Search Results

Search found 10556 results on 423 pages for 'practical approach'.

Page 170/423 | < Previous Page | 166 167 168 169 170 171 172 173 174 175 176 177  | Next Page >

  • In flex how do I pass data retrieved from a remote object service to a modules interface?

    - by Dan G
    I found at this Adobe tutorial a nice "RemoteService" class that creates a RemoteObject and contains the functions for handling the result and fault events. If I wanted to use this approach, how could I pass the data from the result handler to interfaces that modules from the main application could use? I could put the RemoteService/RemoteObject in the modules, but (in my opinion- and I could be wrong) the best design seems to be using the remote calls in the main app and passing the data along to the modules.

    Read the article

  • Unit testing MVC.net Redirection

    - by Dan
    How do I Unit Test a MVC redirection? public ActionResult Create(Product product) { _productTask.Save(product); return RedirectToAction("Success"); } public ActionResult Success() { return View(); } Is Ayende's approach still the best way to go, with preview 5: public static void RenderView(this Controller self, string action) { typeof(Controller).GetMethod("RenderView").Invoke(self,new object[] { action} ); } Seems odd to have to do this, especially as the MVC team have said they are writing the framework to be testable.

    Read the article

  • MySQL & PHP: auto connect to DB or to properly way to pass host/db to MySQL methods

    - by SODA
    Hi, does anyone know of a known method in PHP to auto connect to MySQL db/table in case an app is using multiple databases on multiple hosts? Question 1: are there scripts around that allow to auto connect to necessary host/DB based on query? Question 2: if above is not possible, is there a known approach to properly passing host/DB info to make sure app is properly connected before executing the query?

    Read the article

  • How to use an IN clause in iBATIS?

    - by furtelwart
    I'm using iBATIS to create select statements. Now I would like to implement the following SQL statement with iBATIS: SELECT * FROM table WHERE col1 IN ('value1', 'value2'); With the following approach, the statement is not prepared correctly and no result returns: SELECT * FROM table WHERE col1 IN #listOfValues#; iBATIS seems to restructure this list and tries to interpret it as a string. How can I use the IN clause correctly?

    Read the article

  • apply style to range of text with javascript in uiwebview

    - by drawnonward
    I am displaying some simple styled text as html in a UIWebView on iPhone. It is basically a series of paragraphs with the occasional strong or emphasized phrase. At runtime I need to apply styles to ranges of text. There are a few similar scenarios, one of which is highlighting search results. If the user has searched for "something" I would like to change the background color behind occurrences of the word, then later restore the original background. Is it possible to apply styles to ranges of text using javascript? A key part of this is also being able to unset the styles. There seem to be two likely paths to follow. One would be modifying some html in Objective-C and passing it through javascript as the new innerHTML of some container. The other would be to use javascript to directly manipulate DOM nodes. I could manipulate html, but that sounds tedious in Objective-C so I would rather manipulate the DOM if that is a reasonable approach. I am not that familiar with javascript and DOM so I do not know if it is a reasonable approach. I wrote some routines to translate between text ranges and node ranges with offsets. So if I start with text range 100-200 and that starts in one paragraph and ends in a third, I can get the text nodes and the offsets within the nodes that represent the given text range. I just need a way to split a text node at an offset in the text. Currently I just apply styles to the paragraphs containing the text range. A few notes: straight javascript please, no external frameworks like jquery. the changes never need to be written to disk. the changes should be undoable or at least removable. the styles to apply already exist in a css file. it needs to work in iPhone 3.0 and forward. all the source files are shipped with the app. please be verbose. Thanks for any suggestions.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Navbar Menu Trouble shoot

    - by Nabeel M
    So I wanted to create the fixed nav bar on top of the page. Instead of creating nav bar with ordered list, I used the following approach: <header> <div class="nav"> <img src="images/logo_ab.png" alt="AurinBioTech Logo"/> <a href="index.html">Home</a> <a href="#">About</a> <a href="#">Team</a> <a href="#">Science</a> <a href="#">Need</a> <a href="#">Pipeline</a> <a href="#">Contact</a> </div> </header> CSS: header .nav { margin-top:100px; width:100%; height:10%; text-align:center; padding-top:2%; margin:0 auto; position:fixed; top:0; } header .nav a { font-size: 2em; padding-left: 15px; padding-right: 15px; color:rgb(1, 1, 1); text-decoration: none; font-family: 'Bebas'; } header .nav a:hover { color:white; background-color: #404040; border-radius:5px; padding:0 auto; } header .nav a:active{ background-color: #404040; border-radius:5px; text-decoration:overline; } header .nav img { width:260px; height:65px; padding-right:4em; } The reason I used this approach is because I wanted to use logo image next to the nav bar so it would align properly in the same line. Now the problem is that I need to add sub-menus under Science and Pipeline heading. Since I didn't use UL or LI, how can I add sub-menus under those heading. OR, can you tell me any other way to create a NAV bar that shows the logo as well. so it would be LOGO and MENUS on the same line. Great thanks in advance.

    Read the article

  • Debugging TestNG configuration failures

    - by Ula Karzelek
    I'm running testng from ant. I'm using my own test listeners. I'm refactoring the code and once a while I got [testng] Total tests run: 7, Failures: 0, Skips: 7 [testng] Configuration Failures: 1, Skips: 2 What will be the best approach to fix configuration failures?

    Read the article

  • How to cutomize a modelform widget in django 1.1?

    - by muudscope
    I'm trying to modify a django form to use a textarea instead of a normal input for the "address" field in my house form. The docs seem to imply this changed from django 1.1 (which I'm using) to 1.2. But neither approach is working for me. Here's what I've tried: class HouseForm(forms.ModelForm): address = forms.Textarea() # Should work with django 1.1, but doesn't class Meta: model = House #widgets = { 'address': forms.Textarea() } # 1.2 style - doesn't work either.

    Read the article

  • How to pass operators as parameters

    - by Rodion Ingles
    I have to load an array of doubles from a file, multiply each element by a value in a table (different values for different elements), do some work on it, invert the multiplication (that is, divide) and then save the data back to file. Currently I implement the multiplication and division process in two separate methods. Now there is some extra work behind the scenes but apart from the specific statements where the multiplication/division occurs, the rest of the code is identical. As you can imagine, with this approach you have to be very careful making any changes. The surrounding code is not trivial, so its either a case of manually editing each method or copying changes from one method to the other and remembering to change the * and / operators. After too many close calls I am fed up of this and would like to make a common function which implements the common logic and two wrapper functions which pass which operator to use as a parameter. My initial approach was to use function pointers: MultiplyData(double data) { TransformData(data, &(operator *)); } DivideData(double data) { TransformData(data, &(operator /)); } TransformData(double data, double (*func)(double op1, double op2)) { /* Do stuff here... */ } However, I can't pass the operators as pointers (is this because it is an operator on a native type?), so I tried to use function objects. Initially I thought that multiplies and divides functors in <functional> would be ideal: MultiplyData(double data) { std::multiplies<double> multFunct; TransformData(data, &multFunct); } DivideData(double data) { std::divides<double> divFunct; TransformData(data, &divFunct); } TransformData(double data, std::binary_function<double, double, double> *funct) { /* Do stuff here... */ } As you can see I was trying to use a base class pointer to pass the functor polymorphically. The problem is that std::binary_function does not declare an operator() member for the child classes to implement. Is there something I am missing, or is the solution to implement my own functor heirarchy (which really seems more trouble than it is worth)?

    Read the article

  • Validating Internationalized URLs

    - by VirtuosiMedia
    After reading about the new Arabic URLs, and with more languages to come, how should URL validation be done for internationalized applications? Does the validation change at all and will existing solutions break? Is regex still a good approach? If so, what would that regex look like? If not, what's a good strategy? What are some good resources to read more on the topic?

    Read the article

  • Function that converts hex color values to an approximate color name?

    - by dclowd9901
    I don't suppose anyone knows of a function (PHP, preferably) that can take a hex color code and give an approximate color name for that hex value. I don't need a solution with 100s of colors. Even if it just amounted to the colors white, black, red, green blue, brown orange and yellow, I'd be pretty well in shape. If you don't know of an existing resource, does anyone know of a good way to approach this problem? Thanks in advance for the help.

    Read the article

  • Audio decoding delay when changing the audio language

    - by mahendiran.b
    My gstreamer Pipeline is like this Approach1 --------------input-selector->Queue->AduioParser->AudioSink | Souphttpsrc->tsdemux-->| | --------------- Queue->videoParser->videoSink In this approach 1, there is a delay in audio decoding when I toggle between various audio language. Approach2 ------ input-selector-> Queue->AduioParser->AudioSink | Souphttpsrc->tsdemux---multiqueue>| | ------- Queue->videoParser->VideoSink But there is no delay is observed in approach2. Can anyone please explain the reason behind this ? what is the specialty of multiqueue here?

    Read the article

  • Encryption messages in a queue between 2 dlls.

    - by scope-creep
    Hi, I'm sending messages between 1 dll and another, effectively posting messages onto the dll input queue and receiving a messages back from the dll output queue. These two dlls are very tightly integrated. DLL 1 is a producer,and DLL2 is the consumer. I want to encrypt the messages before they are sent. What would be the best approach? Any help would be appreciated.

    Read the article

  • MSBuild CreateItem condition include based on config file

    - by Mac
    I'm trying to select a list of test dlls that contain corresponding config files MyTest.Tests.dll MyTest.Tests.config I have to use a createItem as the dlls are not available at the time of the script loading <CreateItem Include="$(AssemblyFolder)\*.Tests.dll" Condition="???" <Output TaskParameter="Include" ItemName="TestBinariesWithConfig"/> </CreateItem> Is there a condition I can use or is this the wrong approach? Thanks Mac

    Read the article

< Previous Page | 166 167 168 169 170 171 172 173 174 175 176 177  | Next Page >