Search Results

Search found 13534 results on 542 pages for 'python 2 5'.

Page 157/542 | < Previous Page | 153 154 155 156 157 158 159 160 161 162 163 164  | Next Page >

  • Python unicode search not giving correct answer

    - by user1318912
    I am trying to search hindi words contained one line per file in file-1 and find them in lines in file-2. I have to print the line numbers with the number of words found. This is the code: import codecs hypernyms = codecs.open("hindi_hypernym.txt", "r", "utf-8").readlines() words = codecs.open("hypernyms_en2hi.txt", "r", "utf-8").readlines() count_arr = [] for counter, line in enumerate(hypernyms): count_arr.append(0) for word in words: if line.find(word) >=0: count_arr[counter] +=1 for iterator, count in enumerate(count_arr): if count>0: print iterator, ' ', count This is finding some words, but ignoring some others The input files are: File-1: ???? ??????? File-2: ???????, ????-???? ?????-???, ?????-???, ?????_???, ?????_??? ????_????, ????-????, ???????_???? ????-???? This gives output: 0 1 3 1 Clearly, it is ignoring ??????? and searching for ???? only. I have tried with other inputs as well. It only searches for one word. Any idea how to correct this?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Custom keys for Google App Engine models (Python)

    - by Cameron
    First off, I'm relatively new to Google App Engine, so I'm probably doing something silly. Say I've got a model Foo: class Foo(db.Model): name = db.StringProperty() I want to use name as a unique key for every Foo object. How is this done? When I want to get a specific Foo object, I currently query the datastore for all Foo objects with the target unique name, but queries are slow (plus it's a pain to ensure that name is unique when each new Foo is created). There's got to be a better way to do this! Thanks.

    Read the article

  • Dynamic variable name in python

    - by PhilGo20
    I'd like to call a query with a field name filter that I wont know before run time... Not sure how to construct the variable name ...Or maybe I am tired. field_name = funct() locations = Locations.objects.filter(field_name__lte=arg1) where if funct() returns name would equal to locations = Locations.objects.filter(name__lte=arg1) Not sure how to do that ...

    Read the article

  • Optimizing BeautifulSoup (Python) code

    - by user283405
    I have code that uses the BeautifulSoup library for parsing, but it is very slow. The code is written in such a way that threads cannot be used. Can anyone help me with this? I am using BeautifulSoup for parsing and than save into a DB. If I comment out the save statement, it still takes a long time, so there is no problem with the database. def parse(self,text): soup = BeautifulSoup(text) arr = soup.findAll('tbody') for i in range(0,len(arr)-1): data=Data() soup2 = BeautifulSoup(str(arr[i])) arr2 = soup2.findAll('td') c=0 for j in arr2: if str(j).find("<a href=") > 0: data.sourceURL = self.getAttributeValue(str(j),'<a href="') else: if c == 2: data.Hits=j.renderContents() #and few others... c = c+1 data.save() Any suggestions? Note: I already ask this question here but that was closed due to incomplete information.

    Read the article

  • python cairoplot store previous readings..

    - by krisdigitx
    hi, i am using cairoplot, to make graphs, however the file from where i am reading the data is growing huge and its taking a long time to process the graph is there any real-time way to produce cairo graph, or at least store the previous readings..like rrd. -krisdigitx

    Read the article

  • OpenMeetings + Python + Suds

    - by user366774
    Trying to integrate openmeetings with django website, but can't understand how properly configure ImportDoctor: (here :// replaced with __ 'cause spam protection) print url http://sovershenstvo.com.ua:5080/openmeetings/services/UserService?wsdl imp = Import('http__schemas.xmlsoap.org/soap/encoding/') imp.filter.add('http__services.axis.openmeetings.org') imp.filter.add('http__basic.beans.hibernate.app.openmeetings.org/xsd') imp.filter.add('http__basic.beans.data.app.openmeetings.org/xsd') imp.filter.add('http__services.axis.openmeetings.org') d = ImportDoctor(imp) client = Client(url, doctor = d) client.service.getSession() Traceback (most recent call last): File "", line 1, in File "/usr/lib/python2.6/site-packages/suds/client.py", line 539, in call return client.invoke(args, kwargs) File "/usr/lib/python2.6/site-packages/suds/client.py", line 598, in invoke result = self.send(msg) File "/usr/lib/python2.6/site-packages/suds/client.py", line 627, in send result = self.succeeded(binding, reply.message) File "/usr/lib/python2.6/site-packages/suds/client.py", line 659, in succeeded r, p = binding.get_reply(self.method, reply) File "/usr/lib/python2.6/site-packages/suds/bindings/binding.py", line 159, in get_reply resolved = rtypes[0].resolve(nobuiltin=True) File "/usr/lib/python2.6/site-packages/suds/xsd/sxbasic.py", line 63, in resolve raise TypeNotFound(qref) suds.TypeNotFound: Type not found: '(Sessiondata, http__basic.beans.hibernate.app.openmeetings.org/xsd, )' what i'm doing wrong? please help and sorry for my english, but you are my last chance to save position :( need webinars at morning (2.26 am now)

    Read the article

  • Python RegExp exception

    - by Jasie
    How do I split on all nonalphanumeric characters, EXCEPT the apostrophe? re.split('\W+',text) works, but will also split on apostrophes. How do I add an exception to this rule? Thanks!

    Read the article

  • varargs in lambda functions in Python

    - by brain_damage
    Is it possible a lambda function to have variable number of arguments? For example, I want to write a metaclass, which creates a method for every method of some other class and this newly created method returns the opposite value of the original method and has the same number of arguments. And I want to do this with lambda function. How to pass the arguments? Is it possible? class Negate(type): def __new__(mcs, name, bases, _dict): extended_dict = _dict.copy() for (k, v) in _dict.items(): if hasattr(v, '__call__'): extended_dict["not_" + k] = lambda s, *args, **kw: not v(s, *args, **kw) return type.__new__(mcs, name, bases, extended_dict) class P(metaclass=Negate): def __init__(self, a): self.a = a def yes(self): return True def maybe(self, you_can_chose): return you_can_chose But the result is totally wrong: >>>p = P(0) >>>p.yes() True >>>p.not_yes() # should be False Traceback (most recent call last): File "<pyshell#150>", line 1, in <module> p.not_yes() File "C:\Users\Nona\Desktop\p10.py", line 51, in <lambda> extended_dict["not_" + k] = lambda s, *args, **kw: not v(s, *args, **kw) TypeError: __init__() takes exactly 2 positional arguments (1 given) >>>p.maybe(True) True >>>p.not_maybe(True) #should be False True

    Read the article

  • Python: Taking an array and break it into subarrays based on some criteria

    - by randombits
    I have an array of files. I'd like to be able to break that array down into one array with multiple subarrays, each subarray contains files that were created on the same day. So right now if the array contains files from March 1 - March 31, I'd like to have an array with 31 subarrays (assuming there is at least 1 file for each day). In the long run, I'm trying to find the file from each day with the latest creation/modification time. If there is a way to bundle that into the iterations that are required above to save some CPU cycles, that would be even more ideal. Then I'd have one flat array with 31 files, one for each day, for the latest file created on each individual day.

    Read the article

  • Efficient way in Python to remove an element from a comma-separated string

    - by ensnare
    I'm looking for the most efficient way to add an element to a comma-separated string while maintaining alphabetical order for the words: For example: string = 'Apples, Bananas, Grapes, Oranges' subtraction = 'Bananas' result = 'Apples, Grapes, Oranges' Also, a way to do this but while maintaining IDs: string = '1:Apples, 4:Bananas, 6:Grapes, 23:Oranges' subtraction = '4:Bananas' result = '1:Apples, 6:Grapes, 23:Oranges' Sample code is greatly appreciated. Thank you so much.

    Read the article

  • Proper structure for many test cases in Python with unittest

    - by mellort
    I am looking into the unittest package, and I'm not sure of the proper way to structure my test cases when writing a lot of them for the same method. Say I have a fact function which calculates the factorial of a number; would this testing file be OK? import unittest class functions_tester(unittest.TestCase): def test_fact_1(self): self.assertEqual(1, fact(1)) def test_fact_2(self): self.assertEqual(2, fact(2)) def test_fact_3(self): self.assertEqual(6, fact(3)) def test_fact_4(self): self.assertEqual(24, fact(4)) def test_fact_5(self): self.assertFalse(1==fact(5)) def test_fact_6(self): self.assertRaises(RuntimeError, fact, -1) #fact(-1) if __name__ == "__main__": unittest.main() It seems sloppy to have so many test methods for one method. I'd like to just have one testing method and put a ton of basic test cases (ie 4! ==24, 3!==6, 5!==120, and so on), but unittest doesn't let you do that. What is the best way to structure a testing file in this scenario? Thanks in advance for the help.

    Read the article

  • how to send some data to the Thread module on python and google-map-engine

    - by zjm1126
    from google.appengine.ext import db class Log(db.Model): content = db.StringProperty(multiline=True) class MyThread(threading.Thread): def run(self,request): #logs_query = Log.all().order('-date') #logs = logs_query.fetch(3) log=Log() log.content=request.POST.get('content',None) log.put() def Log(request): thr = MyThread() thr.start(request) return HttpResponse('') error is : Exception in thread Thread-1: Traceback (most recent call last): File "D:\Python25\lib\threading.py", line 486, in __bootstrap_inner self.run() File "D:\zjm_code\helloworld\views.py", line 33, in run log.content=request.POST.get('content',None) NameError: global name 'request' is not defined

    Read the article

  • Python Game using pyGame with Window Menu elements

    - by Zoja
    Here's the deal. I'm trying to write an arkanoid clone game and the thing is that I need a window menu like you get in pyGTK. For example File-(Open/Save/Exit) .. something like that and opening an "about" context where the author should be written. I'm already using pyGame for writting the game logic. I've tried pgu to write the GUI but that doesn't help me, altough it has those menu elements I'm taking about, you can't include the screen of the game in it's container. Does anybody know how to include such window menus with the usage of pyGame ?

    Read the article

  • Python/YACC Lexer: Token priority?

    - by Rosarch
    I'm trying to use reserved words in my grammar: reserved = { 'if' : 'IF', 'then' : 'THEN', 'else' : 'ELSE', 'while' : 'WHILE', } tokens = [ 'DEPT_CODE', 'COURSE_NUMBER', 'OR_CONJ', 'ID', ] + list(reserved.values()) t_DEPT_CODE = r'[A-Z]{2,}' t_COURSE_NUMBER = r'[0-9]{4}' t_OR_CONJ = r'or' t_ignore = ' \t' def t_ID(t): r'[a-zA-Z_][a-zA-Z_0-9]*' if t.value in reserved.values(): t.type = reserved[t.value] return t return None However, the t_ID rule somehow swallows up DEPT_CODE and OR_CONJ. How can I get around this? I'd like those two to take higher precedence than the reserved words.

    Read the article

  • Restart logging to a new file (Python)

    - by compie
    I'm using the following code to initialize logging in my application. logger = logging.getLogger() logger.setLevel(logging.DEBUG) # log to a file directory = '/reserved/DYPE/logfiles' now = datetime.now().strftime("%Y%m%d_%H%M%S") filename = os.path.join(directory, 'dype_%s.log' % now) file_handler = logging.FileHandler(filename) file_handler.setLevel(logging.DEBUG) formatter = logging.Formatter("%(asctime)s %(filename)s, %(lineno)d, %(funcName)s: %(message)s") file_handler.setFormatter(formatter) logger.addHandler(file_handler) # log to the console console_handler = logging.StreamHandler() level = logging.INFO console_handler.setLevel(level) logger.addHandler(console_handler) logging.debug('logging initialized') How can I close the current logging file and restart logging to a new file? Note: I don't want to use RotatingFileHandler, because I want full control over all the filenames and the moment of rotation.

    Read the article

  • Python - Compress Ascii String

    - by n0idea
    I'm looking for a way to compress an ascii-based string, any help? I need also need to decompress it. I tried zlib but with no help. What can I do to compress the string into lesser length? code: def compress(request): if request.POST: data = request.POST.get('input') if is_ascii(data): result = zlib.compress(data) return render_to_response('index.html', {'result': result, 'input':data}, context_instance = RequestContext(request)) else: result = "Error, the string is not ascii-based" return render_to_response('index.html', {'result':result}, context_instance = RequestContext(request)) else: return render_to_response('index.html', {}, context_instance = RequestContext(request))

    Read the article

  • Regex replace (in Python) - a more simple way?

    - by Evan Fosmark
    Any time I want to replace a piece of text that is part of a larger piece of text, I always have to do something like: "(?P<start>some_pattern)(?P<replace>foo)(?P<end>end)" And then concatenate the start group with the new data for replace and then the end group. Is there a better method for this?

    Read the article

  • Python loop | "do-while" over a tree

    - by johannix
    Is there a more Pythonic way to put this loop together?: while True: children = tree.getChildren() if not children: break tree = children[0] UPDATE: I think this syntax is probably what I'm going to go with: while tree.getChildren(): tree = tree.getChildren()[0]

    Read the article

  • Python and classes

    - by Artyom
    Hello, i have 2 classes. How i call first.TQ in Second ? Without creating object First in Second. class First: def __init__(self): self.str = "" def TQ(self): pass def main(self): T = Second(self.str) # Called here class Second(): def __init__(self): list = {u"RANDINT":first.TQ} # List of funcs maybe called in first ..... ..... return data

    Read the article

  • Using the AND and NOT Operator in Python

    - by NoahClark
    Here is my custom class that I have that represents a triangle. I'm trying to write code that checks to see if self.a, self.b, and self.c are greater than 0, which would mean that I have Angle, Angle, Angle. Below you will see the code that checks for A and B, however when I use just self.a != 0 then it works fine. I believe I'm not using & correctly. Any ideas? Here is how I am calling it: print myTri.detType() class Triangle: # Angle A To Angle C Connects Side F # Angle C to Angle B Connects Side D # Angle B to Angle A Connects Side E def __init__(self, a, b, c, d, e, f): self.a = a self.b = b self.c = c self.d = d self.e = e self.f = f def detType(self): #Triangle Type AAA if self.a != 0 & self.b != 0: return self.a #If self.a > 10: #return AAA #Triangle Type AAS #elif self.a = 0: #return AAS #Triangle Type ASA #Triangle Type SAS #Triangle Type SSS #else: #return unknown

    Read the article

< Previous Page | 153 154 155 156 157 158 159 160 161 162 163 164  | Next Page >