Search Results

Search found 15087 results on 604 pages for 'python multithreading'.

Page 167/604 | < Previous Page | 163 164 165 166 167 168 169 170 171 172 173 174  | Next Page >

• python logparse search specific text

  - by krisdigitx

  hi, I am using this function in my code to return the strings i want from reading the log file, I want to grep the "exim" process and return the results, but running the code gives no error, but the output is limited to three lines, how can i just get the output only related to exim process.. #output: {'date': '13', 'process': 'syslogd', 'time': '06:27:33', 'month': 'May'} {'date': '13', 'process': 'exim[23168]:', 'time': '06:27:33', 'month': 'May'} {'May': ['syslogd']} #function: def generate_log_report(logfile): report_dict = {} for line in logfile: line_dict = dictify_logline(line) print line_dict try: month = line_dict['month'] date = line_dict['date'] time = line_dict['time'] #process = line_dict['process'] if "exim" in line_dict['process']: process = line_dict['process'] break else: process = line_dict['process'] except ValueError: continue report_dict.setdefault(month, []).append(process) return report_dict

  Read the article

• Python: How best to parse a simple grammar?

  - by Rosarch

  Ok, so I've asked a bunch of smaller questions about this project, but I still don't have much confidence in the designs I'm coming up with, so I'm going to ask a question on a broader scale. I am parsing pre-requisite descriptions for a course catalog. The descriptions almost always follow a certain form, which makes me think I can parse most of them. From the text, I would like to generate a graph of course pre-requisite relationships. (That part will be easy, after I have parsed the data.) Some sample inputs and outputs: "CS 2110" => ("CS", 2110) # 0 "CS 2110 and INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, 3300, 3140" => [("CS", 2110), ("CS", 3300), ("CS", 3140)] # 1 "CS 2110 or INFO 3300" => [[("CS", 2110)], [("INFO", 3300)]] # 2 "MATH 2210, 2230, 2310, or 2940" => [[("MATH", 2210), ("MATH", 2230), ("MATH", 2310)], [("MATH", 2940)]] # 3 If the entire description is just a course, it is output directly. If the courses are conjoined ("and"), they are all output in the same list If the course are disjoined ("or"), they are in separate lists Here, we have both "and" and "or". One caveat that makes it easier: it appears that the nesting of "and"/"or" phrases is never greater than as shown in example 3. What is the best way to do this? I started with PLY, but I couldn't figure out how to resolve the reduce/reduce conflicts. The advantage of PLY is that it's easy to manipulate what each parse rule generates: def p_course(p): 'course : DEPT_CODE COURSE_NUMBER' p[0] = (p[1], int(p[2])) With PyParse, it's less clear how to modify the output of parseString(). I was considering building upon @Alex Martelli's idea of keeping state in an object and building up the output from that, but I'm not sure exactly how that is best done. def addCourse(self, str, location, tokens): self.result.append((tokens[0][0], tokens[0][1])) def makeCourseList(self, str, location, tokens): dept = tokens[0][0] new_tokens = [(dept, tokens[0][1])] new_tokens.extend((dept, tok) for tok in tokens[1:]) self.result.append(new_tokens) For instance, to handle "or" cases: def __init__(self): self.result = [] # ... self.statement = (course_data + Optional(OR_CONJ + course_data)).setParseAction(self.disjunctionCourses) def disjunctionCourses(self, str, location, tokens): if len(tokens) == 1: return tokens print "disjunction tokens: %s" % tokens How does disjunctionCourses() know which smaller phrases to disjoin? All it gets is tokens, but what's been parsed so far is stored in result, so how can the function tell which data in result corresponds to which elements of token? I guess I could search through the tokens, then find an element of result with the same data, but that feel convoluted... What's a better way to approach this problem?

  Read the article

• Python for statement giving an Invalid Syntax error with list

  - by Cold Diamondz

  I have some code in which is throwing an error (I'm using repl.it) import random students = ['s1:0','s2:0','s3:0'] while True: print'\n'*50 print'Ticket Machine'.center(80) print'-'*80 print'1. Clear Student Ticket Values'.center(80) print'2. Draw Tickets'.center(80) menu = raw_input('-'*80+'\nChoose an Option: ') if menu == '1': print'\n'*50 print'CLEARED!' students = ['s1:0','s2:0','s3:0'] raw_input('Press enter to return to the main menu!') elif menu == '2': tickets = [] print'\n'*50 times = int(raw_input('How many tickets to draw? ') for a in students: for i in range(a.split(':')[1]): tickets.append(a.split(':')[0]) for b in range(1,times+1): print str(b) + '. ' + random.choice(tickets) else: print'\n'*50 print'That was not an option!' raw_input('Press enter to return to the main menu!') But it is throwing this error: File "<stdin>", line 19 for a in students: ^ SyntaxError: invalid syntax I am planning on using this in a class, but I can't use it until the bug is fixed, also, student names have been removed for privacy reasons.

  Read the article

• Find&Replace using Python - Binary file

  - by Aaron Hoffman

  Hello, I'm attempting to do a "find and replace" in a file on a Mac OS X computer. Although it appears to work correctly. It seems that the file is somehow altered. The text editor that I use (Text Wrangler) is unable to even open the file once this is completed. Here is the code as I have it: import fileinput for line in fileinput.FileInput("testfile.txt",inplace=1): line = line.replace("newhost",host) print line, When I view the file from the terminal, it does say "testfile" may be a binary file. See it anyway? Is there a chance that this replace is corrupting the file? Do I have another option for this to work? I really appreciate the help. Thank you, Aaron UPDATE: the actual file is NOT a .txt file it is a .plist file which is preference file in Mac OS X if that makes any difference

  Read the article

• Python recursion with list returns None

  - by newman

  def foo(a): a.append(1) if len(a) > 10: print a return a else: foo(a) Why this recursive function returns None (see transcript below)? I can't quite understand what I am doing wrong. In [263]: x = [] In [264]: y = foo(x) [1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1] In [265]: print y None

  Read the article

• Find last match with python regular expression

  - by SDD

  I wanto to match the last occurence of a simple pattern in a string, e.g. list = re.findall(r"\w+ AAAA \w+", "foo bar AAAA foo2 AAAA bar2) print "last match: ", list[len(list)-1] however, if the string is very long, a huge list of matches is generated. Is there a more direct way to match the second occurence of "AAAA" or should I use this workaround?

  Read the article

• Replacing python docstrings

  - by tomaz

  I have written a epytext to reST markup converter, and now I want to convert all the docstrings in my entire library from epytext to reST format. Is there a smart way to read the all the docstrings in a module and write back the replacements? ps: ast module perhaps?

  Read the article

• Using __str__ representation for printing objects in containers in Python

  - by BobDobbs

  I've noticed that when an instance with an overloaded str method is passed to the print() function as an argument, it prints as intended. However, when passing a container that contains one of those instances to print(), it uses the repr method instead. That is to say, print(x) displays the correct string representation of x, and print(x, y) works correctly, but print([x]) or print((x, y)) prints the repr representation instead. First off, why does this happen? Secondly, is there a way to correct that behavior of print() in this circumstance?

  Read the article

• varargs in lambda functions in Python

  - by brain_damage

  Is it possible a lambda function to have variable number of arguments? For example, I want to write a metaclass, which creates a method for every method of some other class and this newly created method returns the opposite value of the original method and has the same number of arguments. And I want to do this with lambda function. How to pass the arguments? Is it possible? class Negate(type): def __new__(mcs, name, bases, _dict): extended_dict = _dict.copy() for (k, v) in _dict.items(): if hasattr(v, '__call__'): extended_dict["not_" + k] = lambda s, *args, **kw: not v(s, *args, **kw) return type.__new__(mcs, name, bases, extended_dict) class P(metaclass=Negate): def __init__(self, a): self.a = a def yes(self): return True def maybe(self, you_can_chose): return you_can_chose But the result is totally wrong: >>>p = P(0) >>>p.yes() True >>>p.not_yes() # should be False Traceback (most recent call last): File "<pyshell#150>", line 1, in <module> p.not_yes() File "C:\Users\Nona\Desktop\p10.py", line 51, in <lambda> extended_dict["not_" + k] = lambda s, *args, **kw: not v(s, *args, **kw) TypeError: __init__() takes exactly 2 positional arguments (1 given) >>>p.maybe(True) True >>>p.not_maybe(True) #should be False True

  Read the article

• indexing error in list in python

  - by mekasperasky

  B=l.append((l[i]+A+B)) l is a list here and i am trying to append into it more value for it to act as an array . But its still giving me error like list index out of range . How to get rid of it ?

  Read the article

• [Tkinter/Python] Different line widths with canvas.create_line?

  - by Sam

  Does anyone have any idea why I get different line widths on the canvas in the following example? from Tkinter import * bigBoxSize = 150 class cFrame(Frame): def __init__(self, master, cwidth=450, cheight=450): Frame.__init__(self, master, relief=RAISED, height=550, width=600, bg = "grey") self.canvasWidth = cwidth self.canvasHeight = cheight self.canvas = Canvas(self, bg="white", width=cwidth, height=cheight, border =0) self.drawGridLines() self.canvas.pack(side=TOP, pady=20, padx=20) def drawGridLines(self, linewidth = 10): self.canvas.create_line(0, 0, self.canvasWidth, 0, width= linewidth ) self.canvas.create_line(0, 0, 0, self.canvasHeight, width= linewidth ) self.canvas.create_line(0, self.canvasHeight, self.canvasWidth + 2, self.canvasHeight, width= linewidth ) self.canvas.create_line(self.canvasWidth, self.canvasHeight, self.canvasWidth, 1, width= linewidth ) self.canvas.create_line(0, bigBoxSize, self.canvasWidth, bigBoxSize, width= linewidth ) self.canvas.create_line(0, bigBoxSize * 2, self.canvasWidth, bigBoxSize * 2, width= linewidth) root = Tk() C = cFrame(root) C.pack() root.mainloop() It's really frustrating me as I have no idea what's happening. If anyone can help me out then that'd be fantastic. Thanks!

  Read the article

• Python RegExp exception

  - by Jasie

  How do I split on all nonalphanumeric characters, EXCEPT the apostrophe? re.split('\W+',text) works, but will also split on apostrophes. How do I add an exception to this rule? Thanks!

  Read the article

• I have an Errno 13 Permission denied with subprocess in python

  - by wDroter

  The line with the issue is ret=subprocess.call(shlex.split(cmd)) cmd = /usr/share/java -cp pig-hadoop-conf-Simpsons:lib/pig-0.8.1-cdh3u1-core.jar:lib/hadoop-core-0.20.2-cdh3u1.jar org.apache.pig.Main -param func=cat -param from =foo.txt -x mapreduce fsFunc.pig The error is. File "./run_pig.py", line 157, in process ret=subprocess.call(shlex.split(cmd)) File "/usr/lib/python2.7/subprocess.py", line 493, in call return Popen(*popenargs, **kwargs).wait() File "/usr/lib/python2.7/subprocess.py", line 679, in __init__ errread, errwrite) File "/usr/lib/python2.7/subprocess.py", line 1249, in _execute_child raise child_exception OSError: [Errno 13] Permission denied Let me know if any more info is needed. Any help is appreciated. Thanks.

  Read the article

• Python Tkinter after loop not working fast enough

  - by user2658538

  I am making a simple metronome where it plays a tick sound every few milliseconds depending on the bpm and plays the sound using the winsound module. I use tkinter because there will be a gui component later but for now the metronome code is working, it plays the sound at a constant rate, but even though I set the after loop to play the sound every few milliseconds, it waits longer and the beat is slower than it should be. Is it a problem with the code or a problem with the way I calculate the time? Thanks. Here is my code. from Tkinter import * import winsound,time,threading root=Tk() c=Canvas(root) c.pack() class metronome(): def __init__(self,root,canvas,tempo=100): self.root=root self.root.bind("<1>",self.stop) self.c=canvas self.thread=threading.Thread(target=self.play) self.thread.daemon=True self.pause=False self.tempo=tempo/60.0 self.tempo=1.0/self.tempo self.tempo*=1000 def play(self): winsound.PlaySound("tick.wav",winsound.SND_FILENAME) self.sound=self.c.after(int(self.tempo),self.play) def stop(self,e): self.c.after_cancel(self.sound) beat=metronome(root,c,120) beat.thread.start() root.mainloop()

  Read the article

• Python - pickling fails for numpy.void objects

  - by I82Much

  >>> idmapfile = open("idmap", mode="w") >>> pickle.dump(idMap, idmapfile) >>> idmapfile.close() >>> idmapfile = open("idmap") >>> unpickled = pickle.load(idmapfile) >>> unpickled == idMap False idMap[1] {1537: (552, 1, 1537, 17.793827056884766, 3), 1540: (4220, 1, 1540, 19.31205940246582, 3), 1544: (592, 1, 1544, 18.129131317138672, 3), 1675: (529, 1, 1675, 18.347782135009766, 3), 1550: (4048, 1, 1550, 19.31205940246582, 3), 1424: (1528, 1, 1424, 19.744396209716797, 3), 1681: (1265, 1, 1681, 19.596025466918945, 3), 1560: (3457, 1, 1560, 20.530569076538086, 3), 1690: (477, 1, 1690, 17.395542144775391, 3), 1691: (554, 1, 1691, 13.446117401123047, 3), 1436: (3010, 1, 1436, 19.596025466918945, 3), 1434: (3183, 1, 1434, 19.744396209716797, 3), 1441: (3570, 1, 1441, 20.589576721191406, 3), 1435: (476, 1, 1435, 19.640911102294922, 3), 1444: (527, 1, 1444, 17.98480224609375, 3), 1478: (1897, 1, 1478, 19.596025466918945, 3), 1575: (614, 1, 1575, 19.371648788452148, 3), 1586: (2189, 1, 1586, 19.31205940246582, 3), 1716: (3470, 1, 1716, 19.158674240112305, 3), 1590: (2278, 1, 1590, 19.596025466918945, 3), 1463: (991, 1, 1463, 19.31205940246582, 3), 1594: (1890, 1, 1594, 19.596025466918945, 3), 1467: (1087, 1, 1467, 19.31205940246582, 3), 1596: (3759, 1, 1596, 19.744396209716797, 3), 1602: (3011, 1, 1602, 20.530569076538086, 3), 1547: (490, 1, 1547, 17.994071960449219, 3), 1605: (658, 1, 1605, 19.31205940246582, 3), 1606: (1794, 1, 1606, 16.964881896972656, 3), 1719: (1826, 1, 1719, 19.596025466918945, 3), 1617: (583, 1, 1617, 11.894925117492676, 3), 1492: (3441, 1, 1492, 20.500667572021484, 3), 1622: (3215, 1, 1622, 19.31205940246582, 3), 1628: (2761, 1, 1628, 19.744396209716797, 3), 1502: (1563, 1, 1502, 19.596025466918945, 3), 1632: (1108, 1, 1632, 15.457141876220703, 3), 1468: (3779, 1, 1468, 19.596025466918945, 3), 1642: (3970, 1, 1642, 19.744396209716797, 3), 1518: (612, 1, 1518, 18.570245742797852, 3), 1647: (854, 1, 1647, 16.964881896972656, 3), 1650: (2099, 1, 1650, 20.439058303833008, 3), 1651: (540, 1, 1651, 18.552841186523438, 3), 1653: (613, 1, 1653, 19.237197875976563, 3), 1532: (537, 1, 1532, 18.885730743408203, 3)} >>> unpickled[1] {1537: (64880, 1638, 56700, -1.0808743559293829e+18, 152), 1540: (64904, 1638, 0, 0.0, 0), 1544: (54472, 1490, 0, 0.0, 0), 1675: (6464, 1509, 0, 0.0, 0), 1550: (43592, 1510, 0, 0.0, 0), 1424: (43616, 1510, 0, 0.0, 0), 1681: (0, 0, 0, 0.0, 0), 1560: (400, 152, 400, 2.1299736657737219e-43, 0), 1690: (408, 152, 408, 2.7201111331839077e+26, 34), 1435: (424, 152, 61512, 1.0122952080313192e-39, 0), 1436: (400, 152, 400, 20.250289916992188, 3), 1434: (424, 152, 62080, 1.0122952080313192e-39, 0), 1441: (400, 152, 400, 12.250144958496094, 3), 1691: (424, 152, 42608, 15.813941955566406, 3), 1444: (400, 152, 400, 19.625289916992187, 3), 1606: (424, 152, 42432, 5.2947192852601414e-22, 41), 1575: (400, 152, 400, 6.2537390010262572e-36, 0), 1586: (424, 152, 42488, 1.0122601755697111e-39, 0), 1716: (400, 152, 400, 6.2537390010262572e-36, 0), 1590: (424, 152, 64144, 1.0126357235581501e-39, 0), 1463: (400, 152, 400, 6.2537390010262572e-36, 0), 1594: (424, 152, 32672, 17.002994537353516, 3), 1467: (400, 152, 400, 19.750289916992187, 3), 1596: (424, 152, 7176, 1.0124003054161436e-39, 0), 1602: (400, 152, 400, 18.500289916992188, 3), 1547: (424, 152, 7000, 1.0124003054161436e-39, 0), 1605: (400, 152, 400, 20.500289916992188, 3), 1478: (424, 152, 42256, -6.0222748507426518e+30, 222), 1719: (400, 152, 400, 6.2537390010262572e-36, 0), 1617: (424, 152, 16472, 1.0124283313854301e-39, 0), 1492: (400, 152, 400, 6.2537390010262572e-36, 0), 1622: (424, 152, 35304, 1.0123190301052127e-39, 0), 1628: (400, 152, 400, 6.2537390010262572e-36, 0), 1502: (424, 152, 63152, 19.627988815307617, 3), 1632: (400, 152, 400, 19.375289916992188, 3), 1468: (424, 152, 38088, 1.0124213248931084e-39, 0), 1642: (400, 152, 400, 6.2537390010262572e-36, 0), 1518: (424, 152, 63896, 1.0127436235399031e-39, 0), 1647: (400, 152, 400, 6.2537390010262572e-36, 0), 1650: (424, 152, 53424, 16.752857208251953, 3), 1651: (400, 152, 400, 19.250289916992188, 3), 1653: (424, 152, 50624, 1.0126497365427934e-39, 0), 1532: (400, 152, 400, 6.2537390010262572e-36, 0)} The keys come out fine, the values are screwed up. I tried same thing loading file in binary mode; didn't fix the problem. Any idea what I'm doing wrong? Edit: Here's the code with binary. Note that the values are different in the unpickled object. >>> idmapfile = open("idmap", mode="wb") >>> pickle.dump(idMap, idmapfile) >>> idmapfile.close() >>> idmapfile = open("idmap", mode="rb") >>> unpickled = pickle.load(idmapfile) >>> unpickled==idMap False >>> unpickled[1] {1537: (12176, 2281, 56700, -1.0808743559293829e+18, 152), 1540: (0, 0, 15934, 2.7457842047810522e+26, 108), 1544: (400, 152, 400, 4.9518498821046956e+27, 53), 1675: (408, 152, 408, 2.7201111331839077e+26, 34), 1550: (456, 152, 456, -1.1349175514578289e+18, 152), 1424: (432, 152, 432, 4.5939047815653343e-40, 11), 1681: (408, 152, 408, 2.1299736657737219e-43, 0), 1560: (376, 152, 376, 2.1299736657737219e-43, 0), 1690: (376, 152, 376, 2.1299736657737219e-43, 0), 1435: (376, 152, 376, 2.1299736657737219e-43, 0), 1436: (376, 152, 376, 2.1299736657737219e-43, 0), 1434: (376, 152, 376, 2.1299736657737219e-43, 0), 1441: (376, 152, 376, 2.1299736657737219e-43, 0), 1691: (376, 152, 376, 2.1299736657737219e-43, 0), 1444: (376, 152, 376, 2.1299736657737219e-43, 0), 1606: (25784, 2281, 376, -3.2883343074537754e+26, 34), 1575: (24240, 2281, 376, 2.1299736657737219e-43, 0), 1586: (24240, 2281, 376, 2.1299736657737219e-43, 0), 1716: (24240, 2281, 376, -3.0093091599657311e-35, 26), 1590: (24240, 2281, 376, 2.1299736657737219e-43, 0), 1463: (24240, 2281, 376, 2.1299736657737219e-43, 0), 1594: (24240, 2281, 376, -4123208450048.0, 196), 1467: (25784, 2281, 376, 2.1299736657737219e-43, 0), 1596: (25784, 2281, 376, 2.1299736657737219e-43, 0), 1602: (25784, 2281, 376, -5.9963281433905448e+26, 76), 1547: (25784, 2281, 376, -218106240.0, 139), 1605: (25784, 2281, 376, -3.7138649803377281e+27, 56), 1478: (376, 152, 376, 2.1299736657737219e-43, 0), 1719: (25784, 2281, 376, 2.1299736657737219e-43, 0), 1617: (25784, 2281, 376, -1.4411779941597184e+17, 237), 1492: (25784, 2281, 376, 2.8596493694487798e-30, 80), 1622: (25784, 2281, 376, 184686084096.0, 93), 1628: (1336, 152, 1336, 3.1691839245470052e+29, 179), 1502: (1272, 152, 1272, -5.2042207205116645e-17, 99), 1632: (1208, 152, 1208, 2.1299736657737219e-43, 0), 1468: (1144, 152, 1144, 2.1299736657737219e-43, 0), 1642: (1080, 152, 1080, 2.1299736657737219e-43, 0), 1518: (1016, 152, 1016, 4.0240902787680023e+35, 145), 1647: (952, 152, 952, -985172619034624.0, 237), 1650: (888, 152, 888, 12094787289088.0, 66), 1651: (824, 152, 824, 2.1299736657737219e-43, 0), 1653: (760, 152, 760, 0.00018310768064111471, 238), 1532: (696, 152, 696, 8.8978061885676389e+26, 125)} OK I've isolated the problem, but don't know why it's so. First, apparently what I'm pickling are not tuples (though they look like it), but instead numpy.void types. Here is a series to illustrate the problem. first = run0.detections[0] >>> first (1, 19, 1578, 82.637763977050781, 1) >>> type(first) <type 'numpy.void'> >>> firstTuple = tuple(first) >>> theFile = open("pickleTest", "w") >>> pickle.dump(first, theFile) >>> theTupleFile = open("pickleTupleTest", "w") >>> pickle.dump(firstTuple, theTupleFile) >>> theFile.close() >>> theTupleFile.close() >>> first (1, 19, 1578, 82.637763977050781, 1) >>> firstTuple (1, 19, 1578, 82.637764, 1) >>> theFile = open("pickleTest", "r") >>> theTupleFile = open("pickleTupleTest", "r") >>> unpickledTuple = pickle.load(theTupleFile) >>> unpickledVoid = pickle.load(theFile) >>> type(unpickledVoid) <type 'numpy.void'> >>> type(unpickledTuple) <type 'tuple'> >>> unpickledTuple (1, 19, 1578, 82.637764, 1) >>> unpickledTuple == firstTuple True >>> unpickledVoid == first False >>> unpickledVoid (7936, 1705, 56700, -1.0808743559293829e+18, 152) >>> first (1, 19, 1578, 82.637763977050781, 1)

  Read the article

• Efficient way in Python to remove an element from a comma-separated string

  - by ensnare

  I'm looking for the most efficient way to add an element to a comma-separated string while maintaining alphabetical order for the words: For example: string = 'Apples, Bananas, Grapes, Oranges' subtraction = 'Bananas' result = 'Apples, Grapes, Oranges' Also, a way to do this but while maintaining IDs: string = '1:Apples, 4:Bananas, 6:Grapes, 23:Oranges' subtraction = '4:Bananas' result = '1:Apples, 6:Grapes, 23:Oranges' Sample code is greatly appreciated. Thank you so much.

  Read the article

• How do I execute SQL_CALC_FOUND_ROWS in python MySQLDB

  - by alex

  cursor.execute("SELECT SQL_CALC_FOUND_ROWS user_id FROM...limit 5") rows = cursor.fetchall() ... total_rows = cursor.execute("SELECT FOUND_ROWS()") #this doesn't work for some reason. Edit: I tried SELECT FOUND_ROWS() FROM my_table...and the numbers are funky.

  Read the article

• Python unicode search not giving correct answer

  - by user1318912

  I am trying to search hindi words contained one line per file in file-1 and find them in lines in file-2. I have to print the line numbers with the number of words found. This is the code: import codecs hypernyms = codecs.open("hindi_hypernym.txt", "r", "utf-8").readlines() words = codecs.open("hypernyms_en2hi.txt", "r", "utf-8").readlines() count_arr = [] for counter, line in enumerate(hypernyms): count_arr.append(0) for word in words: if line.find(word) >=0: count_arr[counter] +=1 for iterator, count in enumerate(count_arr): if count>0: print iterator, ' ', count This is finding some words, but ignoring some others The input files are: File-1: ???? ??????? File-2: ???????, ????-???? ?????-???, ?????-???, ?????_???, ?????_??? ????_????, ????-????, ???????_???? ????-???? This gives output: 0 1 3 1 Clearly, it is ignoring ??????? and searching for ???? only. I have tried with other inputs as well. It only searches for one word. Any idea how to correct this?

  Read the article

• strip spaces in python.

  - by Richard

  ok I know that this should be simple... anyways say: line = "$W5M5A,100527,142500,730301c44892fd1c,2,686.5 4,333.96,0,0,28.6,123,75,-0.4,1.4*49" I want to strip out the spaces. I thought you would just do this line = line.strip() but now line is still '$W5M5A,100527,142500,730301c44892fd1c,2,686.5 4,333.96,0,0,28.6,123,75,-0.4,1.4*49' instead of '$W5M5A,100527,142500,730301c44892fd1c,2,686.54,333.96,0,0,28.6,123,75,-0.4,1.4*49' any thoughts?

  Read the article

• Unique elements of list within list in python

  - by user2901061

  We are given a list of animals in different zoos and need to find which zoos have animals that are not in any others. The animals of each zoo are separated by spaces, and each zoo is originally separated by a comma. I am currently enumerating over all of the zoos to split each animal and create lists within lists for different zoos as such: for i, zoo in enumerate(zoos): zoos[i] = zoo.split() However, I then do not know how to tell and count how many of the zoos have unique animals. I figure it is something else with enumerate and possibly sets, but cannot get it down exactly. Any help is greatly appreciated. Thanks

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• strip tags python

  - by user283405

  i want the following functionality. input : this is test bold text normal text expected output: this is test normal text the tags can be changed.

  Read the article

• Dynamic variable name in python

  - by PhilGo20

  I'd like to call a query with a field name filter that I wont know before run time... Not sure how to construct the variable name ...Or maybe I am tired. field_name = funct() locations = Locations.objects.filter(field_name__lte=arg1) where if funct() returns name would equal to locations = Locations.objects.filter(name__lte=arg1) Not sure how to do that ...

  Read the article

• Sympy python circumference

  - by Mattia Villani

  I need to display a circumference. In order to do that I thought I could calculata for a lot of x the two values of y, so I did: import sympy as sy from sympy.abc import x,y f = x**2 + y**2 - 1 a = x - 0.5 sy.solve([f,a],[x,y]) and this is what I get: Traceback (most recent call last): File "<input>", line 1, in <module> File "/usr/lib/python2.7/dist-packages/sympy/solvers/solvers.py", line 484, in solve solution = _solve(f, *symbols, **flags) File "/usr/lib/python2.7/dist-packages/sympy/solvers/solvers.py", line 749, in _solve result = solve_poly_system(polys) File "/usr/lib/python2.7/dist-packages/sympy/solvers/polysys.py", line 40, in solve_poly_system return solve_biquadratic(f, g, opt) File "/usr/lib/python2.7/dist-packages/sympy/solvers/polysys.py", line 48, in solve_biquadratic G = groebner([f, g]) File "/usr/lib/python2.7/dist-packages/sympy/polys/polytools.py", line 5308, i n groebner raise DomainError("can't compute a Groebner basis over %s" % domain) DomainError: can't compute a Groebner basis over RR How can I calculate the y's values ?

  Read the article

• Python string formatting too slow

  - by wich

  I use the following code to log a map, it is fast when it only contains zeroes, but as soon as there is actual data in the map it becomes unbearably slow... Is there any way to do this faster? log_file = open('testfile', 'w') for i, x in ((i, start + i * interval) for i in range(length)): log_file.write('%-5d %8.3f %13g %13g %13g %13g %13g %13g\n' % (i, x, map[0][i], map[1][i], map[2][i], map[3][i], map[4][i], map[5][i]))

  Read the article

< Previous Page | 163 164 165 166 167 168 169 170 171 172 173 174  | Next Page >