Search Results

Search found 4670 results on 187 pages for 'jvm arguments'.

Page 164/187 | < Previous Page | 160 161 162 163 164 165 166 167 168 169 170 171  | Next Page >

  • Best way to use Google's hosted jQuery, but fall back to my hosted library on Google fail

    - by Nosredna
    What would be a good way to attempt to load the hosted jQuery at Google (or other Google hosted libs), but load my copy of jQuery if the Google attempt fails? I'm not saying Google is flaky. There are cases where the Google copy is blocked (apparently in Iran, for instance). Would I set up a timer and check for the jQuery object? What would be the danger of both copies coming through? Not really looking for answers like "just use the Google one" or "just use your own." I understand those arguments. I also understand that the user is likely to have the Google version cached. I'm thinking about fallbacks for the cloud in general. Edit: This part added... Since Google suggests using google.load to load the ajax libraries, and it performs a callback when done, I'm wondering if that's the key to serializing this problem. I know it sounds a bit crazy. I'm just trying to figure out if it can be done in a reliable way or not. Update: jQuery now hosted on Microsoft's CDN. http://www.asp.net/ajax/cdn/

    Read the article

  • What else I must do allow my method to handle any type of objects

    - by NewHelpNeeder
    So to allow any type object I must use generics in my code. I have rewrote this method to do so, but then when I create an object, for example Milk, it won't let me pass it to my method. Ether there's something wrong with my generic revision, or Milk object I created is not good. How should I pass my object correctly and add it to linked list? This is a method that causes error when I insert an item: public void insertFirst(T dd) // insert at front of list { Link newLink = new Link(dd); // make new link if( isEmpty() ) // if empty list, last = newLink; // newLink <-- last else first.previous = newLink; // newLink <-- old first newLink.next = first; // newLink --> old first first = newLink; // first --> newLink } This is my class I try to insert into linked list: class Milk { String brand; double size; double price; Milk(String a, double b, double c) { brand = a; size = b; price = c; } } This is test method to insert the data: public static void main(String[] args) { // make a new list DoublyLinkedList theList = new DoublyLinkedList(); // this causes: // The method insertFirst(Comparable) in the type DoublyLinkedList is not applicable for the arguments (Milk) theList.insertFirst(new Milk("brand", 1, 2)); // insert at front theList.displayForward(); // display list forward theList.displayBackward(); // display list backward } // end main() } // end class DoublyLinkedApp Declarations: class Link<T extends Comparable<T>> {} class DoublyLinkedList<T extends Comparable<T>> {}

    Read the article

  • Android : start intent in setOnClickListener

    - by Derek
    I have a button, and this button is going to get the values from EditText, then using this value to start a new Intent protected void onCreate(Bundle savedInstanceState) { textDay = (EditText) findViewById(R.id.textDay); textMonth = (EditText) findViewById(R.id.textMonth); textYear = (EditText) findViewById(R.id.textYear); gen = (Button) findViewById(R.id.getGraph); gen.setOnClickListener(new View.OnClickListener() { public void onClick(View v) { getthisIntent(); } public Intent getthisIntent(Context context) { day = textDay.getText(); month = textMonth.getText(); year = textYear.getText(); date = day + "/" + month + "/" + year; . .// Plot graph using AchartEngine, then return an Intent // . } } }); but i get the error "The method getthisIntent(Context) in the type new View.OnClickListener(){} is not applicable for the arguments ()" Can i get some help? or do i have another alternative solution, when i click the button, then the button pass the values to the new intent, and start it without having a new xxx.java file? Edit This is basically what I am doing now, i need to get the things inserted by user, and plot a graph, the only way i know how to plot graph using AchartEngine is create a new activity with define this public Intent getthisIntent(Context context) To be honest, i dont really know what the hell I am doing, please correct me...

    Read the article

  • Sharing rails fragments between formats

    - by Julian
    Hi I'm toying with mobile_fu and want to share some fragments between the different views. E.g. views/ item/ view.html.erb view.mobile.rb shared/ _common.erb In both view.html.erb and view.mobile.erb I want to share the same fragment '_common.erb' without having to specify the format (should you ever have to specify the format inside a fragment? It doesn't seem like The Rails Way?). Let's say for arguments's sake it's because it's in a helper or whatever -- the point is that I need to share fragments in a 'well-defined and Railsy way' across formats. Let's take this fairly innocuous snippet <% render :fragment => 'shared/common' %> I've tried 3 file name conventions: _common.html.erb only works for html /item/view/xx fails with 'shared/_common.erb not found') however _common.erb fails for html and works for mobile (maybe mobile_fu is doing something wacky?) -- same error as for .html.erb version above _common.rhtml does work for both I'm thinking that: that rhtml works for both is a legacy hack and I'm loathe to rename all the shared fragments .rhtml to get the behaviour I want. Any feedback gratefully welcome! Including 'you fundamentally don't understand how Rails works please RTFM here: http://....' :)

    Read the article

  • Thread mutex behaviour

    - by Alberteddu
    Hi there, I'm learning C. I'm writing an application with multiple threads; I know that when a variable is shared between two or more threads, it is better to lock/unlock using a mutex to avoid deadlock and inconsistency of variables. This is very clear when I want to change or view one variable. int i = 0; /** Global */ static pthread_mutex_t mutex = PTHREAD_MUTEX_INITIALIZER; /** Thread 1. */ pthread_mutex_lock(&mutex); i++; pthread_mutex_unlock(&mutex); /** Thread 2. */ pthread_mutex_lock(&mutex); i++; pthread_mutex_unlock(&mutex); This is correct, I think. The variable i, at the end of the executions, contains the integer 2. Anyway, there are some situations in which I don't know exactly where to put the two function calls. For example, suppose you have a function obtain(), which returns a global variable. I need to call that function from within the two threads. I have also two other threads that call the function set(), defined with a few arguments; this function will set the same global variable. The two functions are necessary when you need to do something before getting/setting the var. /** (0) */ /** Thread 1, or 2, or 3... */ if(obtain() == something) { if(obtain() == somethingElse) { // Do this, sometimes obtain() and sometimes set(random number) (1) } else { // Do that, just obtain(). (2) } } else { // Do this and do that (3) // If # of thread * 3 > 10, then set(3*10) For example. (4) } /** (5) */ Where I have to lock, and where I have to unlock? The situation can be, I think, even more complex. I will appreciate an exhaustive answer. Thank you in advance. —Alberto

    Read the article

  • Node.js/Express Partials problem: Can't be nested too deep?

    - by heorling
    I'm learning Node.js, Express, haml.js and liking it. I've run into a prety annoying problem though. I'm pretty new to this but have been getting nice results so far. I'm writing a jquery heavy web app that relies on a table containing divs. The divs slide around, switch back and fourth and are resized etc to my hearts content. What I'm looking for a way to switch (template?) the divs. Since I've been building in express and mimicking the chat example it would make sense to use partials. The rub is that I've been using inexplicit divs in haml, held within a td. The divs are cunstructed as follows: %tr %td .class1.class2.class3.classetc Which has worked fine cross browser. Parsing the classes works great for the js code to pass arguments around, fetch values etc. What I'd like to be able to do is something like: %tr %td .class1.class2.class3.classetc %ul#messages != this.partial('message.html.haml', { collection: messages }) Any combination I've tried with this has failed however. And I might have tried them all. If I could put a partial into that div I'd probably be set. And you can nest them as long as you use #ids instead of .classes. But if you use more than one class it breaks! I think that's the most accurate way of summing it up. How do you do this? I've checked out various templating solutions like mu.js and micro template like by John Resig. I earlier checked out this thread on templating engines. It's very possible I'm making some fundamental mistake here, I'm new to this. What's a good way to do this?

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • How to throw meaningful data in exceptions ?

    - by ZeroCool
    I would like to throw exceptions with meaningful explanation ! I thought of using variable arguments worked fine but lately I figured out it's impossible to extend the class in order to implement other exception types. So I figured out using an std::ostreamstring as a an internal buffer to deal with formatting ... but doesn't compile! I guess it has something to deal with copy constructors. Anyhow here is my piece of code: class Exception: public std::exception { public: Exception(const char *fmt, ...); Exception(const char *fname, const char *funcname, int line, const char *fmt, ...); //std::ostringstream &Get() { return os_ ; } ~Exception() throw(); virtual const char *what() const throw(); protected: char err_msg_[ERRBUFSIZ]; //std::ostringstream os_; }; The variable argumens constructor can't be inherited from! this is why I thought of std::ostringstream! Any advice on how to implement such approach ?

    Read the article

  • Adding text read from a file to an array list in java

    - by user1824856
    I am having trouble putting text read from a file into an array list. My text looks like this: 438;MIA;JFK;10:55;1092;447 638;JFK;MIA;19:45;1092;447 689;ATL;DFW;12:50;732;448 etc... My code looks like this: package filesexample; import java.io.*; import java.io.FileNotFoundException; import java.util.Scanner; import java.util.ArrayList; /** * * @author */ public class FilesExample { /** * @param args the command line arguments */ public static void main(String[] args) throws IOException { File file = new File ("/Schedule.txt"); try { Scanner scanner= new Scanner(file);; while (scanner.hasNextLine()) { String line = scanner.nextLine(); Scanner lineScanner= new Scanner(line); lineScanner.useDelimiter(";"); while(lineScanner.hasNext()){ String part = lineScanner.next(); System.out.print(part + " "); } System.out.println(); } }catch (FileNotFoundException e){ e.printStackTrace(); } } } Some help on getting started would be much appreciated thank you!

    Read the article

  • Haskell quiz: a simple function

    - by levy
    I'm not a Haskell programmer, but I'm curious about the following questions. Informal function specification: Let MapProduct be a function that takes a function called F and multiple lists. It returns a list containing the results of calling F with one argument from each list in each possible combination. Example: Call MapProduct with F being a function that simply returns a list of its arguments, and two lists. One of the lists contains the integers 1 and 2, the other one contains the strings "a" and "b". It should return a list that contains the lists: 1 and "a", 1 and "b", 2 and "a", 2 and "b". Questions: How is MapProduct implemented? What is the function's type? What is F's type? Can one guess what the function does just by looking at its type? Can you handle inhomogeneous lists as input? (e.g. 1 and "a" in one of the input lists) What extra limitation (if any) do you need to introduce to implement MapProduct?

    Read the article

  • Troubleshooting multiple GET variables In PHP

    - by V413HAV
    This may be a very simple question but I don't what's the wrong thing am doing here... To explain you clearly, I've set a real simple example below: <ul> <li><a href="test.php?link1=true">Link 1</a></li> <li><a href="test.php?link2=true">Link 2</a></li> <li><a href="test.php?link3=true">Link 3</a></li> </ul> <?php if(isset($_GET['link1'])) { if(($_GET['link1']) == 'true') { echo 'This Is Link 1'; } } if(isset($_GET['link2'])) { if(($_GET['link2']) == 'true') { echo 'This Is Link 2'; } } if(isset($_GET['link3'])) { if(($_GET['link3']) == 'true') { echo 'This Is Link 3'; } } ?> This is a test.php page, here I've set 3 different arguments for $_GET, and show contents accordingly, now everything works perfect, the only thing am not understanding is how to block this kind of url say if user clicks on link 1 the url will be : http://localhost/test.php?link1=true And the Output of this url is This is Link 1 Now if I change this url to : http://localhost/test.php?link3=true&link2=true&link1=true And the Output what I get is This Is Link 1This Is Link 2This Is Link 3 Now this is ok here, but it's very annoying if someone types this and see's forms one below the other, any way I can stop this tampering?

    Read the article

  • Change Sequence to Choice

    - by Gordon
    In my Schema File I defined a Group with a Sequence of possible Elements. <group name="argumentGroup"> <sequence> <element name="foo" type="double" /> <element name="bar" type="string" /> <element name="baz" type="integer" /> </sequence> </group> I then reference this Group like this: <element name="arguments"> <complexType> <group ref="my:argumentGroup"/> </complexType> </element> Is it possible to reference the Group at some other point but restrict it so it's a Choice instead of a Sequence. The position where I want to reuse it would only allow one of the Elements within. <element name="argument" minOccurs="0" maxOccurs="1"> <complexType> <group name="my:argumentGroup"> <! -- Somehow change argumentGroup sequence to choice here --> </group> <complexType> </element>

    Read the article

  • How to detect the root recursive call?

    - by ahmadabdolkader
    Say we're writing a simple recursive function fib(n) that calculates the nth Fibonacci number. Now, we want the function to print that nth number. As the same function is being called repeatedly, there has to be a condition that allows only the root call to print. The question is: how to write this condition without passing any additional arguments, or using global/static variables. So, we're dealing with something like this: int fib(int n) { if(n <= 0) return 0; int fn = 1; if(n > 2) fn = fib(n-2) + fib(n-1); if(???) cout << fn << endl; return fn; } int main() { fib(5); return 0; } I thought that the root call differs from all children by returning to a different caller, namely the main method in this example. I wanted to know whether it is possible to use this property to write the condition and how. Update: please note that this is a contrived example that only serves to present the idea. This should be clear from the tags. I'm not looking for standard solutions. Thanks.

    Read the article

  • Error while sending mail (attachment file)

    - by Surya sasidhar
    hi, in my application i am using to send mail with attachments i write the code like this Using System.Net.Mail; MailMessage mail = new MailMessage(); mail.Body = "<html><body><b> Name Of The Job Seeker: " + txtName.Text + "<br><br>" + "The Mail ID:" + txtEmail.Text + "<br><br>" + " The Mobile Number: " + txtmobile.Text + "<br><br>" + "Position For Applied: " + txtPostionAppl.Text + "<br><br>" + "Description " + txtdescript.Text + "<br><br></b></body></html>"; mail.From = new MailAddress ( txtEmail.Text); mail.To .Add (new MailAddress ( mailid)); mail.Priority = MailPriority.High; FileUpload1.PostedFile.SaveAs("~/Resume/" + FileUpload1.FileName); mail.Attachments.Add(filenme); SmtpMail sm = new SmtpMail(); sm.Send(mail); it is giving error at attachment like mail.Attachemts.Add(filena) like this 'System.Collections.ObjectModel.Collection.Add(System.Net.Mail.Attachment)' has some invalid arguments.

    Read the article

  • Why C++ is (one of) the best language to learn at first [closed]

    - by AlexV
    C++ is one of the most used programming language in the world since like 25+ years. My first job as programmer was in C++ and I coded in C++ everyday for nearly 4 years. Now I do mostly PHP, but I will forever cherish this C++ background. C++ has helped me understand many "under the hood" features/behaviors/restrictions of many other (and different) programming languages like PHP and Delphi. I'm a full time programmer for 6+ years now and since I have a quite varied programming background I often get questions by "newbies" as where to start to become a "good" programmer. I think C++ is one of the best language to start with because it gives you a real usefull experience that will last and will teach you how things work under the hood. It's not the easier one to learn for a newbie, but in my opinion it's the one who will reward the most in long term. I would like to know your opinion on this matter to add to my arguments when I guide "newbies". After this introduction, here's my question : Why C++ is for you (one of) the best language to learn at first. Since it's subjective, I've marked this question as community wiki.

    Read the article

  • Should constant contructor aguments be passed by reference or value?

    - by Mike
    When const values are passed to an object construct should they be passed by reference or value? If you pass by value and the arguments are immediately fed to initializes are two copies being made? Is this something that the compiler will automatically take care of. I have noticed that all textbook examples of constructors and intitializers pass by value but this seems inefficient to me. class Point { public: int x; int y; Point(const int _x, const int _y) : x(_x), y(_y) {} }; int main() { const int a = 1, b = 2; Point p(a,b); Point q(3,5); cout << p.x << "," << p.y << endl; cout << q.x << "," << q.y << endl; } vs. class Point { public: int x; int y; Point(const int& _x, const int& _y) : x(_x), y(_y) {} }; Both compile and do the same thing but which is correct?

    Read the article

  • Compile C++ in Visual Studio

    - by Kasun
    Hi All.. I use this method to compile C++ file in VS. But even i provide the correct file it returns false. Can any one help me... This is class called CL class CL { private const string clexe = @"cl.exe"; private const string exe = "Test.exe", file = "test.cpp"; private string args; public CL(String[] args) { this.args = String.Join(" ", args); this.args += (args.Length > 0 ? " " : "") + "/Fe" + exe + " " + file; } public Boolean Compile(String content, ref string errors) { if (File.Exists(exe)) File.Delete(exe); if (File.Exists(file)) File.Delete(file); File.WriteAllText(file, content); Process proc = new Process(); proc.StartInfo.UseShellExecute = false; proc.StartInfo.RedirectStandardOutput = true; proc.StartInfo.RedirectStandardError = true; proc.StartInfo.FileName = clexe; proc.StartInfo.Arguments = this.args; proc.StartInfo.CreateNoWindow = true; proc.Start(); //errors += proc.StandardError.ReadToEnd(); errors += proc.StandardOutput.ReadToEnd(); proc.WaitForExit(); bool success = File.Exists(exe); return success; } } This is my button click event private void button1_Click(object sender, EventArgs e) { string content = "#include <stdio.h>\nmain(){\nprintf(\"Hello world\");\n}\n"; string errors = ""; CL k = new CL(new string[] { }); if (k.Compile(content, ref errors)) Console.WriteLine("Success!"); else MessageBox.Show("Errors are : ", errors); }

    Read the article

  • Java: refactoring static constants

    - by akf
    We are in the process of refactoring some code. There is a feature that we have developed in one project that we would like to now use in other projects. We are extracting the foundation of this feature and making it a full-fledged project which can then be imported by its current project and others. This effort has been relatively straight-forward but we have one headache. When the framework in question was originally developed, we chose to keep a variety of constant values defined as static fields in a single class. Over time this list of static members grew. The class is used in very many places in our code. In our current refactoring, we will be elevating some of the members of this class to our new framework, but leaving others in place. Our headache is in extracting the foundation members of this class to be used in our new project, and more specifically, how we should address those extracted members in our existing code. We know that we can have our existing Constants class subclass this new project's Constants class and it would inherit all of the parent's static members. This would allow us to effect the change without touching the code that uses these members to change the class name on the static reference. However, the tight coupling inherent in this choice doesn't feel right. before: public class ConstantsA { public static final String CONSTANT1 = "constant.1"; public static final String CONSTANT2 = "constant.2"; public static final String CONSTANT3 = "constant.3"; } after: public class ConstantsA extends ConstantsB { public static final String CONSTANT1 = "constant.1"; } public class ConstantsB { public static final String CONSTANT2 = "constant.2"; public static final String CONSTANT3 = "constant.3"; } In our existing code branch, all of the above would be accessible in this manner: ConstantsA.CONSTANT2 I would like to solicit arguments about whether this is 'acceptable' and/or what the best practices are.

    Read the article

  • Compile time error: cannot convert from specific type to a generic type

    - by Water Cooler v2
    I get a compile time error with the following relevant code snippet at the line that calls NotifyObservers in the if construct. public class ExternalSystem<TEmployee, TEventArgs> : ISubject<TEventArgs> where TEmployee : Employee where TEventArgs : EmployeeEventArgs { protected List<IObserver<TEventArgs>> _observers = null; protected List<TEmployee> _employees = null; public virtual void AddNewEmployee(TEmployee employee) { if (_employees.Contains(employee) == false) { _employees.Add(employee); string message = FormatMessage("New {0} hired.", employee); if (employee is Executive) NotifyObservers(new ExecutiveEventArgs { e = employee, msg = message }); else if (employee is BuildingSecurity) NotifyObservers(new BuildingSecurityEventArgs { e = employee, msg = message }); } } public void NotifyObservers(TEventArgs args) { foreach (IObserver<TEventArgs> observer in _observers) observer.EmployeeEventHandler(this, args); } } The error I receive is: The best overloaded method match for 'ExternalSystem.NotifyObservers(TEventArgs)' has some invalid arguments. Cannot convert from 'ExecutiveEventArgs' to 'TEventArgs'. I am compiling this in C# 3.0 using Visual Studio 2008 Express Edition.

    Read the article

  • Passing an arbritrary JavaScript object in Xul

    - by Tom Brito
    I'm following this example to pass an object to a window, but when it as an argument it's with "undefined" value. This is my first window (obs. dump is the way to print to console when debug options are turned on): <?xml version="1.0"?> <?xml-stylesheet href="chrome://global/skin/" type="text/css"?> <!DOCTYPE window SYSTEM "chrome://XulWindowArgTest/locale/XulWindowArgTest.dtd"> <window id="windowID" width="400" height="300" xmlns="http://www.mozilla.org/keymaster/gatekeeper/there.is.only.xul"> <script> <![CDATA[ function onClickMe(event) { dump("begin\n"); try { var args = { param1: true, param2: 42 }; args.wrappedJSObject = args; var watcher = Components.classes["@mozilla.org/embedcomp/window-watcher;1"].getService(Components.interfaces.nsIWindowWatcher); watcher.openWindow(null, "chrome://XulWindowArgTest/content/about.xul", "windowName", "chrome", args); } catch (e) { dump("error: " + e + "\n"); } dump("end\n"); } ]]> </script> <button label="Click me !" oncommand="onClickMe();" /> </window> and my second window: <?xml version="1.0"?> <?xml-stylesheet href="chrome://global/skin/" type="text/css"?> <!DOCTYPE window SYSTEM "chrome://XulWindowArgTest/locale/XulWindowArgTest.dtd"> <window xmlns="http://www.mozilla.org/keymaster/gatekeeper/there.is.only.xul" onload="onload()"> <script> <![CDATA[ function onload() { dump('arg = ' + window.arguments[0].wrappedJSObject + "\n"); } ]]> </script> <label value="test" /> </window> when the second window loads, it calls the onload and prints: arg = undefined Any idea how to fix it?

    Read the article

  • C Map String to Function

    - by Scriptonaut
    So, I'm making a Unix minishell, and have come to a roadblock. I need to be able to execute built-in functions, so I made a function: int exec_if_built_in(char **args) It takes an array of strings(the first being the command, and the rest being arguments). For non built-in commands I simply use something like execvp, however I need to find a way to map the first string to a function. I was thinking of making two arrays, one of strings, and another with their corresponding function pointers. However, since many of these functions will be different(return and accept different things), this approach won't work. I also thought of making an array of structs with a name property and a function pointer property, however once again due to the varied nature of the functions I'll be using, this won't work. So, what's the best way to execute a function based on the input of a string? How do I map a string to a certain function? I'm not very familiar with function pointers so I may be missing something. Thank you guys for the help :)

    Read the article

  • JQuery click anywhere except certain divs and issues with dynamically added html

    - by jCuga
    I want this webpage to highlight certain elements when you click on one of them, but if you click anywhere else on the page, then all of these elements should no longer be highlighted. I accomplished this task by the following, and it works just fine except for one thing (described below): $(document).click(function() { // Do stuff when clicking anywhere but on elements of class suggestion_box $(".suggestion_box").css('background-color', '#FFFFFF'); }); $(".suggestion_box").click(function() { // means you clicked on an object belonging to class suggestion_box return false; }); // the code for handling onclicks for each element function clickSuggestion() { // remove all highlighting $(".suggestion_box").css('background-color', '#FFFFFF'); // then highlight only a specific item $("div[name=" + arguments[0] + "]").css('background-color', '#CCFFCC'); } This way of enforcing the highlighting of elements works fine until I add more html to the page without having a new page load. This is done by .append() and .prepend() What I suspected from debugging was that the page is not "aware" of the new elements that were added to the page dynamically. Despite the new, dynamically added elements having the appropriate class names/IDs/names/onclicks ect, they never get highlighted like the rest of the elements (which continue to work fine the entire time). I was wondering if a possible reason for why my approach does not work for the dynamically added content is that the page is not able to recognize the elements that were not present during the pageload. And if this is a possibility, then is there a way to reconcile this without a pageload? If this line of reasoning is wrong, then the code I have above is probably not enough to show what's wrong with my webpage. But I'm really just interested in whether or not this line of thought is a possibility.

    Read the article

  • Design patterns for Caching Images in a MVC?

    - by Onema
    Hi, I'm designing an image cache system that will be used in an MVC CMS. The main purpose of the image cacher is to modify images: scale, crop, etc and cache them in the client site. I have created an image cache Model and Mapper that interact with the Database, to keep track of the images and know what kind of actions have been applied to them (scale, crop, etc). In addition to the Model and Mapper I have created a ImageCacher Class that is used by the API to manage the Model and image creation based on arguments passed by the client site, this class creates the images and generates the links to the images for the View. A coworker argued that I need to include the functionality of this last Class inside the Model, as the bulk of the logic should go in the model. I respectfully disagree with him since I feel the model's responsibility is to deal with the information about the images cached at the database level, and the responsibility of the ImageCacher Class is to create the url/image that we will be caching (keeping the single responsibility principle). In addition to this I believe that a model should not have Presentation-related features, like creating or showing images. Does anyone have any insight on this? is there a particular design pattern that would make this division of tasks clear and and the image cacher reusable? Should I add all the logic in the Model? Thank you.

    Read the article

  • Problem consuming a dataset via a .NET web service from Flex-ActionScript

    - by DEH
    Hi, I am returning a .NET dataset to Flex Actionscript via a web service. Actionscript snippet as follows: var websvc:WebService = new WebService(); websvc.useProxy=false; websvc.wsdl = "http://localhost:13229/test/mysvc.asmx?WSDL"; websvc.loadWSDL(); var operation:Operation = new Operation(null, "GetData"); operation.arguments.command="xx_gethierdata_"+mode+"_"+identifier; operation.addEventListener(ResultEvent.RESULT, onResultHandler, false, 0, true); operation.addEventListener(FaultEvent.FAULT, onFaultHandler, false, 0, true); operation.resultFormat="object"; websvc.operations = [operation]; operation.send(); Once in the onResultHandler function I have access to the datatable - I then want to grab the column names. The following code outputs my column names: for each (var tcolumn:Object in datatable.Columns){trace('Column:'+tcolumn);} This works ok, but the column names are encoded, so a column name that is actually "1-9" is output as "_x005B_1-9_x005D_" Anyone know the best way to decode the column name? I could replace all the encoding strings, but surely there is a better way? Thanks

    Read the article

  • Creating rapid function overloads in C++

    - by DeadMG
    template<typename Functor, typename Return, typename Arg1, typename Arg2, typename Arg3, typename Arg4, typename Arg5, typename Arg6, typename Arg7, typename Arg8, typename Arg9, typename Arg10> class LambdaCall : public Instruction { public: LambdaCall(Functor func ,unsigned char constructorarg1 ,unsigned char constructorarg2 ,unsigned char constructorarg3 ,unsigned char constructorarg4 ,unsigned char constructorarg5 ,unsigned char constructorarg6 ,unsigned char constructorarg7 ,unsigned char constructorarg8 ,unsigned char constructorarg9 ,unsigned char constructorarg10) : arg1(constructorarg1) , arg2(constructorarg2) , arg3(constructorarg3) , arg4(constructorarg4) , arg5(constructorarg5) , arg6(constructorarg6) , arg7(constructorarg7) , arg8(constructorarg8) , arg9(constructorarg9) , arg10(constructorarg10) , function(func) {} void Call(State& state) { state.Push<Return>(func(*state.GetRegisterValue<Arg1>(arg1) ,*state.GetRegisterValue<Arg1>(arg1) ,*state.GetRegisterValue<Arg2>(arg2) ,*state.GetRegisterValue<Arg3>(arg3) ,*state.GetRegisterValue<Arg4>(arg4) ,*state.GetRegisterValue<Arg5>(arg5) ,*state.GetRegisterValue<Arg6>(arg6) ,*state.GetRegisterValue<Arg7>(arg7) ,*state.GetRegisterValue<Arg8>(arg8) ,*state.GetRegisterValue<Arg9>(arg9) ,*state.GetRegisterValue<Arg10>(arg10) )); } Functor function; unsigned char arg1; unsigned char arg2; unsigned char arg3; unsigned char arg4; unsigned char arg5; unsigned char arg6; unsigned char arg7; unsigned char arg8; unsigned char arg9; unsigned char arg10; }; Then again for every possible number of arguments I want to support, and again for void returns. Any way to do this faster?

    Read the article

< Previous Page | 160 161 162 163 164 165 166 167 168 169 170 171  | Next Page >