Search Results

Search found 13628 results on 546 pages for 'python datamodel'.

Page 157/546 | < Previous Page | 153 154 155 156 157 158 159 160 161 162 163 164  | Next Page >

  • Python: Created nested dictionary from list of paths

    - by sberry2A
    I have a list of tuples the looks similar to this (simplified here, there are over 14,000 of these tuples with more complicated paths than Obj.part) [ (Obj1.part1, {<SPEC>}), (Obj1.partN, {<SPEC>}), (ObjK.partN, {<SPEC>}) ] Where Obj goes from 1 - 1000, part from 0 - 2000. These "keys" all have a dictionary of specs associated with them which act as a lookup reference for inspecting another binary file. The specs dict contains information such as the bit offset, bit size, and C type of the data pointed to by the path ObjK.partN. For example: Obj4.part500 might have this spec, {'size':32, 'offset':128, 'type':'int'} which would let me know that to access Obj4.part500 in the binary file I must unpack 32 bits from offset 128. So, now I want to take my list of strings and create a nested dictionary which in the simplified case will look like this data = { 'Obj1' : {'part1':{spec}, 'partN':{spec} }, 'ObjK' : {'part1':{spec}, 'partN':{spec} } } To do this I am currently doing two things, 1. I am using a dotdict class to be able to use dot notation for dictionary get / set. That class looks like this: class dotdict(dict): def __getattr__(self, attr): return self.get(attr, None) __setattr__ = dict.__setitem__ __delattr__ = dict.__delitem__ The method for creating the nested "dotdict"s looks like this: def addPath(self, spec, parts, base): if len(parts) > 1: item = base.setdefault(parts[0], dotdict()) self.addPath(spec, parts[1:], item) else: item = base.setdefault(parts[0], spec) return base Then I just do something like: for path, spec in paths: self.lookup = dotdict() self.addPath(spec, path.split("."), self.lookup) So, in the end self.lookup.Obj4.part500 points to the spec. Is there a better (more pythonic) way to do this?

    Read the article

  • filtering elements from list of lists in Python?

    - by user248237
    I want to filter elements from a list of lists, and iterate over the elements of each element using a lambda. For example, given the list: a = [[1,2,3],[4,5,6]] suppose that I want to keep only elements where the sum of the list is greater than N. I tried writing: filter(lambda x, y, z: x + y + z >= N, a) but I get the error: <lambda>() takes exactly 3 arguments (1 given) How can I iterate while assigning values of each element to x, y, and z? Something like zip, but for arbitrarily long lists. thanks, p.s. I know I can write this using: filter(lambda x: sum(x)..., a) but that's not the point, imagine that these were not numbers but arbitrary elements and I wanted to assign their values to variable names.

    Read the article

  • [Tkinter/Python] Different line widths with canvas.create_line?

    - by Sam
    Does anyone have any idea why I get different line widths on the canvas in the following example? from Tkinter import * bigBoxSize = 150 class cFrame(Frame): def __init__(self, master, cwidth=450, cheight=450): Frame.__init__(self, master, relief=RAISED, height=550, width=600, bg = "grey") self.canvasWidth = cwidth self.canvasHeight = cheight self.canvas = Canvas(self, bg="white", width=cwidth, height=cheight, border =0) self.drawGridLines() self.canvas.pack(side=TOP, pady=20, padx=20) def drawGridLines(self, linewidth = 10): self.canvas.create_line(0, 0, self.canvasWidth, 0, width= linewidth ) self.canvas.create_line(0, 0, 0, self.canvasHeight, width= linewidth ) self.canvas.create_line(0, self.canvasHeight, self.canvasWidth + 2, self.canvasHeight, width= linewidth ) self.canvas.create_line(self.canvasWidth, self.canvasHeight, self.canvasWidth, 1, width= linewidth ) self.canvas.create_line(0, bigBoxSize, self.canvasWidth, bigBoxSize, width= linewidth ) self.canvas.create_line(0, bigBoxSize * 2, self.canvasWidth, bigBoxSize * 2, width= linewidth) root = Tk() C = cFrame(root) C.pack() root.mainloop() It's really frustrating me as I have no idea what's happening. If anyone can help me out then that'd be fantastic. Thanks!

    Read the article

  • Python recursion with list returns None

    - by newman
    def foo(a): a.append(1) if len(a) > 10: print a return a else: foo(a) Why this recursive function returns None (see transcript below)? I can't quite understand what I am doing wrong. In [263]: x = [] In [264]: y = foo(x) [1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1] In [265]: print y None

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Restart logging to a new file (Python)

    - by compie
    I'm using the following code to initialize logging in my application. logger = logging.getLogger() logger.setLevel(logging.DEBUG) # log to a file directory = '/reserved/DYPE/logfiles' now = datetime.now().strftime("%Y%m%d_%H%M%S") filename = os.path.join(directory, 'dype_%s.log' % now) file_handler = logging.FileHandler(filename) file_handler.setLevel(logging.DEBUG) formatter = logging.Formatter("%(asctime)s %(filename)s, %(lineno)d, %(funcName)s: %(message)s") file_handler.setFormatter(formatter) logger.addHandler(file_handler) # log to the console console_handler = logging.StreamHandler() level = logging.INFO console_handler.setLevel(level) logger.addHandler(console_handler) logging.debug('logging initialized') How can I close the current logging file and restart logging to a new file? Note: I don't want to use RotatingFileHandler, because I want full control over all the filenames and the moment of rotation.

    Read the article

  • Dynamic variable name in python

    - by PhilGo20
    I'd like to call a query with a field name filter that I wont know before run time... Not sure how to construct the variable name ...Or maybe I am tired. field_name = funct() locations = Locations.objects.filter(field_name__lte=arg1) where if funct() returns name would equal to locations = Locations.objects.filter(name__lte=arg1) Not sure how to do that ...

    Read the article

  • how to read a file in other directory in python

    - by mazen.r.f
    i have a file its name is 5_1.txt in a directory i named it direct , how can i read that file using the instruction read. i verified the path using : os.getcwd() os.path.exists(direct) the result was True x_file=open(direct,'r') and i got this error : Traceback (most recent call last): File "<pyshell#17>", line 1, in <module> x_file=open(direct,'r') IOError: [Errno 13] Permission denied i don't know why i can't read the file ? any suggestion ? thanks .

    Read the article

  • Python unicode search not giving correct answer

    - by user1318912
    I am trying to search hindi words contained one line per file in file-1 and find them in lines in file-2. I have to print the line numbers with the number of words found. This is the code: import codecs hypernyms = codecs.open("hindi_hypernym.txt", "r", "utf-8").readlines() words = codecs.open("hypernyms_en2hi.txt", "r", "utf-8").readlines() count_arr = [] for counter, line in enumerate(hypernyms): count_arr.append(0) for word in words: if line.find(word) >=0: count_arr[counter] +=1 for iterator, count in enumerate(count_arr): if count>0: print iterator, ' ', count This is finding some words, but ignoring some others The input files are: File-1: ???? ??????? File-2: ???????, ????-???? ?????-???, ?????-???, ?????_???, ?????_??? ????_????, ????-????, ???????_???? ????-???? This gives output: 0 1 3 1 Clearly, it is ignoring ??????? and searching for ???? only. I have tried with other inputs as well. It only searches for one word. Any idea how to correct this?

    Read the article

  • Python - calendar.timegm() vs. time.mktime()

    - by ibz
    I seem to have a hard time getting my head around this. What's the difference between calendar.timegm() and time.mktime()? Say I have a datetime.datetime with no tzinfo attached, shouldn't the two give the same output? Don't they both give the number of seconds between epoch and the date passed as a parameter? And since the date passed has no tzinfo, isn't that number of seconds the same? >>> import calendar >>> import time >>> import datetime >>> d = datetime.datetime(2010, 10, 10) >>> calendar.timegm(d.timetuple()) 1286668800 >>> time.mktime(d.timetuple()) 1286640000.0 >>>

    Read the article

  • Efficient way in Python to remove an element from a comma-separated string

    - by ensnare
    I'm looking for the most efficient way to add an element to a comma-separated string while maintaining alphabetical order for the words: For example: string = 'Apples, Bananas, Grapes, Oranges' subtraction = 'Bananas' result = 'Apples, Grapes, Oranges' Also, a way to do this but while maintaining IDs: string = '1:Apples, 4:Bananas, 6:Grapes, 23:Oranges' subtraction = '4:Bananas' result = '1:Apples, 6:Grapes, 23:Oranges' Sample code is greatly appreciated. Thank you so much.

    Read the article

  • use/run python's 2to3 as or like a unittest

    - by Vincent
    I have used the 2to3 utility to convert code from the command line. What I would like to do is run it basically as a unittest. Even if it tests the file rather than parts(funtions, methods...) as would be normal for a unittest. It does not need to be a unittest and I don't what to automatically convert the files I just want to monitor the py3 compliance of files in a unittest like manor. I can't seem to find any documentation or examples for this. An example and/or documentation would be great. Thanks

    Read the article

  • Python/YACC Lexer: Token priority?

    - by Rosarch
    I'm trying to use reserved words in my grammar: reserved = { 'if' : 'IF', 'then' : 'THEN', 'else' : 'ELSE', 'while' : 'WHILE', } tokens = [ 'DEPT_CODE', 'COURSE_NUMBER', 'OR_CONJ', 'ID', ] + list(reserved.values()) t_DEPT_CODE = r'[A-Z]{2,}' t_COURSE_NUMBER = r'[0-9]{4}' t_OR_CONJ = r'or' t_ignore = ' \t' def t_ID(t): r'[a-zA-Z_][a-zA-Z_0-9]*' if t.value in reserved.values(): t.type = reserved[t.value] return t return None However, the t_ID rule somehow swallows up DEPT_CODE and OR_CONJ. How can I get around this? I'd like those two to take higher precedence than the reserved words.

    Read the article

  • Optimizing BeautifulSoup (Python) code

    - by user283405
    I have code that uses the BeautifulSoup library for parsing, but it is very slow. The code is written in such a way that threads cannot be used. Can anyone help me with this? I am using BeautifulSoup for parsing and than save into a DB. If I comment out the save statement, it still takes a long time, so there is no problem with the database. def parse(self,text): soup = BeautifulSoup(text) arr = soup.findAll('tbody') for i in range(0,len(arr)-1): data=Data() soup2 = BeautifulSoup(str(arr[i])) arr2 = soup2.findAll('td') c=0 for j in arr2: if str(j).find("<a href=") > 0: data.sourceURL = self.getAttributeValue(str(j),'<a href="') else: if c == 2: data.Hits=j.renderContents() #and few others... c = c+1 data.save() Any suggestions? Note: I already ask this question here but that was closed due to incomplete information.

    Read the article

  • OpenMeetings + Python + Suds

    - by user366774
    Trying to integrate openmeetings with django website, but can't understand how properly configure ImportDoctor: (here :// replaced with __ 'cause spam protection) print url http://sovershenstvo.com.ua:5080/openmeetings/services/UserService?wsdl imp = Import('http__schemas.xmlsoap.org/soap/encoding/') imp.filter.add('http__services.axis.openmeetings.org') imp.filter.add('http__basic.beans.hibernate.app.openmeetings.org/xsd') imp.filter.add('http__basic.beans.data.app.openmeetings.org/xsd') imp.filter.add('http__services.axis.openmeetings.org') d = ImportDoctor(imp) client = Client(url, doctor = d) client.service.getSession() Traceback (most recent call last): File "", line 1, in File "/usr/lib/python2.6/site-packages/suds/client.py", line 539, in call return client.invoke(args, kwargs) File "/usr/lib/python2.6/site-packages/suds/client.py", line 598, in invoke result = self.send(msg) File "/usr/lib/python2.6/site-packages/suds/client.py", line 627, in send result = self.succeeded(binding, reply.message) File "/usr/lib/python2.6/site-packages/suds/client.py", line 659, in succeeded r, p = binding.get_reply(self.method, reply) File "/usr/lib/python2.6/site-packages/suds/bindings/binding.py", line 159, in get_reply resolved = rtypes[0].resolve(nobuiltin=True) File "/usr/lib/python2.6/site-packages/suds/xsd/sxbasic.py", line 63, in resolve raise TypeNotFound(qref) suds.TypeNotFound: Type not found: '(Sessiondata, http__basic.beans.hibernate.app.openmeetings.org/xsd, )' what i'm doing wrong? please help and sorry for my english, but you are my last chance to save position :( need webinars at morning (2.26 am now)

    Read the article

  • Get the last '/' or '\\' character in Python

    - by wowus
    If I have a string that looks like either ./A/B/c.d OR .\A\B\c.d How do I get just the "./A/B/" part? The direction of the slashes can be the same as they are passed. This problem kinda boils down to: How do I get the last of a specific character in a string? Basically, I want the path of a file without the file part of it.

    Read the article

  • Custom keys for Google App Engine models (Python)

    - by Cameron
    First off, I'm relatively new to Google App Engine, so I'm probably doing something silly. Say I've got a model Foo: class Foo(db.Model): name = db.StringProperty() I want to use name as a unique key for every Foo object. How is this done? When I want to get a specific Foo object, I currently query the datastore for all Foo objects with the target unique name, but queries are slow (plus it's a pain to ensure that name is unique when each new Foo is created). There's got to be a better way to do this! Thanks.

    Read the article

  • Python string formatting too slow

    - by wich
    I use the following code to log a map, it is fast when it only contains zeroes, but as soon as there is actual data in the map it becomes unbearably slow... Is there any way to do this faster? log_file = open('testfile', 'w') for i, x in ((i, start + i * interval) for i in range(length)): log_file.write('%-5d %8.3f %13g %13g %13g %13g %13g %13g\n' % (i, x, map[0][i], map[1][i], map[2][i], map[3][i], map[4][i], map[5][i]))

    Read the article

  • python cairoplot store previous readings..

    - by krisdigitx
    hi, i am using cairoplot, to make graphs, however the file from where i am reading the data is growing huge and its taking a long time to process the graph is there any real-time way to produce cairo graph, or at least store the previous readings..like rrd. -krisdigitx

    Read the article

  • Python: Taking an array and break it into subarrays based on some criteria

    - by randombits
    I have an array of files. I'd like to be able to break that array down into one array with multiple subarrays, each subarray contains files that were created on the same day. So right now if the array contains files from March 1 - March 31, I'd like to have an array with 31 subarrays (assuming there is at least 1 file for each day). In the long run, I'm trying to find the file from each day with the latest creation/modification time. If there is a way to bundle that into the iterations that are required above to save some CPU cycles, that would be even more ideal. Then I'd have one flat array with 31 files, one for each day, for the latest file created on each individual day.

    Read the article

  • strip spaces in python.

    - by Richard
    ok I know that this should be simple... anyways say: line = "$W5M5A,100527,142500,730301c44892fd1c,2,686.5 4,333.96,0,0,28.6,123,75,-0.4,1.4*49" I want to strip out the spaces. I thought you would just do this line = line.strip() but now line is still '$W5M5A,100527,142500,730301c44892fd1c,2,686.5 4,333.96,0,0,28.6,123,75,-0.4,1.4*49' instead of '$W5M5A,100527,142500,730301c44892fd1c,2,686.54,333.96,0,0,28.6,123,75,-0.4,1.4*49' any thoughts?

    Read the article

  • Python and classes

    - by Artyom
    Hello, i have 2 classes. How i call first.TQ in Second ? Without creating object First in Second. class First: def __init__(self): self.str = "" def TQ(self): pass def main(self): T = Second(self.str) # Called here class Second(): def __init__(self): list = {u"RANDINT":first.TQ} # List of funcs maybe called in first ..... ..... return data

    Read the article

  • Python: Unpack arbitary length bits for database storage

    - by sberry2A
    I have a binary data format consisting of 18,000+ packed int64s, ints, shorts, bytes and chars. The data is packed to minimize it's size, so they don't always use byte sized chunks. For example, a number whose min and max value are 31, 32 respectively might be stored with a single bit where the actual value is bitvalue + min, so 0 is 31 and 1 is 32. I am looking for the most efficient way to unpack all of these for subsequent processing and database storage. Right now I am able to read any value by using either struct.unpack, or BitBuffer. I use struct.unpack for any data that starts on a bit where (bit-offset % 8 == 0 and data-length % 8 == 0) and I use BitBuffer for anything else. I know the offset and size of every packed piece of data, so what is going to be the fasted way to completely unpack them? Many thanks.

    Read the article

< Previous Page | 153 154 155 156 157 158 159 160 161 162 163 164  | Next Page >