Search Results

Search found 5279 results on 212 pages for 'optional arguments'.

Page 173/212 | < Previous Page | 169 170 171 172 173 174 175 176 177 178 179 180  | Next Page >

  • Why does Python sometimes upgrade a string to unicode and sometimes not?

    - by samtregar
    I'm confused. Consider this code working the way I expect: >>> foo = u'Émilie and Juañ are turncoats.' >>> bar = "foo is %s" % foo >>> bar u'foo is \xc3\x89milie and Jua\xc3\xb1 are turncoats.' And this code not at all working the way I expect: >>> try: ... raise Exception(foo) ... except Exception as e: ... foo2 = e ... >>> bar = "foo2 is %s" % foo2 ------------------------------------------------------------ Traceback (most recent call last): File "<ipython console>", line 1, in <module> UnicodeEncodeError: 'ascii' codec can't encode characters in position 0-1: ordinal not in range(128) Can someone explain what's going on here? Why does it matter whether the unicode data is in a plain unicode string or stored in an Exception object? And why does this fix it: >>> bar = u"foo2 is %s" % foo2 >>> bar u'foo2 is \xc3\x89milie and Jua\xc3\xb1 are turncoats.' I am quite confused! Thanks for the help! UPDATE: My coding buddy Randall has added to my confusion in an attempt to help me! Send in the reinforcements to explain how this is supposed to make sense: >>> class A: ... def __str__(self): return "string" ... def __unicode__(self): return "unicode" ... >>> "%s %s" % (u'niño', A()) u'ni\xc3\xb1o unicode' >>> "%s %s" % (A(), u'niño') u'string ni\xc3\xb1o' Note that the order of the arguments here determines which method is called!

    Read the article

  • How to mimic polymorphism in classes with template methods (c++)?

    - by davide
    in the problem i am facing i need something which works more or less like a polymorphic class, but which would allow for virtual template methods. the point is, i would like to create an array of subproblems, each one being solved by a different technique implemented in a different class, but holding the same interface, then pass a set of parameters (which are functions/functors - this is where templates jump up) to all the subproblems and get back a solution. if the parameters would be, e.g., ints, this would be something like: struct subproblem { ... virtual void solve (double& solution, double parameter)=0; } struct subproblem0: public subproblem { ... virtual void solve (double& solution, double parameter){...}; } struct subproblem1: public subproblem { ... virtual void solve (double* solution, double parameter){...}; } int main{ subproblem problem[2]; subproblem[0] = new subproblem0(); subproblem[1] = new subproblem1(); double argument0(0), argument1(1), sol0[2], sol1[2]; for(unsigned int i(0);i<2;++i) { problem[i]->solve( &(sol0[i]) , argument0); problem[i]->solve( &(sol1[i]) , argument1); } return 0; } but the problem is, i need the arguments to be something like Arg<T1,T2> argument0(f1,f2) and thus the solve method to be something of the likes of template<T1,T2> solve (double* solution, Arg<T1,T2> parameter) which cant obviously be declared virtual ( so cant be called from a pointer to the base class)... now i'm pretty stuck and don't know how to procede...

    Read the article

  • Error while sending mail (attachment file)

    - by Surya sasidhar
    hi, in my application i am using to send mail with attachments i write the code like this Using System.Net.Mail; MailMessage mail = new MailMessage(); mail.Body = "<html><body><b> Name Of The Job Seeker: " + txtName.Text + "<br><br>" + "The Mail ID:" + txtEmail.Text + "<br><br>" + " The Mobile Number: " + txtmobile.Text + "<br><br>" + "Position For Applied: " + txtPostionAppl.Text + "<br><br>" + "Description " + txtdescript.Text + "<br><br></b></body></html>"; mail.From = new MailAddress ( txtEmail.Text); mail.To .Add (new MailAddress ( mailid)); mail.Priority = MailPriority.High; FileUpload1.PostedFile.SaveAs("~/Resume/" + FileUpload1.FileName); mail.Attachments.Add(filenme); SmtpMail sm = new SmtpMail(); sm.Send(mail); it is giving error at attachment like mail.Attachemts.Add(filena) like this 'System.Collections.ObjectModel.Collection.Add(System.Net.Mail.Attachment)' has some invalid arguments.

    Read the article

  • How to solve this problem with Python

    - by morpheous
    I am "porting" an application I wrote in C++ into Python. This is the current workflow: Application is started from the console Application parses CLI args Application reads an ini configuration file which specifies which plugins to load etc Application starts a timer Application iterates through each loaded plugin and orders them to start work. This spawns a new worker thread for the plugin The plugins carry out their work and when completed, they die When time interval (read from config file) is up, steps 5-7 is repeated iteratively Since I am new to Python (2 days and counting), the distinction between script, modules and packages are still a bit hazy to me, and I would like to seek advice from Pythonista as to how to implement the workflow described above, using Python as the programing language. In order to keep things simple, I have decided to leave out the time interval stuff out, and instead run the python script/scripts as a cron job instead. This is how I am thinking of approaching it: Encapsulate the whole application in a package which is executable (i.e. can be run from the command line with arguments. Write the plugins as modules (I think maybe its better to implement each module in a separate file?) I havent seen any examples of using threading in Python yet. Could someone provide a snippet of how I could spawn a thread to run a module. Also, I am not sure how to implement the concept of plugins in Python - any advice would be helpful - especially with a code snippet.

    Read the article

  • How do i make multi call with SudzC

    - by laxonline
    I am developing magento eCommerce stores in iPhone. For that, i have using Sudzc service class for SOAP WS call. Now, I'm trying to create a cart session its working fine. im getting the cardid. And i need to add one product to cart with some arguments. below is the php request example i need to call same this PHP Request Example $proxy = new SoapClient('http://beta.saletab.com/api/soap/?wsdl'); $sessionId = $proxy->login('xxxx', 'zzzzzzzzzzzzzzzzzzzzzzzzz'); //print_r($sessionId); $shoppingCartId = $proxy->call( $sessionId, 'cart.create'); $result = $proxy->call($sessionId,'cart_product.add',array($shoppingCartId,array('product_id'=>"3109",'qty' => 2)),0); echo "REQUEST HEADERS:\n" . $result->__getLastRequestHeaders() . "\n"; IOS Request im trying to send some product details like productid, sku & cardid SDZMagentoService *service = [SDZMagentoService service]; NSString *sessionId = [IMAPP_DELEGATE getUserDefault:IMAPI_SESSIONID]; NSString *cartId = [IMAPP_DELEGATE getUserDefault:IMAPI_CARTSESSIONID]; NSDictionary *argu = [[NSDictionary alloc] initWithObjectsAndKeys:@"3109",@"product_id",@"2",@"qty",cartId,@"card_id", nil]; [service call:self action:@selector(cartTest:) sessionId:sessionId resourcePath:@"cart_product.add" args:argu];

    Read the article

  • Re-usable Obj-C classes with custom values: The right way

    - by Prairiedogg
    I'm trying to reuse a group of Obj-C clases between iPhone applications. The values that differ from app to app have been isolated and I'm trying to figure out the best way to apply these custom values to the classes on an app-to-app basis. Should I hold them in code? // I might have 10 customizable values for each class, that's a long signature! CarController *controller = [[CarController alloc] initWithFontName:@"Vroom" engine:@"Diesel" color:@"Red" number:11]; Should I store them in a big settings.plist? // Wasteful! I sometimes only use 2-3 of 50 settings! AllMyAppSettings *settings = [[AllMyAppSettings alloc] initFromDisk:@"settings.plist"]; MyCustomController *controller = [[MyCustomController alloc] initWithSettings:settings]; [settings release]; Should I have little, optional n_settings.plists for each class? // Sometimes I customize CarControllerSettings *carSettings = [[CarControllerSettings alloc] initFromDisk:@"car_settings.plist"]; CarController *controller = [[CarController alloc] initWithSettings:carSettings]; [carSettings release]; // Sometimes I don't, and CarController falls back to internally stored, reasonable defaults. CarController *controller = [[CarController alloc] initWithSettings:nil]; Or is there an OO solution that I'm not thinking of at all that would be better?

    Read the article

  • DBD::CSV: Problem with userdefined functions

    - by sid_com
    From the SQL::Statement::Functions documentation: Creating User-Defined Functions ... More complex functions can make use of a number of arguments always passed to functions automatically. Functions always receive these values in @_: sub FOO { my( $self, $sth, $rowhash, @params ); } #!/usr/bin/env perl use 5.012; use warnings; use strict; use DBI; my $dbh = DBI->connect( "DBI:CSV:", undef, undef, { RaiseError => 1, } ); my $table = 'wages'; my $array_ref = [ [ 'id', 'number' ], [ 0, 6900 ], [ 1, 3200 ], [ 2, 1800 ], ]; $dbh->do( "CREATE TEMP TABLE $table AS import( ? )", {}, $array_ref ); sub routine { my $self = shift; my $sth = shift; my $rowhash = shift; # return $_[0] / 30; }; $dbh->do( "CREATE FUNCTION routine" ); my $sth = $dbh->prepare( "SELECT id, routine( number ) AS result FROM $table" ); $sth->execute(); $sth->dump_results(); When I try this I get an error-message: DBD::CSV::st execute failed: Use of uninitialized value $_[0] in division (/) at ./so.pl line 27. [for Statement "SELECT id, routine( number ) AS result FROM "wages""] at ./so.pl line 34. When I comment out the third argument I works as expected ( because it looks as if the third argument is missing ): #!/usr/bin/env perl ... sub routine { my $self = shift; my $sth = shift; #my $rowhash = shift; return $_[0] / 30; }; ... 0, 230 1, 106.667 2, 60 3 rows Is this a bug?

    Read the article

  • Can I write a .NETCF Partial Class to extend System.Windows.Forms.UserControl?

    - by eidylon
    Okay... I'm writing a .NET CF (VBNET 2008 3.5 SP1) application, which has one master form, and it dynamically loads specific UserControls based on menu click, in a sort of framework idea. There are certain methods and properties these controls all need to work within the app. Right now I am doing this as an Interface, but this is aggravating as all get up, because some of the methods are optional, and yet I MUST implement them by the nature of interfaces. I would prefer to use inheritance, so that I can have certain code be inherited with overridability, but if I write a class which inherits System.Windows.Forms.UserControl and then inherit my control from that, it squiggles, and tells me that UserControls MUST inherit directly from System.Windows.Forms.UserControl. (Talk about a design flaw!) So next I thought, well, let me use a partial class to extend System.Windows.Forms.UserControl, but when I do that, even though it all seems to compile fine, none of my new properties/methods show up on my controls. Is there any way I can use partial classes to 'extend' System.Windows.Forms.UserControl? For example, can anyone give me a code sample of a partial class which simply adds a MyCount As Integer readonly property to the System.Windows.Forms.UserControl class? If I can just see how to get this going, I can take it from there and add the rest of my functionality. Thanks in advance! I've been searching google, but can't find anything that seems to work for UserControl extension on .NET CF. And the Interface method is driving me crazy as even a small change means updating ALL the controls whether they need to 'override' the method or not.

    Read the article

  • Haskell quiz: a simple function

    - by levy
    I'm not a Haskell programmer, but I'm curious about the following questions. Informal function specification: Let MapProduct be a function that takes a function called F and multiple lists. It returns a list containing the results of calling F with one argument from each list in each possible combination. Example: Call MapProduct with F being a function that simply returns a list of its arguments, and two lists. One of the lists contains the integers 1 and 2, the other one contains the strings "a" and "b". It should return a list that contains the lists: 1 and "a", 1 and "b", 2 and "a", 2 and "b". Questions: How is MapProduct implemented? What is the function's type? What is F's type? Can one guess what the function does just by looking at its type? Can you handle inhomogeneous lists as input? (e.g. 1 and "a" in one of the input lists) What extra limitation (if any) do you need to introduce to implement MapProduct?

    Read the article

  • How to write an R function that evaluates an expression within a data-frame

    - by Prasad Chalasani
    Puzzle for the R cognoscenti: Say we have a data-frame: df <- data.frame( a = 1:5, b = 1:5 ) I know we can do things like with(df, a) to get a vector of results. But how do I write a function that takes an expression (such as a or a > 3) and does the same thing inside. I.e. I want to write a function fn that takes a data-frame and an expression as arguments and returns the result of evaluating the expression "within" the data-frame as an environment. Never mind that this sounds contrived (I could just use with as above), but this is just a simplified version of a more complex function I am writing. I tried several variants ( using eval, with, envir, substitute, local, etc) but none of them work. For example if I define fn like so: fn <- function(dat, expr) { eval(expr, envir = dat) } I get this error: > fn( df, a ) Error in eval(expr, envir = dat) : object 'a' not found Clearly I am missing something subtle about environments and evaluation. Is there a way to define such a function?

    Read the article

  • Call any webservice from the same $.ajax() call

    - by Andreas
    Hi! Im creating a usercontrol which is controled client side, it has an javascript-file attatched to it. This control has a button and upon click a popup appears, this popup shows a list of my domain entities. My entities are fetched using a call to a webservice. Im trying to get this popup usercontrol to work on all my entities, therefore i have the need to call any webservice needed (one per entity for example) with the same $.ajax() call. I have hiddenfields for the webservice url in my usercontrol which you specify in the markup via a property. So far so good. The problem arise when i need some additional parameters to the webservice (other than pagesize and pageindex). Say for example that one webservice takes an additional parameter "Date". At the moment i have my parameters set up like this: var params = JSON.stringify({ pageSize: _this.pageSize, pageIndex: _this.pageIndex }); and then i call the webservice like so: $.ajax({ webserviceUrl, params, function(result) { //some logic }); }); What i want to do is to be able to add my extra parameters (Date) to "Param" when needed, the specification of these parameters will be done via properties of the usercontrol. So, bottom line, i have a set of default parameters and want to dynamically add optional extra parameters. How is this possible? Thanks in advance.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Getting Started: Silverlight 4 Business Application

    - by Eric J.
    With the arrival of VS 2010 and Silverlight 4, I decided it's time to look into Silverlight and understand how to build a 3-Tier business application. After several hours of searching for and reading documentation and tutorials, I'm thoroughly confused (and that doesn't happen easily). Here are some specific points I don't understand. I welcome guidance on any of them, and also would appreciate any references to a really good tutorial. Brad Abrahm's What is a .NET RIA services (written for Silverlight 3) seemed very promising, until I realized I don't have System.Web.Ria.dll on my system. Am I missing an optional download? Was this rolled into another DLL for Silverlight 4? Did this go away in favor of something else in Silverlight 4? This recent blog says to start from a Silverlight Business Application, remove unwanted stuff, create a WCF RIA services Class Library project, and copy files and references from the Business Application to the WCF RIA services project, while manually updating resource references (perhaps bug in B2 compiler). Is this really the right road to go down? It seems very clumsy. My requirements are to perform very simple CRUD on straightforward business objects. I'm looking forward to suggestions on how to do that the Silverlight 4 way.

    Read the article

  • a way to use log4j pass values like java -DmyEnvVar=A_VALUE to my code

    - by raticulin
    I need to pass some value to enable certain code in may app (in this case is to optionally enable writing some stats to a file in certain conditions, but it might be anything generally). My java app is installed as a service. So every way I have thought of has some drawbacks: Add another param to main(): cumbersome as customers already have the tool installed, and the command line would need to be changed every time. Adding java -DmyEnvVar=A_VALUE to my command line: same as above. Set an environment variable: service should at least be restarted, and even then you must take care of what user is the service running under etc. Adding the property in the config file: I prefer not to have this visible on the config file so the user does not see it, it is something for debugging etc. So I thought maybe there is some way (or hack) to use log4j loggers to pass that value to my code. I have thought of one way already, although is very limited: Add a dummy class to my codebase com.dummy.DevOptions public class DevOptions { public static final Logger logger = Logger.getLogger(DevOptions.class); In my code, use it like this: if (DevOptions.logger.isInfoEnabled()){ //do my optional stuff } //... if (DevOptions.logger.isDebugEnabled()){ //do other stuff } This allows me to use discriminate among various values, and I could increase the number by adding more loggers to DevOptions. But I wonder whether there is a cleaner way, possibly by configuring the loggers only in log4j.xml??

    Read the article

  • What is the nicest way to parse this in C++ ?

    - by ereOn
    Hi, In my program, I have a list of "server address" in the following format: host[:port] The brackets here, indicate that the port is optional. host can be a hostname, an IPv4 or IPv6 address. port, if present can be a numeric port number or a service string (like: "http" or "ssh"). If port is present and host is an IPv6 address, host must be in "bracket-enclosed" notation (Example: [::1]) Here are some valid examples: localhost localhost:11211 127.0.0.1:http [::1]:11211 ::1 [::1] And an invalid example: ::1:80 // Invalid: Is this the IPv6 address ::1:80 and a default port, or the IPv6 address ::1 and the port 80 ? ::1:http // This is not ambigous, but for simplicity sake, let's consider this is forbidden as well. My goal is to separate such entries in two parts (obviously host and port). I don't care if either the host or port are invalid as long as they don't contain a : (290.234.34.34.5 is ok for host, it will be rejected in the next process); I just want to separate the two parts, or if there is no port part, to know it somehow. I tried to do something with std::stringstream but everything I come up to seems hacky and not really elegant. How would you do this in C++ ? I don't mind answers in C but C++ is prefered. Any boost solution is welcome as well. Thank you.

    Read the article

  • Why does the WCF 3.5 REST Starter Kit do this?

    - by Brandon
    I am setting up a REST endpoint that looks like the following: [WebInvoke(Method = "POST", UriTemplate = "?format=json", BodyStyle = WebMessageBodyStyle.WrappedRequest, ResponseFormat = WebMessageFormat.Json)] and [WebInvoke(Method = "DELETE", UriTemplate = "?token={token}&format=json", ResponseFormat = WebMessageFormat.Json)] The above throws the following error: UriTemplateTable does not support '?format=json' and '?token={token}&format=json' since they are not equivalent, but cannot be disambiguated because they have equivalent paths and the same common literal values for the query string. See the documentation for UriTemplateTable for more detail. I am not an expert at WCF, but I would imagine that it should map first by the HTTP Method and then by the URI Template. It appears to be backwards. If both of my URI templates are: ?token={token}&format=json This works because they are equivalent and it then appears to look at the HTTP Method where one is POST and the other is DELETE. Is REST supposed to work this way? Why are the URI Template Tables not being sorted first by HTTP Method and then by URI Template? This can cause some serious frustrations when 1 HTTP Method requires a parameter and another does not, or if I want to do optional parameters (e.g. if the 'format' parameter is not passed, default to XML).

    Read the article

  • Compile C++ in Visual Studio

    - by Kasun
    Hi All.. I use this method to compile C++ file in VS. But even i provide the correct file it returns false. Can any one help me... This is class called CL class CL { private const string clexe = @"cl.exe"; private const string exe = "Test.exe", file = "test.cpp"; private string args; public CL(String[] args) { this.args = String.Join(" ", args); this.args += (args.Length > 0 ? " " : "") + "/Fe" + exe + " " + file; } public Boolean Compile(String content, ref string errors) { if (File.Exists(exe)) File.Delete(exe); if (File.Exists(file)) File.Delete(file); File.WriteAllText(file, content); Process proc = new Process(); proc.StartInfo.UseShellExecute = false; proc.StartInfo.RedirectStandardOutput = true; proc.StartInfo.RedirectStandardError = true; proc.StartInfo.FileName = clexe; proc.StartInfo.Arguments = this.args; proc.StartInfo.CreateNoWindow = true; proc.Start(); //errors += proc.StandardError.ReadToEnd(); errors += proc.StandardOutput.ReadToEnd(); proc.WaitForExit(); bool success = File.Exists(exe); return success; } } This is my button click event private void button1_Click(object sender, EventArgs e) { string content = "#include <stdio.h>\nmain(){\nprintf(\"Hello world\");\n}\n"; string errors = ""; CL k = new CL(new string[] { }); if (k.Compile(content, ref errors)) Console.WriteLine("Success!"); else MessageBox.Show("Errors are : ", errors); }

    Read the article

  • Forming triangles from points and relations

    - by SiN
    Hello, I want to generate triangles from points and optional relations between them. Not all points form triangles, but many of them do. In the initial structure, I've got a database with the following tables: Nodes(id, value) Relations(id, nodeA, nodeB, value) Triangles(id, relation1_id, relation2_id, relation3_id) In order to generate triangles from both nodes and relations table, I've used the following query: INSERT INTO Triangles SELECT t1.id, t2.id , t3.id, FROM Relations t1, Relations t2, Relations t3 WHERE t1.id < t2.id AND t3.id > t1.id AND ( t1.nodeA = t2.nodeA AND (t3.nodeA = t1.nodeB AND t3.nodeB = t2.nodeB OR t3.nodeA = t2.nodeB AND t3.nodeB = t1.nodeB) OR t1.nodeA = t2.nodeB AND (t3.nodeA = t1.nodeB AND t3.nodeB = t2.nodeA OR t3.nodeA = t2.nodeA AND t3.nodeB = t1.nodeB) ) It's working perfectly on small sized data. (~< 50 points) In some cases however, I've got around 100 points all related to each other which leads to thousands of relations. So when the expected number of triangles is in the hundreds of thousands, or even in the millions, the query might take several hours. My main problem is not in the select query, while I see it execute in Management Studio, the returned results slow. I received around 2000 rows per minute, which is not acceptable for my case. As a matter of fact, the size of operations is being added up exponentionally and that is terribly affecting the performance. I've tried doing it as a LINQ to object from my code, but the performance was even worse. I've also tried using SqlBulkCopy on a reader from C# on the result, also with no luck. So the question is... Any ideas or workarounds?

    Read the article

  • Better language or checking tool?

    - by rwallace
    This is primarily aimed at programmers who use unmanaged languages like C and C++ in preference to managed languages, forgoing some forms of error checking to obtain benefits like the ability to work in extremely resource constrained systems or the last increment of performance, though I would also be interested in answers from those who use managed languages. Which of the following would be of most value? A language that would optionally compile to CLR byte code or to machine code via C, and would provide things like optional array bounds checking, more support for memory management in environments where you can't use garbage collection, and faster compile times than typical C++ projects. (Think e.g. Ada or Eiffel with Python syntax.) A tool that would take existing C code and perform static analysis to look for things like potential null pointer dereferences and array overflows. (Think e.g. an open source equivalent to Coverity.) Something else I haven't thought of. Or put another way, when you're using C family languages, is the top of your wish list more expressiveness, better error checking or something else? The reason I'm asking is that I have a design and prototype parser for #1, and an outline design for #2, and I'm wondering which would be the better use of resources to work on after my current project is up and running; but I think the answers may be useful for other tools programmers also. (As usual with questions of this nature, if the answer you would give is already there, please upvote it.)

    Read the article

  • Google App engine Url Mapping using WSGIAppl and regx grouping Help Needed

    - by spidee
    Hi take this example from google docs class BrowseHandler(webapp.RequestHandler): > def get(self, category, product_id): > # Display product with given ID in the given category. > > > # Map URLs like /browse/(category)/(product_id) to > BrowseHandler. application = > webapp.WSGIApplication([(r'/browse/(.*)/(.*)', > BrowseHandler) > ], > debug=True) > > def main(): > run_wsgi_app(application) > > if __name__ == '__main__': > main() How can i change the regx groupings so that Product id is optional ie the url http://yourdomain.com/category will be sent to the browse handler in the current above example you must add a product id or at least the / after the category ie http://yourdomain.com/category/ r'/browse/(.)/(.)' Any ideas?

    Read the article

  • Best way to use Google's hosted jQuery, but fall back to my hosted library on Google fail

    - by Nosredna
    What would be a good way to attempt to load the hosted jQuery at Google (or other Google hosted libs), but load my copy of jQuery if the Google attempt fails? I'm not saying Google is flaky. There are cases where the Google copy is blocked (apparently in Iran, for instance). Would I set up a timer and check for the jQuery object? What would be the danger of both copies coming through? Not really looking for answers like "just use the Google one" or "just use your own." I understand those arguments. I also understand that the user is likely to have the Google version cached. I'm thinking about fallbacks for the cloud in general. Edit: This part added... Since Google suggests using google.load to load the ajax libraries, and it performs a callback when done, I'm wondering if that's the key to serializing this problem. I know it sounds a bit crazy. I'm just trying to figure out if it can be done in a reliable way or not. Update: jQuery now hosted on Microsoft's CDN. http://www.asp.net/ajax/cdn/

    Read the article

  • Select rows from table1 and all the children from table2 into an object

    - by Patrick
    I want to pull data from table "Province_Notifiers" and also fetch all corresponding items from table "Province_Notifier_Datas". The table "Province_Notifier" has a guid to identify it (PK), table "Province_Notifier_Datas" has a column called BelongsToProvinceID witch is a foreign key to the "Province_Notifier" tables guid. I tried something like this: var records = from data in ctx.Province_Notifiers where DateTime.Now >= data.SendTime && data.Sent == false join data2 in ctx.Province_Notifier_Datas on data.Province_ID equals data2.BelongsToProvince_ID select new Province_Notifier { Email = data.Email, Province_ID = data.Province_ID, ProvinceName = data.ProvinceName, Sent = data.Sent, UserName = data.UserName, User_ID = data.User_ID, Province_Notifier_Datas = (new List<Province_Notifier_Data>().AddRange(data2)) }; This line is not working and i am trying to figure out how topull the data from table2 into that Province_Notifier_Datas variable. Province_Notifier_Datas = (new List<Province_Notifier_Data>().AddRange(data2)) I can add a record easily by adding the second table row into the Province_Notifier_Datas but i can't fetch it back. Province_Notifier dbNotifier = new Province_Notifier(); // set some values for dbNotifier dbNotifier.Province_Notifier_Datas.Add( new Province_Notifier_Data { BelongsToProvince_ID = userInput.Value.ProvinceId, EventText = GenerateNotificationDetail(notifierDetail) }); This works and inserts the data correctly into both tables. Edit: These error messages is thrown: Cannot convert from 'Province_Notifier_Data' to 'System.Collections.Generic.IEnumerable' If i look in Visual Studio, the variable "Province_Notifier_Datas" is of type System.Data.Linq.EntitySet The best overloaded method match for 'System.Collections.Generic.List.AddRange(System.Collections.Generic.IEnumerable)' has some invalid arguments Edit: var records = from data in ctx.Province_Notifiers where DateTime.Now >= data.SendTime && data.Sent == false join data2 in ctx.Province_Notifier_Datas on data.Province_ID equals data2.BelongsToProvince_ID into data2list select new Province_Notifier { Email = data.Email, Province_ID = data.Province_ID, ProvinceName = data.ProvinceName, Sent = data.Sent, UserName = data.UserName, User_ID = data.User_ID, Province_Notifier_Datas = new EntitySet<Province_Notifier_Data>().AddRange(data2List) }; Error 3 The name 'data2List' does not exist in the current context.

    Read the article

  • problem linking vba modules in MS Access 2007

    - by Ted
    I am upgrading a database system from Access 2000 db to Access 2007, which communicates with several chemistry measuring devices(pH meter, scale, etc) via an RS 232 serial port. The first db consists of several modules containing vba code that enables the communications with the ports, as well as supports the code behind the forms in the second db. The user, or lab tech, navigates through the forms in the second db to interact with the lab devices, and also to generate the reports which display the info. from the devices. The reports are also part of the second db. The code works in Access 2000, but once I convert it to 2007, the code in the second db cannot find the function calls in the first db that dictate the progression from screen to screen. I have tried importing the modules into the second db, and I have tried linking them, but it still doesn't work. The error message is #438: "Object doesn't support this property or method." Any suggestions would be greatly appreciated. Here is the code for the first function that is not being called correctly: Description: ' This routine is used to return to the calling form and close the active form. ' ' Input: ' strFormCalled --- the active form ' strCallingForm --- the form that called the active form ' blnUnhideOrOpen --- whether to open or just unhide form Public Sub basReturnToCallingForm(ByVal strFormCalled As String, ByVal _ strCallingForm As Variant, Optional blnUnhideOrOpen As Boolean = True) On Error GoTo err_basReturnToCaliingForm If Not basIsBlankString(strCallingForm) And blnUnhideOrOpen Then DoCmd.OpenForm strCallingForm, acNormal Else Call basUnHideForm(strCallingForm) End If Call basCloseForm(strFormCalled) exit_basReturnToCaliingForm: Exit Sub err_basReturnToCaliingForm: Err.Raise Err.Number, "basReturnToCaliingForm", Err.Description End Sub I will post the second function shortly, but I have to go to a meeting... The second funtion that isn't 'working' is a cmdStartClick that is supposed to be called when a user initializes a pump. However, within that function, it's also sticking on a line that is supposed to progress to the next form in the db. The other thing is that the code works in Access 2002, but not in Access 2007...

    Read the article

  • Problem updating collection using JPA

    - by FarmBoy
    I have an entity class Foo foo that contains Collection<Bar> bars. I've tried a variety of ways, but I'm unable to successfully update my collection. One attempt: foo = em.find(key); foo.getBars().clear(); foo.setBars(bars); em.flush; \\ commit, etc. This appends the new collection to the old one. Another attempt: foo = em.find(key); bars = foo.getBars(); for (Bar bar : bars) { em.remove(bar); } em.flush; At this point, I thought I could add the new collection, but I find that the entity foo has been wiped out. Here are some annotations. In Foo: @OneToMany(cascade = { CascadeType.ALL }, mappedBy = "foo") private List<Bar> bars; In Bar: @ManyToOne(optional = false, cascade = { CascadeType.ALL }) @JoinColumn(name = "FOO_ID") private Foo foo; Has anyone else had trouble with this? Any ideas?

    Read the article

  • Node.js/Express Partials problem: Can't be nested too deep?

    - by heorling
    I'm learning Node.js, Express, haml.js and liking it. I've run into a prety annoying problem though. I'm pretty new to this but have been getting nice results so far. I'm writing a jquery heavy web app that relies on a table containing divs. The divs slide around, switch back and fourth and are resized etc to my hearts content. What I'm looking for a way to switch (template?) the divs. Since I've been building in express and mimicking the chat example it would make sense to use partials. The rub is that I've been using inexplicit divs in haml, held within a td. The divs are cunstructed as follows: %tr %td .class1.class2.class3.classetc Which has worked fine cross browser. Parsing the classes works great for the js code to pass arguments around, fetch values etc. What I'd like to be able to do is something like: %tr %td .class1.class2.class3.classetc %ul#messages != this.partial('message.html.haml', { collection: messages }) Any combination I've tried with this has failed however. And I might have tried them all. If I could put a partial into that div I'd probably be set. And you can nest them as long as you use #ids instead of .classes. But if you use more than one class it breaks! I think that's the most accurate way of summing it up. How do you do this? I've checked out various templating solutions like mu.js and micro template like by John Resig. I earlier checked out this thread on templating engines. It's very possible I'm making some fundamental mistake here, I'm new to this. What's a good way to do this?

    Read the article

< Previous Page | 169 170 171 172 173 174 175 176 177 178 179 180  | Next Page >