Search Results

Search found 13539 results on 542 pages for 'python gtkmozembed'.

Page 157/542 | < Previous Page | 153 154 155 156 157 158 159 160 161 162 163 164  | Next Page >

• Python recursion with list returns None

  - by newman

  def foo(a): a.append(1) if len(a) > 10: print a return a else: foo(a) Why this recursive function returns None (see transcript below)? I can't quite understand what I am doing wrong. In [263]: x = [] In [264]: y = foo(x) [1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1] In [265]: print y None

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• strip spaces in python.

  - by Richard

  ok I know that this should be simple... anyways say: line = "$W5M5A,100527,142500,730301c44892fd1c,2,686.5 4,333.96,0,0,28.6,123,75,-0.4,1.4*49" I want to strip out the spaces. I thought you would just do this line = line.strip() but now line is still '$W5M5A,100527,142500,730301c44892fd1c,2,686.5 4,333.96,0,0,28.6,123,75,-0.4,1.4*49' instead of '$W5M5A,100527,142500,730301c44892fd1c,2,686.54,333.96,0,0,28.6,123,75,-0.4,1.4*49' any thoughts?

  Read the article

• Python RegExp exception

  - by Jasie

  How do I split on all nonalphanumeric characters, EXCEPT the apostrophe? re.split('\W+',text) works, but will also split on apostrophes. How do I add an exception to this rule? Thanks!

  Read the article

• Python combinations no repeat by constraint

  - by user2758113

  I have a tuple of tuples (Name, val 1, val 2, Class) tuple = (("Jackson",10,12,"A"), ("Ryan",10,20,"A"), ("Michael",10,12,"B"), ("Andrew",10,20,"B"), ("McKensie",10,12,"C"), ("Alex",10,20,"D")) I need to return all combinations using itertools combinations that do not repeat classes. How can I return combinations that dont repeat classes. For example, the first returned statement would be: tuple0, tuple2, tuple4, tuple5 and so on.

  Read the article

• python cairoplot store previous readings..

  - by krisdigitx

  hi, i am using cairoplot, to make graphs, however the file from where i am reading the data is growing huge and its taking a long time to process the graph is there any real-time way to produce cairo graph, or at least store the previous readings..like rrd. -krisdigitx

  Read the article

• Optimizing BeautifulSoup (Python) code

  - by user283405

  I have code that uses the BeautifulSoup library for parsing, but it is very slow. The code is written in such a way that threads cannot be used. Can anyone help me with this? I am using BeautifulSoup for parsing and than save into a DB. If I comment out the save statement, it still takes a long time, so there is no problem with the database. def parse(self,text): soup = BeautifulSoup(text) arr = soup.findAll('tbody') for i in range(0,len(arr)-1): data=Data() soup2 = BeautifulSoup(str(arr[i])) arr2 = soup2.findAll('td') c=0 for j in arr2: if str(j).find("<a href=") > 0: data.sourceURL = self.getAttributeValue(str(j),'<a href="') else: if c == 2: data.Hits=j.renderContents() #and few others... c = c+1 data.save() Any suggestions? Note: I already ask this question here but that was closed due to incomplete information.

  Read the article

• Python/Django Concatenate a string depending on whether that string exists

  - by Douglas Meehan

  I'm creating a property on a Django model called "address". I want address to consist of the concatenation of a number of fields I have on my model. The problem is that not all instances of this model will have values for all of these fields. So, I want to concatenate only those fields that have values. What is the best/most Pythonic way to do this? Here are the relevant fields from the model: house = models.IntegerField('House Number', null=True, blank=True) suf = models.CharField('House Number Suffix', max_length=1, null=True, blank=True) unit = models.CharField('Address Unit', max_length=7, null=True, blank=True) stex = models.IntegerField('Address Extention', null=True, blank=True) stdir = models.CharField('Street Direction', max_length=254, null=True, blank=True) stnam = models.CharField('Street Name', max_length=30, null=True, blank=True) stdes = models.CharField('Street Designation', max_length=3, null=True, blank=True) stdessuf = models.CharField('Street Designation Suffix',max_length=1, null=True, blank=True) I could just do something like this: def _get_address(self): return "%s %s %s %s %s %s %s %s" % (self.house, self.suf, self.unit, self.stex, self.stdir, self.stname, self.stdes, self.stdessuf) but then there would be extra blank spaces in the result. I could do a series of if statements and concatenate within each, but that seems ugly. What's the best way to handle this situation? Thanks.

  Read the article

• Restart logging to a new file (Python)

  - by compie

  I'm using the following code to initialize logging in my application. logger = logging.getLogger() logger.setLevel(logging.DEBUG) # log to a file directory = '/reserved/DYPE/logfiles' now = datetime.now().strftime("%Y%m%d_%H%M%S") filename = os.path.join(directory, 'dype_%s.log' % now) file_handler = logging.FileHandler(filename) file_handler.setLevel(logging.DEBUG) formatter = logging.Formatter("%(asctime)s %(filename)s, %(lineno)d, %(funcName)s: %(message)s") file_handler.setFormatter(formatter) logger.addHandler(file_handler) # log to the console console_handler = logging.StreamHandler() level = logging.INFO console_handler.setLevel(level) logger.addHandler(console_handler) logging.debug('logging initialized') How can I close the current logging file and restart logging to a new file? Note: I don't want to use RotatingFileHandler, because I want full control over all the filenames and the moment of rotation.

  Read the article

• Custom keys for Google App Engine models (Python)

  - by Cameron

  First off, I'm relatively new to Google App Engine, so I'm probably doing something silly. Say I've got a model Foo: class Foo(db.Model): name = db.StringProperty() I want to use name as a unique key for every Foo object. How is this done? When I want to get a specific Foo object, I currently query the datastore for all Foo objects with the target unique name, but queries are slow (plus it's a pain to ensure that name is unique when each new Foo is created). There's got to be a better way to do this! Thanks.

  Read the article

• Dynamic Operator Overloading on dict classes in Python

  - by Ishpeck

  I have a class that dynamically overloads basic arithmetic operators like so... import operator class IshyNum: def __init__(self, n): self.num=n self.buildArith() def arithmetic(self, other, o): return o(self.num, other) def buildArith(self): map(lambda o: setattr(self, "__%s__"%o,lambda f: self.arithmetic(f, getattr(operator, o))), ["add", "sub", "mul", "div"]) if __name__=="__main__": number=IshyNum(5) print number+5 print number/2 print number*3 print number-3 But if I change the class to inherit from the dictionary (class IshyNum(dict):) it doesn't work. I need to explicitly def __add__(self, other) or whatever in order for this to work. Why?

  Read the article

• Python - calendar.timegm() vs. time.mktime()

  - by ibz

  I seem to have a hard time getting my head around this. What's the difference between calendar.timegm() and time.mktime()? Say I have a datetime.datetime with no tzinfo attached, shouldn't the two give the same output? Don't they both give the number of seconds between epoch and the date passed as a parameter? And since the date passed has no tzinfo, isn't that number of seconds the same? >>> import calendar >>> import time >>> import datetime >>> d = datetime.datetime(2010, 10, 10) >>> calendar.timegm(d.timetuple()) 1286668800 >>> time.mktime(d.timetuple()) 1286640000.0 >>>

  Read the article

• Python string formatting too slow

  - by wich

  I use the following code to log a map, it is fast when it only contains zeroes, but as soon as there is actual data in the map it becomes unbearably slow... Is there any way to do this faster? log_file = open('testfile', 'w') for i, x in ((i, start + i * interval) for i in range(length)): log_file.write('%-5d %8.3f %13g %13g %13g %13g %13g %13g\n' % (i, x, map[0][i], map[1][i], map[2][i], map[3][i], map[4][i], map[5][i]))

  Read the article

• python - from matrix to dictionary in single line

  - by Sanich

  matrix is a list of lists. I've to return a dictionary of the form {i:(l1[i],l2[i],...,lm[i])} Where the key i is matched with a tuple the i'th elements from each list. Say matrix=[[1,2,3,4],[9,8,7,6],[4,8,2,6]] so the line: >>> dict([(i,tuple(matrix[k][i] for k in xrange(len(matrix)))) for i in xrange(len(matrix[0]))]) does the job pretty well and outputs: {0: (1, 9, 4), 1: (2, 8, 8), 2: (3, 7, 2), 3: (4, 6, 6)} but fails if the matrix is empty: matrix=[]. The output should be: {} How can i deal with this?

  Read the article

• Get the last '/' or '\\' character in Python

  - by wowus

  If I have a string that looks like either ./A/B/c.d OR .\A\B\c.d How do I get just the "./A/B/" part? The direction of the slashes can be the same as they are passed. This problem kinda boils down to: How do I get the last of a specific character in a string? Basically, I want the path of a file without the file part of it.

  Read the article

• Python for statement giving an Invalid Syntax error with list

  - by Cold Diamondz

  I have some code in which is throwing an error (I'm using repl.it) import random students = ['s1:0','s2:0','s3:0'] while True: print'\n'*50 print'Ticket Machine'.center(80) print'-'*80 print'1. Clear Student Ticket Values'.center(80) print'2. Draw Tickets'.center(80) menu = raw_input('-'*80+'\nChoose an Option: ') if menu == '1': print'\n'*50 print'CLEARED!' students = ['s1:0','s2:0','s3:0'] raw_input('Press enter to return to the main menu!') elif menu == '2': tickets = [] print'\n'*50 times = int(raw_input('How many tickets to draw? ') for a in students: for i in range(a.split(':')[1]): tickets.append(a.split(':')[0]) for b in range(1,times+1): print str(b) + '. ' + random.choice(tickets) else: print'\n'*50 print'That was not an option!' raw_input('Press enter to return to the main menu!') But it is throwing this error: File "<stdin>", line 19 for a in students: ^ SyntaxError: invalid syntax I am planning on using this in a class, but I can't use it until the bug is fixed, also, student names have been removed for privacy reasons.

  Read the article

• Python and classes

  - by Artyom

  Hello, i have 2 classes. How i call first.TQ in Second ? Without creating object First in Second. class First: def __init__(self): self.str = "" def TQ(self): pass def main(self): T = Second(self.str) # Called here class Second(): def __init__(self): list = {u"RANDINT":first.TQ} # List of funcs maybe called in first ..... ..... return data

  Read the article

• use/run python's 2to3 as or like a unittest

  - by Vincent

  I have used the 2to3 utility to convert code from the command line. What I would like to do is run it basically as a unittest. Even if it tests the file rather than parts(funtions, methods...) as would be normal for a unittest. It does not need to be a unittest and I don't what to automatically convert the files I just want to monitor the py3 compliance of files in a unittest like manor. I can't seem to find any documentation or examples for this. An example and/or documentation would be great. Thanks

  Read the article

• Python: Taking an array and break it into subarrays based on some criteria

  - by randombits

  I have an array of files. I'd like to be able to break that array down into one array with multiple subarrays, each subarray contains files that were created on the same day. So right now if the array contains files from March 1 - March 31, I'd like to have an array with 31 subarrays (assuming there is at least 1 file for each day). In the long run, I'm trying to find the file from each day with the latest creation/modification time. If there is a way to bundle that into the iterations that are required above to save some CPU cycles, that would be even more ideal. Then I'd have one flat array with 31 files, one for each day, for the latest file created on each individual day.

  Read the article

• Python/YACC Lexer: Token priority?

  - by Rosarch

  I'm trying to use reserved words in my grammar: reserved = { 'if' : 'IF', 'then' : 'THEN', 'else' : 'ELSE', 'while' : 'WHILE', } tokens = [ 'DEPT_CODE', 'COURSE_NUMBER', 'OR_CONJ', 'ID', ] + list(reserved.values()) t_DEPT_CODE = r'[A-Z]{2,}' t_COURSE_NUMBER = r'[0-9]{4}' t_OR_CONJ = r'or' t_ignore = ' \t' def t_ID(t): r'[a-zA-Z_][a-zA-Z_0-9]*' if t.value in reserved.values(): t.type = reserved[t.value] return t return None However, the t_ID rule somehow swallows up DEPT_CODE and OR_CONJ. How can I get around this? I'd like those two to take higher precedence than the reserved words.

  Read the article

• Sympy python circumference

  - by Mattia Villani

  I need to display a circumference. In order to do that I thought I could calculata for a lot of x the two values of y, so I did: import sympy as sy from sympy.abc import x,y f = x**2 + y**2 - 1 a = x - 0.5 sy.solve([f,a],[x,y]) and this is what I get: Traceback (most recent call last): File "<input>", line 1, in <module> File "/usr/lib/python2.7/dist-packages/sympy/solvers/solvers.py", line 484, in solve solution = _solve(f, *symbols, **flags) File "/usr/lib/python2.7/dist-packages/sympy/solvers/solvers.py", line 749, in _solve result = solve_poly_system(polys) File "/usr/lib/python2.7/dist-packages/sympy/solvers/polysys.py", line 40, in solve_poly_system return solve_biquadratic(f, g, opt) File "/usr/lib/python2.7/dist-packages/sympy/solvers/polysys.py", line 48, in solve_biquadratic G = groebner([f, g]) File "/usr/lib/python2.7/dist-packages/sympy/polys/polytools.py", line 5308, i n groebner raise DomainError("can't compute a Groebner basis over %s" % domain) DomainError: can't compute a Groebner basis over RR How can I calculate the y's values ?

  Read the article

• Unique elements of list within list in python

  - by user2901061

  We are given a list of animals in different zoos and need to find which zoos have animals that are not in any others. The animals of each zoo are separated by spaces, and each zoo is originally separated by a comma. I am currently enumerating over all of the zoos to split each animal and create lists within lists for different zoos as such: for i, zoo in enumerate(zoos): zoos[i] = zoo.split() However, I then do not know how to tell and count how many of the zoos have unique animals. I figure it is something else with enumerate and possibly sets, but cannot get it down exactly. Any help is greatly appreciated. Thanks

  Read the article

• Python - Compress Ascii String

  - by n0idea

  I'm looking for a way to compress an ascii-based string, any help? I need also need to decompress it. I tried zlib but with no help. What can I do to compress the string into lesser length? code: def compress(request): if request.POST: data = request.POST.get('input') if is_ascii(data): result = zlib.compress(data) return render_to_response('index.html', {'result': result, 'input':data}, context_instance = RequestContext(request)) else: result = "Error, the string is not ascii-based" return render_to_response('index.html', {'result':result}, context_instance = RequestContext(request)) else: return render_to_response('index.html', {}, context_instance = RequestContext(request))

  Read the article

• Python Game using pyGame with Window Menu elements

  - by Zoja

  Here's the deal. I'm trying to write an arkanoid clone game and the thing is that I need a window menu like you get in pyGTK. For example File-(Open/Save/Exit) .. something like that and opening an "about" context where the author should be written. I'm already using pyGame for writting the game logic. I've tried pgu to write the GUI but that doesn't help me, altough it has those menu elements I'm taking about, you can't include the screen of the game in it's container. Does anybody know how to include such window menus with the usage of pyGame ?

  Read the article

• facing problem when trying to send an email using python

  - by vishnu

  i wrote the code like this import smtplib server=smtplib.SMTP('localhost') then it raising an error like error: [Errno 10061] No connection could be made because the target machine actively refused it i am new to SMTP can you tell what exactly the problem is

  Read the article

< Previous Page | 153 154 155 156 157 158 159 160 161 162 163 164  | Next Page >