Search Results

Search found 14201 results on 569 pages for 'python mock'.

Page 160/569 | < Previous Page | 156 157 158 159 160 161 162 163 164 165 166 167  | Next Page >

  • Extra characters Extracted with XPath and Python (html)

    - by Nacari
    I have been using XPath with scrapy to extract text from html tags online, but when I do I get extra characters attached. An example is trying to extract a number, like "204" from a <td> tag and getting [u'204']. In some cases its much worse. For instance trying to extract "1 - Mathoverflow" and instead getting [u'\r\n\t\t 1 \u2013 MathOverflow\r\n\t\t ']. Is there a way to prevent this, or trim the strings so that the extra characters arent a part of the string? (using items to store the data). It looks like it has something to do with formatting, so how do I get xpath to not pick up that stuff?

    Read the article

  • Proper structure for many test cases in Python with unittest

    - by mellort
    I am looking into the unittest package, and I'm not sure of the proper way to structure my test cases when writing a lot of them for the same method. Say I have a fact function which calculates the factorial of a number; would this testing file be OK? import unittest class functions_tester(unittest.TestCase): def test_fact_1(self): self.assertEqual(1, fact(1)) def test_fact_2(self): self.assertEqual(2, fact(2)) def test_fact_3(self): self.assertEqual(6, fact(3)) def test_fact_4(self): self.assertEqual(24, fact(4)) def test_fact_5(self): self.assertFalse(1==fact(5)) def test_fact_6(self): self.assertRaises(RuntimeError, fact, -1) #fact(-1) if __name__ == "__main__": unittest.main() It seems sloppy to have so many test methods for one method. I'd like to just have one testing method and put a ton of basic test cases (ie 4! ==24, 3!==6, 5!==120, and so on), but unittest doesn't let you do that. What is the best way to structure a testing file in this scenario? Thanks in advance for the help.

    Read the article

  • Python unicode search not giving correct answer

    - by user1318912
    I am trying to search hindi words contained one line per file in file-1 and find them in lines in file-2. I have to print the line numbers with the number of words found. This is the code: import codecs hypernyms = codecs.open("hindi_hypernym.txt", "r", "utf-8").readlines() words = codecs.open("hypernyms_en2hi.txt", "r", "utf-8").readlines() count_arr = [] for counter, line in enumerate(hypernyms): count_arr.append(0) for word in words: if line.find(word) >=0: count_arr[counter] +=1 for iterator, count in enumerate(count_arr): if count>0: print iterator, ' ', count This is finding some words, but ignoring some others The input files are: File-1: ???? ??????? File-2: ???????, ????-???? ?????-???, ?????-???, ?????_???, ?????_??? ????_????, ????-????, ???????_???? ????-???? This gives output: 0 1 3 1 Clearly, it is ignoring ??????? and searching for ???? only. I have tried with other inputs as well. It only searches for one word. Any idea how to correct this?

    Read the article

  • Optimizing python code performance when importing zipped csv to a mongo collection

    - by mark
    I need to import a zipped csv into a mongo collection, but there is a catch - every record contains a timestamp in Pacific Time, which must be converted to the local time corresponding to the (longitude,latitude) pair found in the same record. The code looks like so: def read_csv_zip(path, timezones): with ZipFile(path) as z, z.open(z.namelist()[0]) as input: csv_rows = csv.reader(input) header = csv_rows.next() check,converters = get_aux_stuff(header) for csv_row in csv_rows: if check(csv_row): row = { converter[0]:converter[1](value) for converter, value in zip(converters, csv_row) if allow_field(converter) } ts = row['ts'] lng, lat = row['loc'] found_tz_entry = timezones.find_one(SON({'loc': {'$within': {'$box': [[lng-tz_lookup_radius, lat-tz_lookup_radius],[lng+tz_lookup_radius, lat+tz_lookup_radius]]}}})) if found_tz_entry: tz_name = found_tz_entry['tz'] local_ts = ts.astimezone(timezone(tz_name)).replace(tzinfo=None) row['tz'] = tz_name else: local_ts = (ts.astimezone(utc) + timedelta(hours = int(lng/15))).replace(tzinfo = None) row['local_ts'] = local_ts yield row def insert_documents(collection, source, batch_size): while True: items = list(itertools.islice(source, batch_size)) if len(items) == 0: break; try: collection.insert(items) except: for item in items: try: collection.insert(item) except Exception as exc: print("Failed to insert record {0} - {1}".format(item['_id'], exc)) def main(zip_path): with Connection() as connection: data = connection.mydb.data timezones = connection.timezones.data insert_documents(data, read_csv_zip(zip_path, timezones), 1000) The code proceeds as follows: Every record read from the csv is checked and converted to a dictionary, where some fields may be skipped, some titles be renamed (from those appearing in the csv header), some values may be converted (to datetime, to integers, to floats. etc ...) For each record read from the csv, a lookup is made into the timezones collection to map the record location to the respective time zone. If the mapping is successful - that timezone is used to convert the record timestamp (pacific time) to the respective local timestamp. If no mapping is found - a rough approximation is calculated. The timezones collection is appropriately indexed, of course - calling explain() confirms it. The process is slow. Naturally, having to query the timezones collection for every record kills the performance. I am looking for advises on how to improve it. Thanks. EDIT The timezones collection contains 8176040 records, each containing four values: > db.data.findOne() { "_id" : 3038814, "loc" : [ 1.48333, 42.5 ], "tz" : "Europe/Andorra" } EDIT2 OK, I have compiled a release build of http://toblerity.github.com/rtree/ and configured the rtree package. Then I have created an rtree dat/idx pair of files corresponding to my timezones collection. So, instead of calling collection.find_one I call index.intersection. Surprisingly, not only there is no improvement, but it works even more slowly now! May be rtree could be fine tuned to load the entire dat/idx pair into RAM (704M), but I do not know how to do it. Until then, it is not an alternative. In general, I think the solution should involve parallelization of the task. EDIT3 Profile output when using collection.find_one: >>> p.sort_stats('cumulative').print_stats(10) Tue Apr 10 14:28:39 2012 ImportDataIntoMongo.profile 64549590 function calls (64549180 primitive calls) in 1231.257 seconds Ordered by: cumulative time List reduced from 730 to 10 due to restriction <10> ncalls tottime percall cumtime percall filename:lineno(function) 1 0.012 0.012 1231.257 1231.257 ImportDataIntoMongo.py:1(<module>) 1 0.001 0.001 1230.959 1230.959 ImportDataIntoMongo.py:187(main) 1 853.558 853.558 853.558 853.558 {raw_input} 1 0.598 0.598 370.510 370.510 ImportDataIntoMongo.py:165(insert_documents) 343407 9.965 0.000 359.034 0.001 ImportDataIntoMongo.py:137(read_csv_zip) 343408 2.927 0.000 287.035 0.001 c:\python27\lib\site-packages\pymongo\collection.py:489(find_one) 343408 1.842 0.000 274.803 0.001 c:\python27\lib\site-packages\pymongo\cursor.py:699(next) 343408 2.542 0.000 271.212 0.001 c:\python27\lib\site-packages\pymongo\cursor.py:644(_refresh) 343408 4.512 0.000 253.673 0.001 c:\python27\lib\site-packages\pymongo\cursor.py:605(__send_message) 343408 0.971 0.000 242.078 0.001 c:\python27\lib\site-packages\pymongo\connection.py:871(_send_message_with_response) Profile output when using index.intersection: >>> p.sort_stats('cumulative').print_stats(10) Wed Apr 11 16:21:31 2012 ImportDataIntoMongo.profile 41542960 function calls (41542536 primitive calls) in 2889.164 seconds Ordered by: cumulative time List reduced from 778 to 10 due to restriction <10> ncalls tottime percall cumtime percall filename:lineno(function) 1 0.028 0.028 2889.164 2889.164 ImportDataIntoMongo.py:1(<module>) 1 0.017 0.017 2888.679 2888.679 ImportDataIntoMongo.py:202(main) 1 2365.526 2365.526 2365.526 2365.526 {raw_input} 1 0.766 0.766 502.817 502.817 ImportDataIntoMongo.py:180(insert_documents) 343407 9.147 0.000 491.433 0.001 ImportDataIntoMongo.py:152(read_csv_zip) 343406 0.571 0.000 391.394 0.001 c:\python27\lib\site-packages\rtree-0.7.0-py2.7.egg\rtree\index.py:384(intersection) 343406 379.957 0.001 390.824 0.001 c:\python27\lib\site-packages\rtree-0.7.0-py2.7.egg\rtree\index.py:435(_intersection_obj) 686513 22.616 0.000 38.705 0.000 c:\python27\lib\site-packages\rtree-0.7.0-py2.7.egg\rtree\index.py:451(_get_objects) 343406 6.134 0.000 33.326 0.000 ImportDataIntoMongo.py:162(<dictcomp>) 346 0.396 0.001 30.665 0.089 c:\python27\lib\site-packages\pymongo\collection.py:240(insert) EDIT4 I have parallelized the code, but the results are still not very encouraging. I am convinced it could be done better. See my own answer to this question for details.

    Read the article

  • I have an Errno 13 Permission denied with subprocess in python

    - by wDroter
    The line with the issue is ret=subprocess.call(shlex.split(cmd)) cmd = /usr/share/java -cp pig-hadoop-conf-Simpsons:lib/pig-0.8.1-cdh3u1-core.jar:lib/hadoop-core-0.20.2-cdh3u1.jar org.apache.pig.Main -param func=cat -param from =foo.txt -x mapreduce fsFunc.pig The error is. File "./run_pig.py", line 157, in process ret=subprocess.call(shlex.split(cmd)) File "/usr/lib/python2.7/subprocess.py", line 493, in call return Popen(*popenargs, **kwargs).wait() File "/usr/lib/python2.7/subprocess.py", line 679, in __init__ errread, errwrite) File "/usr/lib/python2.7/subprocess.py", line 1249, in _execute_child raise child_exception OSError: [Errno 13] Permission denied Let me know if any more info is needed. Any help is appreciated. Thanks.

    Read the article

  • OpenMeetings + Python + Suds

    - by user366774
    Trying to integrate openmeetings with django website, but can't understand how properly configure ImportDoctor: (here :// replaced with __ 'cause spam protection) print url http://sovershenstvo.com.ua:5080/openmeetings/services/UserService?wsdl imp = Import('http__schemas.xmlsoap.org/soap/encoding/') imp.filter.add('http__services.axis.openmeetings.org') imp.filter.add('http__basic.beans.hibernate.app.openmeetings.org/xsd') imp.filter.add('http__basic.beans.data.app.openmeetings.org/xsd') imp.filter.add('http__services.axis.openmeetings.org') d = ImportDoctor(imp) client = Client(url, doctor = d) client.service.getSession() Traceback (most recent call last): File "", line 1, in File "/usr/lib/python2.6/site-packages/suds/client.py", line 539, in call return client.invoke(args, kwargs) File "/usr/lib/python2.6/site-packages/suds/client.py", line 598, in invoke result = self.send(msg) File "/usr/lib/python2.6/site-packages/suds/client.py", line 627, in send result = self.succeeded(binding, reply.message) File "/usr/lib/python2.6/site-packages/suds/client.py", line 659, in succeeded r, p = binding.get_reply(self.method, reply) File "/usr/lib/python2.6/site-packages/suds/bindings/binding.py", line 159, in get_reply resolved = rtypes[0].resolve(nobuiltin=True) File "/usr/lib/python2.6/site-packages/suds/xsd/sxbasic.py", line 63, in resolve raise TypeNotFound(qref) suds.TypeNotFound: Type not found: '(Sessiondata, http__basic.beans.hibernate.app.openmeetings.org/xsd, )' what i'm doing wrong? please help and sorry for my english, but you are my last chance to save position :( need webinars at morning (2.26 am now)

    Read the article

  • Look for match in a nested list in Python

    - by elfuego1
    Hello everybody, I have two nested lists of different sizes: A = [[1, 7, 3, 5], [5, 5, 14, 10]] B = [[1, 17, 3, 5], [1487, 34, 14, 74], [1487, 34, 3, 87], [141, 25, 14, 10]] I'd like to gather all nested lists from list B if A[2:4] == B[2:4] and put it into list L: L = [[1, 17, 3, 5], [141, 25, 14, 10]] Additionally if the match occurs then I want to change last element of sublist B into first element of sublist A so the final solution would look like this: L1 = [[1, 17, 3, 1], [141, 25, 14, 5]]

    Read the article

  • [Python/Tkinter] Grid within a frame?

    - by Sam
    Is it possible to place a grid of buttons in Tkinter inside another frame? I'm wanting to create a tic-tac-toe like game and want to use the grid feature to put gamesquares (that will be buttons). However, I'd like to have other stuff in the GUI other than just the game board so it's not ideal to just have everything in the one grid. To illustrate: O | X | X | ---------- | O | O | X | Player 2 wins! ---------- | X | O | X | The tic tac toe board is in a grid that is made up of all buttons and the 'player 2 wins' is a label inside a frame. This is an oversimplification of what I'm trying to do so bear with me, for the way I've designed the program so far (the board is dynamically created) a grid makes the most sense.

    Read the article

  • supply inputs to python unittests

    - by zubin71
    I`m relatively new to the concept of unit-testing and have very little experience in the same. I have been looking at lots of articles on how to write unit-tests; however, I still have difficulty in writing tests where conditions like the following arise:- Test user Input. Test input read from a file. Test input read from an environment variable. Itd be great if someone could show me how to approach the above mentioned scenarios; itd still be awesome if you could point me to a few docs/articles/blog posts which I could read.

    Read the article

  • Dynamic Operator Overloading on dict classes in Python

    - by Ishpeck
    I have a class that dynamically overloads basic arithmetic operators like so... import operator class IshyNum: def __init__(self, n): self.num=n self.buildArith() def arithmetic(self, other, o): return o(self.num, other) def buildArith(self): map(lambda o: setattr(self, "__%s__"%o,lambda f: self.arithmetic(f, getattr(operator, o))), ["add", "sub", "mul", "div"]) if __name__=="__main__": number=IshyNum(5) print number+5 print number/2 print number*3 print number-3 But if I change the class to inherit from the dictionary (class IshyNum(dict):) it doesn't work. I need to explicitly def __add__(self, other) or whatever in order for this to work. Why?

    Read the article

  • Python - pickling fails for numpy.void objects

    - by I82Much
    >>> idmapfile = open("idmap", mode="w") >>> pickle.dump(idMap, idmapfile) >>> idmapfile.close() >>> idmapfile = open("idmap") >>> unpickled = pickle.load(idmapfile) >>> unpickled == idMap False idMap[1] {1537: (552, 1, 1537, 17.793827056884766, 3), 1540: (4220, 1, 1540, 19.31205940246582, 3), 1544: (592, 1, 1544, 18.129131317138672, 3), 1675: (529, 1, 1675, 18.347782135009766, 3), 1550: (4048, 1, 1550, 19.31205940246582, 3), 1424: (1528, 1, 1424, 19.744396209716797, 3), 1681: (1265, 1, 1681, 19.596025466918945, 3), 1560: (3457, 1, 1560, 20.530569076538086, 3), 1690: (477, 1, 1690, 17.395542144775391, 3), 1691: (554, 1, 1691, 13.446117401123047, 3), 1436: (3010, 1, 1436, 19.596025466918945, 3), 1434: (3183, 1, 1434, 19.744396209716797, 3), 1441: (3570, 1, 1441, 20.589576721191406, 3), 1435: (476, 1, 1435, 19.640911102294922, 3), 1444: (527, 1, 1444, 17.98480224609375, 3), 1478: (1897, 1, 1478, 19.596025466918945, 3), 1575: (614, 1, 1575, 19.371648788452148, 3), 1586: (2189, 1, 1586, 19.31205940246582, 3), 1716: (3470, 1, 1716, 19.158674240112305, 3), 1590: (2278, 1, 1590, 19.596025466918945, 3), 1463: (991, 1, 1463, 19.31205940246582, 3), 1594: (1890, 1, 1594, 19.596025466918945, 3), 1467: (1087, 1, 1467, 19.31205940246582, 3), 1596: (3759, 1, 1596, 19.744396209716797, 3), 1602: (3011, 1, 1602, 20.530569076538086, 3), 1547: (490, 1, 1547, 17.994071960449219, 3), 1605: (658, 1, 1605, 19.31205940246582, 3), 1606: (1794, 1, 1606, 16.964881896972656, 3), 1719: (1826, 1, 1719, 19.596025466918945, 3), 1617: (583, 1, 1617, 11.894925117492676, 3), 1492: (3441, 1, 1492, 20.500667572021484, 3), 1622: (3215, 1, 1622, 19.31205940246582, 3), 1628: (2761, 1, 1628, 19.744396209716797, 3), 1502: (1563, 1, 1502, 19.596025466918945, 3), 1632: (1108, 1, 1632, 15.457141876220703, 3), 1468: (3779, 1, 1468, 19.596025466918945, 3), 1642: (3970, 1, 1642, 19.744396209716797, 3), 1518: (612, 1, 1518, 18.570245742797852, 3), 1647: (854, 1, 1647, 16.964881896972656, 3), 1650: (2099, 1, 1650, 20.439058303833008, 3), 1651: (540, 1, 1651, 18.552841186523438, 3), 1653: (613, 1, 1653, 19.237197875976563, 3), 1532: (537, 1, 1532, 18.885730743408203, 3)} >>> unpickled[1] {1537: (64880, 1638, 56700, -1.0808743559293829e+18, 152), 1540: (64904, 1638, 0, 0.0, 0), 1544: (54472, 1490, 0, 0.0, 0), 1675: (6464, 1509, 0, 0.0, 0), 1550: (43592, 1510, 0, 0.0, 0), 1424: (43616, 1510, 0, 0.0, 0), 1681: (0, 0, 0, 0.0, 0), 1560: (400, 152, 400, 2.1299736657737219e-43, 0), 1690: (408, 152, 408, 2.7201111331839077e+26, 34), 1435: (424, 152, 61512, 1.0122952080313192e-39, 0), 1436: (400, 152, 400, 20.250289916992188, 3), 1434: (424, 152, 62080, 1.0122952080313192e-39, 0), 1441: (400, 152, 400, 12.250144958496094, 3), 1691: (424, 152, 42608, 15.813941955566406, 3), 1444: (400, 152, 400, 19.625289916992187, 3), 1606: (424, 152, 42432, 5.2947192852601414e-22, 41), 1575: (400, 152, 400, 6.2537390010262572e-36, 0), 1586: (424, 152, 42488, 1.0122601755697111e-39, 0), 1716: (400, 152, 400, 6.2537390010262572e-36, 0), 1590: (424, 152, 64144, 1.0126357235581501e-39, 0), 1463: (400, 152, 400, 6.2537390010262572e-36, 0), 1594: (424, 152, 32672, 17.002994537353516, 3), 1467: (400, 152, 400, 19.750289916992187, 3), 1596: (424, 152, 7176, 1.0124003054161436e-39, 0), 1602: (400, 152, 400, 18.500289916992188, 3), 1547: (424, 152, 7000, 1.0124003054161436e-39, 0), 1605: (400, 152, 400, 20.500289916992188, 3), 1478: (424, 152, 42256, -6.0222748507426518e+30, 222), 1719: (400, 152, 400, 6.2537390010262572e-36, 0), 1617: (424, 152, 16472, 1.0124283313854301e-39, 0), 1492: (400, 152, 400, 6.2537390010262572e-36, 0), 1622: (424, 152, 35304, 1.0123190301052127e-39, 0), 1628: (400, 152, 400, 6.2537390010262572e-36, 0), 1502: (424, 152, 63152, 19.627988815307617, 3), 1632: (400, 152, 400, 19.375289916992188, 3), 1468: (424, 152, 38088, 1.0124213248931084e-39, 0), 1642: (400, 152, 400, 6.2537390010262572e-36, 0), 1518: (424, 152, 63896, 1.0127436235399031e-39, 0), 1647: (400, 152, 400, 6.2537390010262572e-36, 0), 1650: (424, 152, 53424, 16.752857208251953, 3), 1651: (400, 152, 400, 19.250289916992188, 3), 1653: (424, 152, 50624, 1.0126497365427934e-39, 0), 1532: (400, 152, 400, 6.2537390010262572e-36, 0)} The keys come out fine, the values are screwed up. I tried same thing loading file in binary mode; didn't fix the problem. Any idea what I'm doing wrong? Edit: Here's the code with binary. Note that the values are different in the unpickled object. >>> idmapfile = open("idmap", mode="wb") >>> pickle.dump(idMap, idmapfile) >>> idmapfile.close() >>> idmapfile = open("idmap", mode="rb") >>> unpickled = pickle.load(idmapfile) >>> unpickled==idMap False >>> unpickled[1] {1537: (12176, 2281, 56700, -1.0808743559293829e+18, 152), 1540: (0, 0, 15934, 2.7457842047810522e+26, 108), 1544: (400, 152, 400, 4.9518498821046956e+27, 53), 1675: (408, 152, 408, 2.7201111331839077e+26, 34), 1550: (456, 152, 456, -1.1349175514578289e+18, 152), 1424: (432, 152, 432, 4.5939047815653343e-40, 11), 1681: (408, 152, 408, 2.1299736657737219e-43, 0), 1560: (376, 152, 376, 2.1299736657737219e-43, 0), 1690: (376, 152, 376, 2.1299736657737219e-43, 0), 1435: (376, 152, 376, 2.1299736657737219e-43, 0), 1436: (376, 152, 376, 2.1299736657737219e-43, 0), 1434: (376, 152, 376, 2.1299736657737219e-43, 0), 1441: (376, 152, 376, 2.1299736657737219e-43, 0), 1691: (376, 152, 376, 2.1299736657737219e-43, 0), 1444: (376, 152, 376, 2.1299736657737219e-43, 0), 1606: (25784, 2281, 376, -3.2883343074537754e+26, 34), 1575: (24240, 2281, 376, 2.1299736657737219e-43, 0), 1586: (24240, 2281, 376, 2.1299736657737219e-43, 0), 1716: (24240, 2281, 376, -3.0093091599657311e-35, 26), 1590: (24240, 2281, 376, 2.1299736657737219e-43, 0), 1463: (24240, 2281, 376, 2.1299736657737219e-43, 0), 1594: (24240, 2281, 376, -4123208450048.0, 196), 1467: (25784, 2281, 376, 2.1299736657737219e-43, 0), 1596: (25784, 2281, 376, 2.1299736657737219e-43, 0), 1602: (25784, 2281, 376, -5.9963281433905448e+26, 76), 1547: (25784, 2281, 376, -218106240.0, 139), 1605: (25784, 2281, 376, -3.7138649803377281e+27, 56), 1478: (376, 152, 376, 2.1299736657737219e-43, 0), 1719: (25784, 2281, 376, 2.1299736657737219e-43, 0), 1617: (25784, 2281, 376, -1.4411779941597184e+17, 237), 1492: (25784, 2281, 376, 2.8596493694487798e-30, 80), 1622: (25784, 2281, 376, 184686084096.0, 93), 1628: (1336, 152, 1336, 3.1691839245470052e+29, 179), 1502: (1272, 152, 1272, -5.2042207205116645e-17, 99), 1632: (1208, 152, 1208, 2.1299736657737219e-43, 0), 1468: (1144, 152, 1144, 2.1299736657737219e-43, 0), 1642: (1080, 152, 1080, 2.1299736657737219e-43, 0), 1518: (1016, 152, 1016, 4.0240902787680023e+35, 145), 1647: (952, 152, 952, -985172619034624.0, 237), 1650: (888, 152, 888, 12094787289088.0, 66), 1651: (824, 152, 824, 2.1299736657737219e-43, 0), 1653: (760, 152, 760, 0.00018310768064111471, 238), 1532: (696, 152, 696, 8.8978061885676389e+26, 125)} OK I've isolated the problem, but don't know why it's so. First, apparently what I'm pickling are not tuples (though they look like it), but instead numpy.void types. Here is a series to illustrate the problem. first = run0.detections[0] >>> first (1, 19, 1578, 82.637763977050781, 1) >>> type(first) <type 'numpy.void'> >>> firstTuple = tuple(first) >>> theFile = open("pickleTest", "w") >>> pickle.dump(first, theFile) >>> theTupleFile = open("pickleTupleTest", "w") >>> pickle.dump(firstTuple, theTupleFile) >>> theFile.close() >>> theTupleFile.close() >>> first (1, 19, 1578, 82.637763977050781, 1) >>> firstTuple (1, 19, 1578, 82.637764, 1) >>> theFile = open("pickleTest", "r") >>> theTupleFile = open("pickleTupleTest", "r") >>> unpickledTuple = pickle.load(theTupleFile) >>> unpickledVoid = pickle.load(theFile) >>> type(unpickledVoid) <type 'numpy.void'> >>> type(unpickledTuple) <type 'tuple'> >>> unpickledTuple (1, 19, 1578, 82.637764, 1) >>> unpickledTuple == firstTuple True >>> unpickledVoid == first False >>> unpickledVoid (7936, 1705, 56700, -1.0808743559293829e+18, 152) >>> first (1, 19, 1578, 82.637763977050781, 1)

    Read the article

  • Optimizing python link matching regular expression

    - by Matt
    I have a regular expression, links = re.compile('<a(.+?)href=(?:"|\')?((?:https?://|/)[^\'"]+)(?:"|\')?(.*?)>(.+?)</a>',re.I).findall(data) to find links in some html, it is taking a long time on certain html, any optimization advice? One that it chokes on is http://freeyourmindonline.net/Blog/

    Read the article

  • match strings in python

    - by mesun
    Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring. Complete the definition def constrainedMatchPair(firstMatch,secondMatch,length):

    Read the article

  • Python: Taking an array and break it into subarrays based on some criteria

    - by randombits
    I have an array of files. I'd like to be able to break that array down into one array with multiple subarrays, each subarray contains files that were created on the same day. So right now if the array contains files from March 1 - March 31, I'd like to have an array with 31 subarrays (assuming there is at least 1 file for each day). In the long run, I'm trying to find the file from each day with the latest creation/modification time. If there is a way to bundle that into the iterations that are required above to save some CPU cycles, that would be even more ideal. Then I'd have one flat array with 31 files, one for each day, for the latest file created on each individual day.

    Read the article

  • strip spaces in python.

    - by Richard
    ok I know that this should be simple... anyways say: line = "$W5M5A,100527,142500,730301c44892fd1c,2,686.5 4,333.96,0,0,28.6,123,75,-0.4,1.4*49" I want to strip out the spaces. I thought you would just do this line = line.strip() but now line is still '$W5M5A,100527,142500,730301c44892fd1c,2,686.5 4,333.96,0,0,28.6,123,75,-0.4,1.4*49' instead of '$W5M5A,100527,142500,730301c44892fd1c,2,686.54,333.96,0,0,28.6,123,75,-0.4,1.4*49' any thoughts?

    Read the article

  • How to print a dictionary in python c api function

    - by dizgam
    PyObject* dict = PyDict_New(); PyDict_SetItem(dict, key, value); PyDict_GetItem(dict, key); Bus error if i use getitem function otherwise not. So Want to confirm that the dictionary has the same values which i have set. Other than using PyDict_GetItem function, Is there any other method to print the values of the dictionary?

    Read the article

  • Caching result of setUp() using Python unittest

    - by dbr
    I currently have a unittest.TestCase that looks like.. class test_appletrailer(unittest.TestCase): def setup(self): self.all_trailers = Trailers(res = "720", verbose = True) def test_has_trailers(self): self.failUnless(len(self.all_trailers) > 1) # ..more tests.. This works fine, but the Trailers() call takes about 2 seconds to run.. Given that setUp() is called before each test is run, the tests now take almost 10 seconds to run (with only 3 test functions) What is the correct way of caching the self.all_trailers variable between tests? Removing the setUp function, and doing.. class test_appletrailer(unittest.TestCase): all_trailers = Trailers(res = "720", verbose = True) ..works, but then it claims "Ran 3 tests in 0.000s" which is incorrect.. The only other way I could think of is to have a cache_trailers global variable (which works correctly, but is rather horrible): cache_trailers = None class test_appletrailer(unittest.TestCase): def setUp(self): global cache_trailers if cache_trailers is None: cache_trailers = self.all_trailers = all_trailers = Trailers(res = "720", verbose = True) else: self.all_trailers = cache_trailers

    Read the article

  • python cairoplot store previous readings..

    - by krisdigitx
    hi, i am using cairoplot, to make graphs, however the file from where i am reading the data is growing huge and its taking a long time to process the graph is there any real-time way to produce cairo graph, or at least store the previous readings..like rrd. -krisdigitx

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Python - Subprocess Popen and Thread error

    - by n0idea
    In both functions record and ftp, i have subprocess.Popen if __name__ == '__main__': try: t1 = threading.Thread(target = record) t1.daemon = True t1.start() t2 = threading.Thread(target = ftp) t2.daemon = True t2.start() except (KeyboardInterrupt, SystemExit): sys.exit() The error I'm receiving is: Exception in thread Thread-1 (most likely raised during interpreter shutdown): Traceback (most recent call last): File "/usr/lib/python2.7/threading.py", line 551, in __bootstrap_inner File "/usr/lib/python2.7/threading.py", line 504, in run File "./in.py", line 20, in recordaudio File "/usr/lib/python2.7/subprocess.py", line 493, in call File "/usr/lib/python2.7/subprocess.py", line 679, in __init__ File "/usr/lib/python2.7/subprocess.py", line 1237, in _execute_child <type 'exceptions.AttributeError'>: 'NoneType' object has no attribute 'close' What might the issue be ?

    Read the article

< Previous Page | 156 157 158 159 160 161 162 163 164 165 166 167  | Next Page >