7) ... G44 = SUM(AA44) H44 = SUM(AB44) End If If Month.Value = "April" G7 = SUM(AA7, AC7, AE7, AG7) H7 = SUM(AB7, AD7, AF7, AH7) ... G44 = SUM(AA44, AC44, AE44, AG44) H44 = SUM(AB44, AD44, AF44, AH44) End If But the macro I have is taking way too long.. Is there any other way to do this?

  Read the article

• Drawing an image in Java, slow as hell on a netbook.

  - by Norswap

  In follow-up to my previous questions (especially this one : http://stackoverflow.com/questions/2684123/java-volatileimage-slower-than-bufferedimage), i have noticed that simply drawing an Image (it doesn't matter if it's buffered or volatile, since the computer has no accelerated memory*, and tests shows it's doesn't change anything), tends to be very long. (*) System.out.println(GraphicsEnvironment.getLocalGraphicsEnvironment() .getDefaultScreenDevice().getAvailableAcceleratedMemory()); --> 0 How long ? For a 500x400 image, about 0.04 seconds. This is only drawing the image on the backbuffer (obtained via buffer strategy). Now considering that world of warcraft runs on that netbook (tough it is quite laggy) and that online java games seems to have no problem whatsoever, this is quite thought provoking. I'm quite certain I didn't miss something obvious, I've searched extensively the web, but nothing will do. So do any of you java whiz have an idea of what obscure problem might be causing this (or maybe it is normal, tough I doubt it) ? PS : As I'm writing this I realized this might be cause by my Linux installation (archlinux) tough I have the correct Intel driver. But my computer normally has "Integrated Intel Graphics Media Accelerator 950", which would mean it should have accelerated video memory somehow. Any ideas about this side of things ?

  Read the article

< Previous Page | 153 154 155 156 157 158 159 160 161 162 163 164  | Next Page >