Search Results

Search found 14643 results on 586 pages for 'performance comparison'.

Page 164/586 | < Previous Page | 160 161 162 163 164 165 166 167 168 169 170 171  | Next Page >

  • linq: SQL performance on high loaded web applications

    - by Alex
    I started working with linq to SQL several weeks ago. I got really tired of working with SQL server directly through the SQL queries (sqldatareader, sqlcommand and all this good stuff).  After hearing about linq to SQL and mvc I quickly moved all my projects to these technologies. I expected linq to SQL work slower but it suprisongly turned out to be pretty fast, primarily because I always forgot to close my connections when using datareaders. Now I don't have to worry about it. But there's one problem that really bothers me. There's one page that's requested thousands of times a day. The system gets data in the beginning, works with it and updates it. Primarily the updates are ++ @ -- (increase and decrease values). I used to do it like this UPDATE table SET value=value+1 WHERE ID=@I'd It worked with no problems obviously. But with linq to SQL the data is taken in the beginning, moved to the class, changed and then saved. Stats.registeredusers++; Db.submitchanges(); Let's say there were 100 000 users. Linq will say "let it be 100 001" instead of "let it be increased by 1". But if there value of users has already been increased (that happens in my site all the time) then linq will be like oops, this value is already 100 001. Whatever I'll throw an exception" You can change this behavior so that it won't throw an exception but it still will not set the value to 100 002. Like I said, it happened with me all the time. The stas value was increased twice a second on average. I simply had to rewrite this chunk of code with classic ado net. So my question is how can you solve the problem with linq

    Read the article

  • How to improve performance of map that loads new overlay images

    - by anthonysomerset
    I have inherited a website to maintain that uses a html map overlaying a real map to link specific countries to specific pages. previously it loaded the default map image, then with some javascript it would change the image src to an image with that particular country in a different colour on mouseover and reset the image source back to the original image on mouse out to make maintenance (adding new countries) easier i made the initial map a background image by utilising some CSS for the div tag, and then created new images for each country which only had that countries hightlight so that the images remain fairly small. this works great but theres one issue which is particularly noticeable on slower internet connections when you hover over a country if you dont have the image file in your browser cache or downloaded it wont load the image unless you hover over another country and then back onto the first country - i guess this is due to the image having to manually be downloaded on first hover. My question: is it possible to force the load of these extra images AFTER the page and all the other assets have finished loading so that this behaviour is all but eliminated? the html code for the MAP is as follows: <div class="gtmap"><img id="Image-Maps_6200909211657061" src="<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-blank.png" usemap="#Image-Maps_6200909211657061" alt="We offer Guided Motorcycle Tours all around the world" width="615" height="296" /> <map id="_Image-Maps_6200909211657061" name="Image-Maps_6200909211657061"> <area shape="poly" coords="511,134,532,107,542,113,520,141" href="/guided-motorcycle-tours-japan/" alt="Guided Japan Motorcycle Tours" title="Japan" onmouseover="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-japan.png';" onmouseout="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-blank.png';" /> <area shape="poly" coords="252,61,266,58,275,64,262,68" href="/guided-motorcycle-tour.php?iceland-motorcycle-adventure-39" alt="Guided Iceland Motorcycle Tours" title="Iceland" onmouseover="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-iceland.png';" onmouseout="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-blank.png';" /> <area shape="poly" coords="587,246,597,256,577,279,568,270" href="/guided-motorcycle-tour.php?new-zealand-south-island-adventure-10" alt="New Zealand Guided Motorcycle Tours" title="New Zealand" onmouseover="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-nz.png';" onmouseout="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-blank.png';" /> <area shape="poly" coords="418,133,412,145,412,154,421,178,430,180,430,166,443,154,443,145,438,144,433,142,430,138,431,130,430,129,425,128" href="/guided-motorcycle-tours-india/" alt="India Guided Motorcycle Tours" title="India" onmouseover="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-india.png';" onmouseout="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-blank.png';" /> <area shape="poly" coords="460,152,466,149,474,165,470,171,466,161" href="/guided-motorcycle-tours-laos/" alt="Laos Guided Motorcycle Tours" title="Laos" onmouseover="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-laos.png';" onmouseout="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-blank.png';" /> <area shape="poly" coords="468,179,475,166,468,152,475,152,482,169" href="/guided-motorcycle-tour.php?indochina-motorcycle-adventure-tour-32" onClick="javascript: pageTracker._trackPageview('/internal-links/guided-tours/map/vietnam');" alt="Vietnam Guided Motorcycle Tours" title="Vietnam" onmouseover="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-viet.png';" onmouseout="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-blank.png';" /> <area shape="poly" coords="330,239,337,235,347,226,352,233,351,243,344,250,335,253,327,255,323,249,322,242,323,241" href="/guided-motorcycle-tours-southafrica/" alt="South Africa Guided Motorcycle Tours" title="South Africa" onmouseover="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-sa.png';" onmouseout="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-blank.png';" /> <area shape="poly" coords="290,77,293,86,298,96,286,102,285,97,285,89,282,84,282,79" href="/guided-motorcycle-tour.php?great-britain-isle-of-man-scotland-wales-uk-18" alt="United Kingdom" title="United Kingdom Guided Motorcycle Tours" onmouseover="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-uk.png';" onmouseout="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-blank.png';" /> <area shape="poly" coords="357,118,368,118,369,126,345,129,338,125,338,117,342,115,348,116" href="/guided-motorcycle-tour.php?explore-turkey-adventure-45" alt="Turkey" title="Turkey Guided Motorcycle Tours" onmouseover="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-turkey.png';" onmouseout="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-blank.png';" /> <area shape="poly" coords="206,95,193,101,185,101,178,106,165,111,157,109,147,105,134,103,121,103,107,103,96,103,86,104,81,99,77,91,70,83,62,79,60,72,61,64,59,57,60,51,71,50,83,49,95,50,107,54,117,53,129,47,137,36,148,37,163,38,177,44,187,54,195,60,184,72,191,80,200,87" href="/guided-motorcycle-tours-canada/" alt="Guided Canada Motorcycle Tours" title="Canada" onmouseover="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-canada.png';" onmouseout="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-blank.png';" /> <area shape="poly" coords="61,75,60,62,60,55,59,44,51,44,43,43,36,42,28,43,23,48,17,51,15,62,19,74,27,79,19,83,16,93,35,83,43,77,50,75,55,75" href="/guided-motorcycle-tours-alaska/" alt="Guided Alaska Motorcycle Tours" title="Alaska" onmouseover="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-alaska.png';" onmouseout="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-blank.png';" /> <area shape="poly" coords="82,101,99,101,133,101,148,105,161,110,172,106,187,100,180,113,171,122,165,131,159,149,147,141,137,140,129,147,120,141,112,138,103,137,93,132,86,122,86,112,86,106" href="/guided-motorcycle-tours-usa/" alt="USA Guided Motorcycle Tours" title="USA" onmouseover="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-usa.png';" onmouseout="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-blank.png';" /> <area shape="poly" coords="178,225,180,214,175,208,174,204,178,198,174,193,167,192,157,199,158,204,164,211,167,218" href="/guided-motorcycle-tour.php?peru-machu-picchu-adventure-25" alt="Peru Guided Motorcycle Tours" title="Peru" onmouseover="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-peru.png';" onmouseout="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-blank.png';" /> <area shape="poly" coords="172,226,169,239,166,256,166,267,164,279,171,277,174,262,175,250,179,234,180,225,176,224" href="/guided-motorcycle-tours-chile/" alt="Guided Chile Motorcycle Tours" title="Chile" onmouseover="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-chile.png';" onmouseout="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-blank.png';" /> <area shape="poly" coords="199,260,194,261,187,265,184,276,183,296,170,292,168,282,174,270,174,257,177,245,180,230,190,228,205,237,199,245" href="/guided-motorcycle-tours-argentina/" alt="Guided Argentina Motorcycle Tours" title="Argentina" onmouseover="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-arg.png';" onmouseout="if(document.images) document.getElementById('Image-Maps_6200909211657061').src='<?php echo cdnhttpsCheck(); ?>assets/wmap/a-guided-tours-map-blank.png';" /> </map> </div> The <?php echo cdnhttpsCheck(); ?> is just a site specific function that gets the correct web domain/url from a config file to load resources from CDN where possible (eg all non HTTPS requests) We are loading Jquery at the bottom of the HTML if anybody wonders why it is missing from the code snippet for reference, the page with the map in question is found here: http://www.motoquest.com/guided-motorcycle-tours/

    Read the article

  • High performance querying - Sugestions please

    - by Alex Takitani
    Supposing that I have millions of user profiles, with hundreds of fields (name, gender, preferred pet and so on...). With database would You choose? Suppose that You have a Facebook like load. Speed is a must. Open Source preferred. I've read a lot about Cassandra, HBase, Mongo, Mysql... I just can't decide.....

    Read the article

  • "Order By" in LINQ-to-SQL Causes performance issues

    - by panamack
    I've set out to write a method in my C# application which can return an ordered subset of names from a table containing about 2000 names starting at the 100th name and returning the next 20 names. I'm doing this so I can populate a WPF DataGrid in my UI and do some custom paging. I've been using LINQ to SQL but hit a snag with this long executing query so I'm examining the SQL the LINQ query is using (Query B below). Query A runs well: SELECT TOP (20) [t0].[subject_id] AS [Subject_id], [t0].[session_id] AS [Session_id], [t0].[name] AS [Name] FROM [Subjects] AS [t0] WHERE (NOT (EXISTS( SELECT NULL AS [EMPTY] FROM ( SELECT TOP (100) [t1].[subject_id] FROM [Subjects] AS [t1] WHERE [t1].[session_id] = 1 ORDER BY [t1].[name] ) AS [t2] WHERE [t0].[subject_id] = [t2].[subject_id] ))) AND ([t0].[session_id] = 1) Query B takes 40 seconds: SELECT TOP (20) [t0].[subject_id] AS [Subject_id], [t0].[session_id] AS [Session_id], [t0].[name] AS [Name] FROM [Subjects] AS [t0] WHERE (NOT (EXISTS( SELECT NULL AS [EMPTY] FROM ( SELECT TOP (100) [t1].[subject_id] FROM [Subjects] AS [t1] WHERE [t1].[session_id] = 1 ORDER BY [t1].[name] ) AS [t2] WHERE [t0].[subject_id] = [t2].[subject_id] ))) AND ([t0].[session_id] = 1) ORDER BY [t0].[name] When I add the ORDER BY [t0].[name] to the outer query it slows down the query. How can I improve the second query? This was my LINQ stuff Nick int sessionId = 1; int start = 100; int count = 20; // Query subjects with the shoot's session id var subjects = cldb.Subjects.Where<Subject>(s => s.Session_id == sessionId); // Filter as per params var orderedSubjects = subjects .OrderBy<Subject, string>( s => s.Col_zero ); var filteredSubjects = orderedSubjects .Skip<Subject>(start) .Take<Subject>(count);

    Read the article

  • Difference in linq-to-sql query performance using GenericRespositry

    - by Neil
    Given i have a class like so in my Data Layer public class GenericRepository<TEntity> where TEntity : class { [System.ComponentModel.DataObjectMethod(System.ComponentModel.DataObjectMethodType.Select)] public IQueryable<TEntity> SelectAll() { return DataContext.GetTable<TEntity>(); } } I would be able to query a table in my database like so from a higher layer using (GenericRepositry<MyTable> mytable = new GenericRepositry<MyTable>()) { var myresult = from m in mytable.SelectAll() where m.IsActive select m; } is this considerably slower than using the usual code in my Data Layer using (MyDataContext ctx = new MyDataContext()) { var myresult = from m in ctx.MyTable where m.IsActive select m; } Eliminating the need to write simple single table selects in the Data layer saves a lot of time, but will i regret it?

    Read the article

  • How to index a table with a Type 2 slowly changing dimension for optimal performance

    - by The Lazy DBA
    Suppose you have a table with a Type 2 slowly-changing dimension. Let's express this table as follows, with the following columns: * [Key] * [Value1] * ... * [ValueN] * [StartDate] * [ExpiryDate] In this example, let's suppose that [StartDate] is effectively the date in which the values for a given [Key] become known to the system. So our primary key would be composed of both [StartDate] and [Key]. When a new set of values arrives for a given [Key], we assign [ExpiryDate] to some pre-defined high surrogate value such as '12/31/9999'. We then set the existing "most recent" records for that [Key] to have an [ExpiryDate] that is equal to the [StartDate] of the new value. A simple update based on a join. So if we always wanted to get the most recent records for a given [Key], we know we could create a clustered index that is: * [ExpiryDate] ASC * [Key] ASC Although the keyspace may be very wide (say, a million keys), we can minimize the number of pages between reads by initially ordering them by [ExpiryDate]. And since we know the most recent record for a given key will always have an [ExpiryDate] of '12/31/9999', we can use that to our advantage. However... what if we want to get a point-in-time snapshot of all [Key]s at a given time? Theoretically, the entirety of the keyspace isn't all being updated at the same time. Therefore for a given point-in-time, the window between [StartDate] and [ExpiryDate] is variable, so ordering by either [StartDate] or [ExpiryDate] would never yield a result in which all the records you're looking for are contiguous. Granted, you can immediately throw out all records in which the [StartDate] is greater than your defined point-in-time. In essence, in a typical RDBMS, what indexing strategy affords the best way to minimize the number of reads to retrieve the values for all keys for a given point-in-time? I realize I can at least maximize IO by partitioning the table by [Key], however this certainly isn't ideal. Alternatively, is there a different type of slowly-changing-dimension that solves this problem in a more performant manner?

    Read the article

  • MonoTouch - foreach vs for loops (performance)

    - by ifwdev
    Normally I'm well aware that a consideration like this is premature optimization. Right now I have some event handlers being attached inside a foreach loop. I am wondering if this style might be prone to leaks or inefficient memory use due to closures being created. Is there any validity to this thinking?

    Read the article

  • Performance issues with testing on an ADP2

    - by Stuart
    I have an Android Developer Phone with Android 1.6 installed, sometimes it will take 30 seconds for the home screen to appear after a call or exiting from an application. Why is my phone so slow? Should I replace the memory card? Also, when is the 2.0 coming out for the ADP2? How do I install it?

    Read the article

  • Vb.exe performance time

    - by vinodacharyabva
    Hi I am running a vb.exe through automation. In exe I have return a code which takes a data from database and saves that data into file. I ran that .exe for the first time. It took 1 mins. For testing baseline I called same .exe 5 times one after the other. But it took nearly 10 mins to generate. My question is if it takes 1 min for 1 report to generate then it should take 5 mins to generate 5 report but why it is taking 10 mins (more than the double). Is there any problem while calling a exe one after the other?

    Read the article

  • Horrible eclipse performance on macbook pro running 10.5.8

    - by user246114
    Hi I am using eclipse galileo on my macbook pro. After a few minutes it starts dragging really badly, like it takes 8 seconds to open a file. I don't have many files open at all. I already modified the config file to increase ram and all that stuff. Is there something wrong with this version of eclipse, never had it run so poorly on here, Thanks

    Read the article

  • Horrible eclipse performance on macbook pro running 10.5.8

    - by user246114
    Hi I am using eclipse galileo on my macbook pro. After a few minutes it starts dragging really badly, like it takes 8 seconds to open a file. I don't have many files open at all. I already modified the config file to increase ram and all that stuff. Is there something wrong with this version of eclipse, never had it run so poorly on here, Thanks

    Read the article

  • vectorizing loops in Matlab - performance issues

    - by Gacek
    This question is related to these two: http://stackoverflow.com/questions/2867901/introduction-to-vectorizing-in-matlab-any-good-tutorials http://stackoverflow.com/questions/2561617/filter-that-uses-elements-from-two-arrays-at-the-same-time Basing on the tutorials I read, I was trying to vectorize some procedure that takes really a lot of time. I've rewritten this: function B = bfltGray(A,w,sigma_r) dim = size(A); B = zeros(dim); for i = 1:dim(1) for j = 1:dim(2) % Extract local region. iMin = max(i-w,1); iMax = min(i+w,dim(1)); jMin = max(j-w,1); jMax = min(j+w,dim(2)); I = A(iMin:iMax,jMin:jMax); % Compute Gaussian intensity weights. F = exp(-0.5*(abs(I-A(i,j))/sigma_r).^2); B(i,j) = sum(F(:).*I(:))/sum(F(:)); end end into this: function B = rngVect(A, w, sigma) W = 2*w+1; I = padarray(A, [w,w],'symmetric'); I = im2col(I, [W,W]); H = exp(-0.5*(abs(I-repmat(A(:)', size(I,1),1))/sigma).^2); B = reshape(sum(H.*I,1)./sum(H,1), size(A, 1), []); But this version seems to be as slow as the first one, but in addition it uses a lot of memory and sometimes causes memory problems. I suppose I've made something wrong. Probably some logic mistake regarding vectorizing. Well, in fact I'm not surprised - this method creates really big matrices and probably the computations are proportionally longer. I have also tried to write it using nlfilter (similar to the second solution given by Jonas) but it seems to be hard since I use Matlab 6.5 (R13) (there are no sophisticated function handles available). So once again, I'm asking not for ready solution, but for some ideas that would help me to solve this in reasonable time. Maybe you will point me what I did wrong.

    Read the article

  • real time stock quotes, StreamReader performance optimization

    - by sean717
    I am working on a program that extracts real time quote for 900+ stocks from a website. I use HttpWebRequest to send HTTP request to the site and store the response to a stream and open a stream using the following code: HttpWebResponse response = (HttpWebResponse)request.GetResponse(); Stream stream = response.GetResponseStream (); StreamReader reader = new StreamReader( stream ) the size of the received HTML is large (5000+ lines), so it takes a long time to parse it and extract the price. For 900 files, It takes about 6 mins for parsing and extracting. Which my boss isn't happy with, he told me he'd want the whole process to be done in TWO mins. I've identified the part of the program that takes most of time to finish is parsing and extracting. I've tried to optimize the code to make it faster, the following is what I have now after some optimization: // skip lines at the top for(int i=0;i<1500;++i) reader.ReadLine(); // read the line that contains the price string theLine = reader.ReadLine(); // ... extract the price from the line now it takes about 4 mins to process all the files, there is still a significant gap to what my boss's expecting. So I am wondering, is there other way that I can further speed up the parsing and extracting and have everything done within 2 mins?

    Read the article

  • SQL Server CTE referred in self joins slow

    - by Kharlos Dominguez
    Hello, I have written a table-valued UDF that starts by a CTE to return a subset of the rows from a large table. There are several joins in the CTE. A couple of inner and one left join to other tables, which don't contain a lot of rows. The CTE has a where clause that returns the rows within a date range, in order to return only the rows needed. I'm then referencing this CTE in 4 self left joins, in order to build subtotals using different criterias. The query is quite complex but here is a simplified pseudo-version of it WITH DataCTE as ( SELECT [columns] FROM table INNER JOIN table2 ON [...] INNER JOIN table3 ON [...] LEFT JOIN table3 ON [...] ) SELECT [aggregates_columns of each subset] FROM DataCTE Main LEFT JOIN DataCTE BananasSubset ON [...] AND Product = 'Bananas' AND Quality = 100 LEFT JOIN DataCTE DamagedBananasSubset ON [...] AND Product = 'Bananas' AND Quality < 20 LEFT JOIN DataCTE MangosSubset ON [...] GROUP BY [ I have the feeling that SQL Server gets confused and calls the CTE for each self join, which seems confirmed by looking at the execution plan, although I confess not being an expert at reading those. I would have assumed SQL Server to be smart enough to only perform the data retrieval from the CTE only once, rather than do it several times. I have tried the same approach but rather than using a CTE to get the subset of the data, I used the same select query as in the CTE, but made it output to a temp table instead. The version referring the CTE version takes 40 seconds. The version referring the temp table takes between 1 and 2 seconds. Why isn't SQL Server smart enough to keep the CTE results in memory? I like CTEs, especially in this case as my UDF is a table-valued one, so it allowed me to keep everything in a single statement. To use a temp table, I would need to write a multi-statement table valued UDF, which I find a slightly less elegant solution. Did some of you had this kind of performance issues with CTE, and if so, how did you get them sorted? Thanks, Kharlos

    Read the article

  • optimizing any OS for maximum informix client/server performance

    - by Frank Developer
    Is there any Informix documentation for optimizing any operating system where an ifx engine is running? For example, in Linux, strip-down to a bare minimum all unnecessary binaries, daemons, utilities, tune kernel parameters, optimize raw and cooked devices (hdparm), place swap space on beginning tracks of a disk, etc. Someday, maybe, Informix can create its own proprietary and dedicated PICK-like O/S to provide the most optimized environment for a standalone ifx server? The general idea is for the OS where ifx sits on have the smallest footprint and lowest overhead impact.

    Read the article

  • how to avoid sub-query to gain performance

    - by chun
    hi i have a reporting query which have 2 long sub-query SELECT r1.code_centre, r1.libelle_centre, r1.id_equipe, r1.equipe, r1.id_file_attente, r1.libelle_file_attente,r1.id_date, r1.tranche, r1.id_granularite_de_periode,r1.granularite, r1.ContactsTraites, r1.ContactsenParcage, r1.ContactsenComm, r1.DureeTraitementContacts, r1.DureeComm, r1.DureeParcage, r2.AgentsConnectes, r2.DureeConnexion, r2.DureeTraitementAgents, r2.DureePostTraitement FROM ( SELECT cc.id_centre_contact, cc.code_centre, cc.libelle_centre, a.id_equipe, a.equipe, a.id_file_attente, f.libelle_file_attente, a.id_date, g.tranche, g.id_granularite_de_periode, g.granularite, sum(Nb_Contacts_Traites) as ContactsTraites, sum(Nb_Contacts_en_Parcage) as ContactsenParcage, sum(Nb_Contacts_en_Communication) as ContactsenComm, sum(Duree_Traitement/1000) as DureeTraitementContacts, sum(Duree_Communication / 1000 + Duree_Conference / 1000 + Duree_Com_Interagent / 1000) as DureeComm, sum(Duree_Parcage/1000) as DureeParcage FROM agr_synthese_activite_media_fa_agent a, centre_contact cc, direction_contact dc, granularite_de_periode g, media m, file_attente f WHERE m.id_media = a.id_media AND cc.id_centre_contact = a.id_centre_contact AND a.id_direction_contact = dc.id_direction_contact AND dc.direction_contact ='INCOMING' AND a.id_file_attente = f.id_file_attente AND m.media = 'PHONE' AND ( ( g.valeur_min = date_format(a.id_date,'%d/%m') and g.granularite = 'Jour') or ( g.granularite = 'Heure' and a.id_th_heure = g.id_granularite_de_periode) ) GROUP by cc.id_centre_contact, a.id_equipe, a.id_file_attente, a.id_date, g.tranche, g.id_granularite_de_periode) r1, ( (SELECT cc.id_centre_contact,cc.code_centre, cc.libelle_centre, a.id_equipe, a.equipe, a.id_date, g.tranche, g.id_granularite_de_periode,g.granularite, count(distinct a.id_agent) as AgentsConnectes, sum(Duree_Connexion / 1000) as DureeConnexion, sum(Duree_en_Traitement / 1000) as DureeTraitementAgents, sum(Duree_en_PostTraitement / 1000) as DureePostTraitement FROM activite_agent a, centre_contact cc, granularite_de_periode g WHERE ( g.valeur_min = date_format(a.id_date,'%d/%m') and g.granularite = 'Jour') AND cc.id_centre_contact = a.id_centre_contact GROUP BY cc.id_centre_contact, a.id_equipe, a.id_date, g.tranche, g.id_granularite_de_periode ) UNION (SELECT cc.id_centre_contact,cc.code_centre, cc.libelle_centre, a.id_equipe, a.equipe, a.id_date, g.tranche, g.id_granularite_de_periode,g.granularite, count(distinct a.id_agent) as AgentsConnectes, sum(Duree_Connexion / 1000) as DureeConnexion, sum(Duree_en_Traitement / 1000) as DureeTraitementAgents, sum(Duree_en_PostTraitement / 1000) as DureePostTraitement FROM activite_agent a, centre_contact cc, granularite_de_periode g WHERE ( g.granularite = 'Heure' AND a.id_th_heure = g.id_granularite_de_periode) AND cc.id_centre_contact = a.id_centre_contact GROUP BY cc.id_centre_contact,a.id_equipe, a.id_date, g.tranche, g.id_granularite_de_periode) ) r2 WHERE r1.id_centre_contact = r2.id_centre_contact AND r1.id_equipe = r2.id_equipe AND r1.id_date = r2.id_date AND r1.tranche = r2.tranche AND r1.id_granularite_de_periode = r2.id_granularite_de_periode GROUP BY r1.id_centre_contact , r1.id_equipe, r1.id_file_attente, r1.id_date, r1.tranche, r1.id_granularite_de_periode ORDER BY r1.code_centre, r1.libelle_centre, r1.equipe, r1.libelle_file_attente, r1.id_date, r1.id_granularite_de_periode,r1.tranche the EXPLAIN shows | id | select_type | table | type| possible_keys | key | key_len | ref| rows | Extra | '1', 'PRIMARY', '<derived3>', 'ALL', NULL, NULL, NULL, NULL, '2520', 'Using temporary; Using filesort' '1', 'PRIMARY', '<derived2>', 'ALL', NULL, NULL, NULL, NULL, '4378', 'Using where; Using join buffer' '3', 'DERIVED', 'a', 'ALL', 'fk_Activite_Agent_centre_contact', NULL, NULL, NULL, '83433', 'Using temporary; Using filesort' '3', 'DERIVED', 'g', 'ref', 'Index_granularite,Index_Valeur_min', 'Index_Valeur_min', '23', 'func', '1', 'Using where' '3', 'DERIVED', 'cc', 'ALL', 'PRIMARY', NULL, NULL, NULL, '6', 'Using where; Using join buffer' '4', 'UNION', 'g', 'ref', 'PRIMARY,Index_granularite', 'Index_granularite', '23', '', '24', 'Using where; Using temporary; Using filesort' '4', 'UNION', 'a', 'ref', 'fk_Activite_Agent_centre_contact,fk_activite_agent_TH_heure', 'fk_activite_agent_TH_heure', '5', 'reporting_acd.g.Id_Granularite_de_periode', '2979', 'Using where' '4', 'UNION', 'cc', 'ALL', 'PRIMARY', NULL, NULL, NULL, '6', 'Using where; Using join buffer' NULL, 'UNION RESULT', '<union3,4>', 'ALL', NULL, NULL, NULL, NULL, NULL, '' '2', 'DERIVED', 'g', 'range', 'PRIMARY,Index_granularite,Index_Valeur_min', 'Index_granularite', '23', NULL, '389', 'Using where; Using temporary; Using filesort' '2', 'DERIVED', 'a', 'ALL', 'fk_agr_synthese_activite_media_fa_agent_centre_contact,fk_agr_synthese_activite_media_fa_agent_direction_contact,fk_agr_synthese_activite_media_fa_agent_file_attente,fk_agr_synthese_activite_media_fa_agent_media,fk_agr_synthese_activite_media_fa_agent_th_heure', NULL, NULL, NULL, '20903', 'Using where; Using join buffer' '2', 'DERIVED', 'cc', 'eq_ref', 'PRIMARY', 'PRIMARY', '4', 'reporting_acd.a.Id_Centre_Contact', '1', '' '2', 'DERIVED', 'f', 'eq_ref', 'PRIMARY', 'PRIMARY', '4', 'reporting_acd.a.Id_File_Attente', '1', '' '2', 'DERIVED', 'dc', 'eq_ref', 'PRIMARY', 'PRIMARY', '4', 'reporting_acd.a.Id_Direction_Contact', '1', 'Using where' '2', 'DERIVED', 'm', 'eq_ref', 'PRIMARY', 'PRIMARY', '4', 'reporting_acd.a.Id_Media', '1', 'Using where' don't know it very clear, but i think is the problem of seems it take full scaning than i change all the sub-query to views(create view as select sub-query), and the result is the same thanks for any advice

    Read the article

  • list or container O(1)-ish insertion/deletion performance, with array semantics

    - by Chris Kaminski
    I'm looking for a collection that offers list semantics, but also allows array semantics. Say I have a list with the following items: apple orange carrot pear then my container array would: container[0] == apple container[1] == orangle container[2] == carrot Then say I delete the orange element: container[0] == apple container[1] == carrot I don't particularly care if sort order is maintained, I'd just like the array values to function as accelerators to the list items, and I want to collapse gaps in the array without having to do an explicit resizing.

    Read the article

  • JavaScript tags, performance and W3C

    - by Thomas
    Today I was looking for website optimization content and I found an article talking about move JavaScript scripts to the bottom of the HTML page. Is this valid with W3C's recommendations? I learned that all JavaScript must be inside of head tag... Thank you.

    Read the article

  • Improve performance writing 10 million records to text file using windows service

    - by user1039583
    I'm fetching more than 10 millions of records from database and writing to a text file. It takes hours of time to complete this operation. Is there any option to use TPL features here? It would be great if someone could get me started implementing this with the TPL. using (FileStream fStream = new FileStream("d:\\file.txt", FileMode.OpenOrCreate, FileAccess.ReadWrite)) { BufferedStream bStream = new BufferedStream(fStream); TextWriter writer = new StreamWriter(bStream); for (int i = 0; i < 100000000; i++) { writer.WriteLine(i); } bStream.Flush(); writer.Flush(); // empty buffer; fStream.Flush(); }

    Read the article

  • Mysql regexp performance question

    - by Tim
    Rumour has it that this; SELECT * FROM lineage_string where lineage like '%179%' and lineage regexp '(^|/)179(/|$)' Would be faster than this; SELECT * FROM lineage_string where lineage regexp '(^|/)179(/|$)' Can anyone confirm ? Or know a decent way to test the speed of such queries. Thanks

    Read the article

  • Mysql select - improve performances

    - by realshadow
    Hey, I am working on an e-shop which sells products only via loans. I display 10 products per page in any category, each product has 3 different price tags - 3 different loan types. Everything went pretty well during testing time, query execution time was perfect, but today when transfered the changes to the production server, the site "collapsed" in about 2 minutes. The query that is used to select loan types sometimes hangs for ~10 seconds and it happens frequently and thus it cant keep up and its hella slow. The table that is used to store the data has approximately 2 milion records and each select looks like this: SELECT * FROM products_loans WHERE KOD IN("X17/Q30-10", "X17/12", "X17/5-24") AND 369.27 BETWEEN CENA_OD AND CENA_DO; 3 loan types and the price that needs to be in range between CENA_OD and CENA_DO, thus 3 rows are returned. But since I need to display 10 products per page, I need to run it trough a modified select using OR, since I didnt find any other solution to this. I have asked about it here, but got no answer. As mentioned in the referencing post, this has to be done separately since there is no column that could be used in a join (except of course price and code, but that ended very, very badly). Here is the show create table, kod and CENA_OD/CENA_DO very indexed via INDEX. CREATE TABLE `products_loans` ( `KOEF_ID` bigint(20) NOT NULL, `KOD` varchar(30) NOT NULL, `AKONTACIA` int(11) NOT NULL, `POCET_SPLATOK` int(11) NOT NULL, `koeficient` decimal(10,2) NOT NULL default '0.00', `CENA_OD` decimal(10,2) default NULL, `CENA_DO` decimal(10,2) default NULL, `PREDAJNA_CENA` decimal(10,2) default NULL, `AKONTACIA_SUMA` decimal(10,2) default NULL, `TYP_VYHODY` varchar(4) default NULL, `stage` smallint(6) NOT NULL default '1', PRIMARY KEY (`KOEF_ID`), KEY `CENA_OD` (`CENA_OD`), KEY `CENA_DO` (`CENA_DO`), KEY `KOD` (`KOD`), KEY `stage` (`stage`) ) ENGINE=InnoDB DEFAULT CHARSET=utf8 And also selecting all loan types and later filtering them trough php doesnt work good, since each type has over 50k records and the select takes too much time as well... Any ides about improving the speed are appreciated. Edit: Here is the explain +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | id | select_type | table | type | possible_keys | key | key_len | ref | rows | Extra | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | 1 | SIMPLE | products_loans | range | CENA_OD,CENA_DO,KOD | KOD | 92 | NULL | 190158 | Using where | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ I have tried the combined index and it improved the performance on the test server from 0.44 sec to 0.06 sec, I cant access the production server from home though, so I will have to try it tomorrow.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

< Previous Page | 160 161 162 163 164 165 166 167 168 169 170 171  | Next Page >