How do I split on all nonalphanumeric characters, EXCEPT the apostrophe?
re.split('\W+',text)
works, but will also split on apostrophes. How do I add an exception to this rule?
Thanks!
I am trying to search hindi words contained one line per file in file-1 and find them in lines in file-2. I have to print the line numbers with the number of words found.
This is the code:
import codecs
hypernyms = codecs.open("hindi_hypernym.txt", "r", "utf-8").readlines()
words = codecs.open("hypernyms_en2hi.txt", "r", "utf-8").readlines()
count_arr = []
for counter, line in enumerate(hypernyms):
count_arr.append(0)
for word in words:
if line.find(word) >=0:
count_arr[counter] +=1
for iterator, count in enumerate(count_arr):
if count>0:
print iterator, ' ', count
This is finding some words, but ignoring some others
The input files are:
File-1:
????
???????
File-2:
???????, ????-????
?????-???, ?????-???, ?????_???, ?????_???
????_????, ????-????, ???????_????
????-????
This gives output:
0 1
3 1
Clearly, it is ignoring ??????? and searching for ???? only. I have tried with other inputs as well. It only searches for one word. Any idea how to correct this?
I'm creating a property on a Django model called "address". I want address to consist of the concatenation of a number of fields I have on my model. The problem is that not all instances of this model will have values for all of these fields. So, I want to concatenate only those fields that have values.
What is the best/most Pythonic way to do this?
Here are the relevant fields from the model:
house = models.IntegerField('House Number', null=True, blank=True)
suf = models.CharField('House Number Suffix', max_length=1, null=True, blank=True)
unit = models.CharField('Address Unit', max_length=7, null=True, blank=True)
stex = models.IntegerField('Address Extention', null=True, blank=True)
stdir = models.CharField('Street Direction', max_length=254, null=True, blank=True)
stnam = models.CharField('Street Name', max_length=30, null=True, blank=True)
stdes = models.CharField('Street Designation', max_length=3, null=True, blank=True)
stdessuf = models.CharField('Street Designation Suffix',max_length=1, null=True, blank=True)
I could just do something like this:
def _get_address(self):
return "%s %s %s %s %s %s %s %s" % (self.house, self.suf, self.unit, self.stex, self.stdir, self.stname, self.stdes, self.stdessuf)
but then there would be extra blank spaces in the result.
I could do a series of if statements and concatenate within each, but that seems ugly.
What's the best way to handle this situation?
Thanks.
ok I know that this should be simple... anyways say:
line = "$W5M5A,100527,142500,730301c44892fd1c,2,686.5 4,333.96,0,0,28.6,123,75,-0.4,1.4*49"
I want to strip out the spaces. I thought you would just do this
line = line.strip()
but now line is still '$W5M5A,100527,142500,730301c44892fd1c,2,686.5 4,333.96,0,0,28.6,123,75,-0.4,1.4*49' instead of '$W5M5A,100527,142500,730301c44892fd1c,2,686.54,333.96,0,0,28.6,123,75,-0.4,1.4*49'
any thoughts?
I'd like to call a query with a field name filter that I wont know before run time... Not sure how to construct the variable name ...Or maybe I am tired.
field_name = funct()
locations = Locations.objects.filter(field_name__lte=arg1)
where if funct() returns name would equal to
locations = Locations.objects.filter(name__lte=arg1)
Not sure how to do that ...
I'm looking for the most efficient way to add an element to a comma-separated string while maintaining alphabetical order for the words:
For example:
string = 'Apples, Bananas, Grapes, Oranges'
subtraction = 'Bananas'
result = 'Apples, Grapes, Oranges'
Also, a way to do this but while maintaining IDs:
string = '1:Apples, 4:Bananas, 6:Grapes, 23:Oranges'
subtraction = '4:Bananas'
result = '1:Apples, 6:Grapes, 23:Oranges'
Sample code is greatly appreciated. Thank you so much.
I have code that uses the BeautifulSoup library for parsing, but it is very slow. The code is written in such a way that threads cannot be used.
Can anyone help me with this?
I am using BeautifulSoup for parsing and than save into a DB. If I comment out the save statement, it still takes a long time, so there is no problem with the database.
def parse(self,text):
soup = BeautifulSoup(text)
arr = soup.findAll('tbody')
for i in range(0,len(arr)-1):
data=Data()
soup2 = BeautifulSoup(str(arr[i]))
arr2 = soup2.findAll('td')
c=0
for j in arr2:
if str(j).find("<a href=") > 0:
data.sourceURL = self.getAttributeValue(str(j),'<a href="')
else:
if c == 2:
data.Hits=j.renderContents()
#and few others...
c = c+1
data.save()
Any suggestions?
Note: I already ask this question here but that was closed due to incomplete information.
We are given a list of animals in different zoos and need to find which zoos have animals that are not in any others. The animals of each zoo are separated by spaces, and each zoo is originally separated by a comma.
I am currently enumerating over all of the zoos to split each animal and create lists within lists for different zoos as such:
for i, zoo in enumerate(zoos):
zoos[i] = zoo.split()
However, I then do not know how to tell and count how many of the zoos have unique animals. I figure it is something else with enumerate and possibly sets, but cannot get it down exactly. Any help is greatly appreciated.
Thanks
def foo(a):
a.append(1)
if len(a) > 10:
print a
return a
else:
foo(a)
Why this recursive function returns None (see transcript below)? I can't quite understand what I am doing wrong.
In [263]: x = []
In [264]: y = foo(x)
[1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1]
In [265]: print y
None
The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it:
What is the fastest (least execution
time) way to split a text file in to
ALL (overlapping) substrings of size N (bound N, eg 36)
while throwing out newline characters.
I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like.
As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module.
Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do.
My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8
import cStringIO
example_file = cStringIO.StringIO("""\
header
CAGTcag
TFgcACF
""")
for read in parse(example_file):
... print read
...
CAGTCAGTF
AGTCAGTFG
GTCAGTFGC
TCAGTFGCA
CAGTFGCAC
AGTFGCACF
The function that I found had the absolute best performance from the methods I could think of is this:
def parse(file):
size = 8 # of course in my code this is a function argument
file.readline() # skip past the header
buffer = ''
for line in file:
buffer += line.rstrip().upper()
while len(buffer) = size:
yield buffer[:size]
buffer = buffer[1:]
This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community.
Thanks!
Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size.
Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!
First off, I'm relatively new to Google App Engine, so I'm probably doing something silly.
Say I've got a model Foo:
class Foo(db.Model):
name = db.StringProperty()
I want to use name as a unique key for every Foo object. How is this done?
When I want to get a specific Foo object, I currently query the datastore for all Foo objects with the target unique name, but queries are slow (plus it's a pain to ensure that name is unique when each new Foo is created).
There's got to be a better way to do this!
Thanks.
hi,
i am using cairoplot, to make graphs, however the file from where i am reading the data is growing huge and its taking a long time to process the graph
is there any real-time way to produce cairo graph, or at least store the previous readings..like rrd.
-krisdigitx
I use the following code to log a map, it is fast when it only contains zeroes, but as soon as there is actual data in the map it becomes unbearably slow... Is there any way to do this faster?
log_file = open('testfile', 'w')
for i, x in ((i, start + i * interval) for i in range(length)):
log_file.write('%-5d %8.3f %13g %13g %13g %13g %13g %13g\n' % (i, x,
map[0][i], map[1][i], map[2][i], map[3][i], map[4][i], map[5][i]))
I have some code in which is throwing an error (I'm using repl.it)
import random
students = ['s1:0','s2:0','s3:0']
while True:
print'\n'*50
print'Ticket Machine'.center(80)
print'-'*80
print'1. Clear Student Ticket Values'.center(80)
print'2. Draw Tickets'.center(80)
menu = raw_input('-'*80+'\nChoose an Option: ')
if menu == '1':
print'\n'*50
print'CLEARED!'
students = ['s1:0','s2:0','s3:0']
raw_input('Press enter to return to the main menu!')
elif menu == '2':
tickets = []
print'\n'*50
times = int(raw_input('How many tickets to draw? ')
for a in students:
for i in range(a.split(':')[1]):
tickets.append(a.split(':')[0])
for b in range(1,times+1):
print str(b) + '. ' + random.choice(tickets)
else:
print'\n'*50
print'That was not an option!'
raw_input('Press enter to return to the main menu!')
But it is throwing this error:
File "<stdin>", line 19
for a in students:
^
SyntaxError: invalid syntax
I am planning on using this in a class, but I can't use it until the bug is fixed, also, student names have been removed for privacy reasons.
i wrote the code like this
import smtplib
server=smtplib.SMTP('localhost')
then it raising an error like
error: [Errno 10061] No connection could be made because the target machine actively refused it
i am new to SMTP can you tell what exactly the problem is
I have used the 2to3 utility to convert code from the command line. What I would like to do is run it basically as a unittest. Even if it tests the file rather than parts(funtions, methods...) as would be normal for a unittest.
It does not need to be a unittest and I don't what to automatically convert the files I just want to monitor the py3 compliance of files in a unittest like manor. I can't seem to find any documentation or examples for this.
An example and/or documentation would be great.
Thanks
I am making a simple metronome where it plays a tick sound every few milliseconds depending on the bpm and plays the sound using the winsound module. I use tkinter because there will be a gui component later but for now the metronome code is working, it plays the sound at a constant rate, but even though I set the after loop to play the sound every few milliseconds, it waits longer and the beat is slower than it should be. Is it a problem with the code or a problem with the way I calculate the time?
Thanks.
Here is my code.
from Tkinter import *
import winsound,time,threading
root=Tk()
c=Canvas(root)
c.pack()
class metronome():
def __init__(self,root,canvas,tempo=100):
self.root=root
self.root.bind("<1>",self.stop)
self.c=canvas
self.thread=threading.Thread(target=self.play)
self.thread.daemon=True
self.pause=False
self.tempo=tempo/60.0
self.tempo=1.0/self.tempo
self.tempo*=1000
def play(self):
winsound.PlaySound("tick.wav",winsound.SND_FILENAME)
self.sound=self.c.after(int(self.tempo),self.play)
def stop(self,e):
self.c.after_cancel(self.sound)
beat=metronome(root,c,120)
beat.thread.start()
root.mainloop()
matrix
is a list of lists. I've to return a dictionary of the form
{i:(l1[i],l2[i],...,lm[i])}
Where the key i is matched with a tuple the i'th elements
from each list.
Say
matrix=[[1,2,3,4],[9,8,7,6],[4,8,2,6]]
so the line:
>>> dict([(i,tuple(matrix[k][i] for k in xrange(len(matrix)))) for i in xrange(len(matrix[0]))])
does the job pretty well and outputs:
{0: (1, 9, 4), 1: (2, 8, 8), 2: (3, 7, 2), 3: (4, 6, 6)}
but fails if the matrix is empty: matrix=[]. The output should be: {}
How can i deal with this?
I have a class that dynamically overloads basic arithmetic operators like so...
import operator
class IshyNum:
def __init__(self, n):
self.num=n
self.buildArith()
def arithmetic(self, other, o):
return o(self.num, other)
def buildArith(self):
map(lambda o: setattr(self, "__%s__"%o,lambda f: self.arithmetic(f, getattr(operator, o))), ["add", "sub", "mul", "div"])
if __name__=="__main__":
number=IshyNum(5)
print number+5
print number/2
print number*3
print number-3
But if I change the class to inherit from the dictionary (class IshyNum(dict):) it doesn't work. I need to explicitly def __add__(self, other) or whatever in order for this to work. Why?
I need to display a circumference. In order to do that I thought I could calculata for a lot of x the two values of y, so I did:
import sympy as sy
from sympy.abc import x,y
f = x**2 + y**2 - 1
a = x - 0.5
sy.solve([f,a],[x,y])
and this is what I get:
Traceback (most recent call last):
File "<input>", line 1, in <module>
File "/usr/lib/python2.7/dist-packages/sympy/solvers/solvers.py", line 484, in
solve
solution = _solve(f, *symbols, **flags)
File "/usr/lib/python2.7/dist-packages/sympy/solvers/solvers.py", line 749, in
_solve
result = solve_poly_system(polys)
File "/usr/lib/python2.7/dist-packages/sympy/solvers/polysys.py", line 40, in
solve_poly_system
return solve_biquadratic(f, g, opt)
File "/usr/lib/python2.7/dist-packages/sympy/solvers/polysys.py", line 48, in
solve_biquadratic
G = groebner([f, g])
File "/usr/lib/python2.7/dist-packages/sympy/polys/polytools.py", line 5308, i
n groebner
raise DomainError("can't compute a Groebner basis over %s" % domain)
DomainError: can't compute a Groebner basis over RR
How can I calculate the y's values ?
If I have a string that looks like either
./A/B/c.d
OR
.\A\B\c.d
How do I get just the "./A/B/" part? The direction of the slashes can be the same as they are passed.
This problem kinda boils down to: How do I get the last of a specific character in a string?
Basically, I want the path of a file without the file part of it.
I'm looking for a way to compress an ascii-based string, any help?
I need also need to decompress it. I tried zlib but with no help.
What can I do to compress the string into lesser length?
code:
def compress(request):
if request.POST:
data = request.POST.get('input')
if is_ascii(data):
result = zlib.compress(data)
return render_to_response('index.html', {'result': result, 'input':data}, context_instance = RequestContext(request))
else:
result = "Error, the string is not ascii-based"
return render_to_response('index.html', {'result':result}, context_instance = RequestContext(request))
else:
return render_to_response('index.html', {}, context_instance = RequestContext(request))
I need to remove all the html tags from a given webpage data. I tried this using regular expressions:
import urllib2
import re
page = urllib2.urlopen("http://www.frugalrules.com")
from bs4 import BeautifulSoup, NavigableString, Comment
soup = BeautifulSoup(page)
link = soup.find('link', type='application/rss+xml')
print link['href']
rss = urllib2.urlopen(link['href']).read()
souprss = BeautifulSoup(rss)
description_tag = souprss.find_all('description')
content_tag = souprss.find_all('content:encoded')
print re.sub('<[^>]*>', '', content_tag)
But the syntax of the re.sub is:
re.sub(pattern, repl, string, count=0)
So, I modified the code as (instead of the print statement above):
for row in content_tag:
print re.sub(ur"<[^>]*>",'',row,re.UNICODE
But it gives the following error:
Traceback (most recent call last):
File "C:\beautifulsoup4-4.3.2\collocation.py", line 20, in <module>
print re.sub(ur"<[^>]*>",'',row,re.UNICODE)
File "C:\Python27\lib\re.py", line 151, in sub
return _compile(pattern, flags).sub(repl, string, count)
TypeError: expected string or buffer
What am I doing wrong?
I have an array of files. I'd like to be able to break that array down into one array with multiple subarrays, each subarray contains files that were created on the same day. So right now if the array contains files from March 1 - March 31, I'd like to have an array with 31 subarrays (assuming there is at least 1 file for each day).
In the long run, I'm trying to find the file from each day with the latest creation/modification time. If there is a way to bundle that into the iterations that are required above to save some CPU cycles, that would be even more ideal. Then I'd have one flat array with 31 files, one for each day, for the latest file created on each individual day.