Search Results

Search found 5279 results on 212 pages for 'optional arguments'.

Page 173/212 | < Previous Page | 169 170 171 172 173 174 175 176 177 178 179 180  | Next Page >

  • C: incompatible types in assignment

    - by The.Anti.9
    I'm writing a program to check to see if a port is open in C. One line in particular copies one of the arguments to a char array. However, when I try to compile, it says: error: incompatible types in assignment Heres the code. The error is on the assignment of addr #include <sys/socket.h> #include <sys/time.h> #include <sys/types.h> #include <arpa/inet.h> #include <netinet/in.h> #include <errno.h> #include <fcntl.h> #include <stdio.h> #include <netdb.h> #include <stdlib.h> #include <string.h> #include <unistd.h> int main(int argc, char **argv) { u_short port; /* user specified port number */ char addr[1023]; /* will be a copy of the address entered by u */ struct sockaddr_in address; /* the libc network address data structure */ short int sock = -1; /* file descriptor for the network socket */ port = atoi(argv[1]); addr = strncpy(addr, argv[2], 1023); bzero((char *)&address, sizeof(address)); /* init addr struct */ address.sin_addr.s_addr = inet_addr(addr); /* assign the address */ address.sin_port = htons(port); /* translate int2port num */ sock = socket(AF_INET, SOCK_STREAM, 0); if (connect(sock,(struct sockaddr *)&address,sizeof(address)) == 0) { printf("%i is open\n", port); } if (errno == 113) { fprintf(stderr, "Port not open!\n"); } close(sock); return 0; } I'm new to C, so I'm not sure why it would do this.

    Read the article

  • Select rows from table1 and all the children from table2 into an object

    - by Patrick
    I want to pull data from table "Province_Notifiers" and also fetch all corresponding items from table "Province_Notifier_Datas". The table "Province_Notifier" has a guid to identify it (PK), table "Province_Notifier_Datas" has a column called BelongsToProvinceID witch is a foreign key to the "Province_Notifier" tables guid. I tried something like this: var records = from data in ctx.Province_Notifiers where DateTime.Now >= data.SendTime && data.Sent == false join data2 in ctx.Province_Notifier_Datas on data.Province_ID equals data2.BelongsToProvince_ID select new Province_Notifier { Email = data.Email, Province_ID = data.Province_ID, ProvinceName = data.ProvinceName, Sent = data.Sent, UserName = data.UserName, User_ID = data.User_ID, Province_Notifier_Datas = (new List<Province_Notifier_Data>().AddRange(data2)) }; This line is not working and i am trying to figure out how topull the data from table2 into that Province_Notifier_Datas variable. Province_Notifier_Datas = (new List<Province_Notifier_Data>().AddRange(data2)) I can add a record easily by adding the second table row into the Province_Notifier_Datas but i can't fetch it back. Province_Notifier dbNotifier = new Province_Notifier(); // set some values for dbNotifier dbNotifier.Province_Notifier_Datas.Add( new Province_Notifier_Data { BelongsToProvince_ID = userInput.Value.ProvinceId, EventText = GenerateNotificationDetail(notifierDetail) }); This works and inserts the data correctly into both tables. Edit: These error messages is thrown: Cannot convert from 'Province_Notifier_Data' to 'System.Collections.Generic.IEnumerable' If i look in Visual Studio, the variable "Province_Notifier_Datas" is of type System.Data.Linq.EntitySet The best overloaded method match for 'System.Collections.Generic.List.AddRange(System.Collections.Generic.IEnumerable)' has some invalid arguments Edit: var records = from data in ctx.Province_Notifiers where DateTime.Now >= data.SendTime && data.Sent == false join data2 in ctx.Province_Notifier_Datas on data.Province_ID equals data2.BelongsToProvince_ID into data2list select new Province_Notifier { Email = data.Email, Province_ID = data.Province_ID, ProvinceName = data.ProvinceName, Sent = data.Sent, UserName = data.UserName, User_ID = data.User_ID, Province_Notifier_Datas = new EntitySet<Province_Notifier_Data>().AddRange(data2List) }; Error 3 The name 'data2List' does not exist in the current context.

    Read the article

  • converting code from non-(C)ontinuation (P)assing (S)tyle to CPS

    - by Delirium tremens
    before: function sc_startSiteCompare(){ var visitinguri; var validateduri; var downloaduris; var compareuris; var tryinguri; sc_setstatus('started'); visitinguri = sc_getvisitinguri(); validateduri = sc_getvalidateduri(visitinguri); downloaduris = new Array(); downloaduris = sc_generatedownloaduris(validateduri); compareuris = new Array(); compareuris = sc_generatecompareuris(validateduri); tryinguri = 0; sc_finishSiteCompare(downloaduris, compareuris, tryinguri); } function sc_getvisitinguri() { var visitinguri; visitinguri = content.location.href; return visitinguri; } after (I'm trying): function sc_startSiteCompare(){ var visitinguri; sc_setstatus('started'); visitinguri = sc_getvisitinguri(sc_startSiteComparec1); } function sc_startSiteComparec1 (visitinguri) { var validateduri; validateduri = sc_getvalidateduri(visitinguri, sc_startSiteComparec2); } function sc_startSiteComparec2 (visitinguri, c) { var downloaduris; downloaduris = sc_generatedownloaduris(validateduri, sc_startSiteComparec3); } function sc_startSiteComparec3 (validateduri, c) { var compareuris; compareuris = sc_generatecompareuris(downloaduris, validateduri, sc_startSiteComparec4); } function sc_startSiteComparec4 (downloaduris, compareuris, validateduri, c) { var tryinguri; tryinguri = 0; sc_finishSiteCompare(downloaduris, compareuris, tryinguri); } function sc_getvisitinguri(c) { var visitinguri; visitinguri = content.location.href; c(visitinguri); } I'm having to pass lots of arguments to functions now. global in procedural code look like this / self in modular code. Any difference? Will I really have to use OO now? As a last resort, does CPS have an alternative?

    Read the article

  • Method not being resolved for dynamic generic type

    - by kelloti
    I have these types: public class GenericDao<T> { public T Save(T t) { return t; } } public abstract class DomainObject { // Some properties protected abstract dynamic Dao { get; } public virtual void Save() { var dao = Dao; dao.Save(this); } } public class Attachment : DomainObject { protected dynamic Dao { get { return new GenericDao<Attachment>(); } } } Then when I run this code it fails with RuntimeBinderException: Best overloaded method match for 'GenericDAO<Attachment.Save(Attachment)' has some invalid arguments var obj = new Attachment() { /* set properties */ }; obj.Save(); I've verified that in DomainObject.Save() "this" is definitely Attachment, so the error doesn't really make sense. Can anyone shed some light on why the method isn't resolving? Some more information - It succeeds if I change the contents of DomainObject.Save() to use reflection: public virtual void Save() { var dao = Dao; var type = dao.GetType(); var save = ((Type)type).GetMethod("Save"); save.Invoke(dao, new []{this}); }

    Read the article

  • How to solve this problem with Python

    - by morpheous
    I am "porting" an application I wrote in C++ into Python. This is the current workflow: Application is started from the console Application parses CLI args Application reads an ini configuration file which specifies which plugins to load etc Application starts a timer Application iterates through each loaded plugin and orders them to start work. This spawns a new worker thread for the plugin The plugins carry out their work and when completed, they die When time interval (read from config file) is up, steps 5-7 is repeated iteratively Since I am new to Python (2 days and counting), the distinction between script, modules and packages are still a bit hazy to me, and I would like to seek advice from Pythonista as to how to implement the workflow described above, using Python as the programing language. In order to keep things simple, I have decided to leave out the time interval stuff out, and instead run the python script/scripts as a cron job instead. This is how I am thinking of approaching it: Encapsulate the whole application in a package which is executable (i.e. can be run from the command line with arguments. Write the plugins as modules (I think maybe its better to implement each module in a separate file?) I havent seen any examples of using threading in Python yet. Could someone provide a snippet of how I could spawn a thread to run a module. Also, I am not sure how to implement the concept of plugins in Python - any advice would be helpful - especially with a code snippet.

    Read the article

  • summing functions handles in matlab

    - by user552231
    Hi I am trying to sum two function handles, but it doesn't work. for example: y1=@(x)(x*x); y2=@(x)(x*x+3*x); y3=y1+y2 The error I receive is "??? Undefined function or method 'plus' for input arguments of type 'function_handle'." This is just a small example, in reality I actually need to iteratively sum about 500 functions that are dependent on each other. EDIT The solution by Clement J. indeed works but I couldn't manage to generalize this into a loop and ran into a problem. I have the function s=@(x,y,z)((1-exp(-x*y)-z)*exp(-x*y)); And I have a vector v that contains 536 data points and another vector w that also contains 536 data points. My goal is to sum up s(v(i),y,w(i)) for i=1...536 Thus getting one function in the variable y which is the sum of 536 functions. The syntax I tried in order to do this is: sum=@(y)(s(v(1),y,z2(1))); for i=2:536 sum=@(y)(sum+s(v(i),y,z2(i))) end

    Read the article

  • DBD::CSV: Problem with userdefined functions

    - by sid_com
    From the SQL::Statement::Functions documentation: Creating User-Defined Functions ... More complex functions can make use of a number of arguments always passed to functions automatically. Functions always receive these values in @_: sub FOO { my( $self, $sth, $rowhash, @params ); } #!/usr/bin/env perl use 5.012; use warnings; use strict; use DBI; my $dbh = DBI->connect( "DBI:CSV:", undef, undef, { RaiseError => 1, } ); my $table = 'wages'; my $array_ref = [ [ 'id', 'number' ], [ 0, 6900 ], [ 1, 3200 ], [ 2, 1800 ], ]; $dbh->do( "CREATE TEMP TABLE $table AS import( ? )", {}, $array_ref ); sub routine { my $self = shift; my $sth = shift; my $rowhash = shift; # return $_[0] / 30; }; $dbh->do( "CREATE FUNCTION routine" ); my $sth = $dbh->prepare( "SELECT id, routine( number ) AS result FROM $table" ); $sth->execute(); $sth->dump_results(); When I try this I get an error-message: DBD::CSV::st execute failed: Use of uninitialized value $_[0] in division (/) at ./so.pl line 27. [for Statement "SELECT id, routine( number ) AS result FROM "wages""] at ./so.pl line 34. When I comment out the third argument I works as expected ( because it looks as if the third argument is missing ): #!/usr/bin/env perl ... sub routine { my $self = shift; my $sth = shift; #my $rowhash = shift; return $_[0] / 30; }; ... 0, 230 1, 106.667 2, 60 3 rows Is this a bug?

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Can I write a .NETCF Partial Class to extend System.Windows.Forms.UserControl?

    - by eidylon
    Okay... I'm writing a .NET CF (VBNET 2008 3.5 SP1) application, which has one master form, and it dynamically loads specific UserControls based on menu click, in a sort of framework idea. There are certain methods and properties these controls all need to work within the app. Right now I am doing this as an Interface, but this is aggravating as all get up, because some of the methods are optional, and yet I MUST implement them by the nature of interfaces. I would prefer to use inheritance, so that I can have certain code be inherited with overridability, but if I write a class which inherits System.Windows.Forms.UserControl and then inherit my control from that, it squiggles, and tells me that UserControls MUST inherit directly from System.Windows.Forms.UserControl. (Talk about a design flaw!) So next I thought, well, let me use a partial class to extend System.Windows.Forms.UserControl, but when I do that, even though it all seems to compile fine, none of my new properties/methods show up on my controls. Is there any way I can use partial classes to 'extend' System.Windows.Forms.UserControl? For example, can anyone give me a code sample of a partial class which simply adds a MyCount As Integer readonly property to the System.Windows.Forms.UserControl class? If I can just see how to get this going, I can take it from there and add the rest of my functionality. Thanks in advance! I've been searching google, but can't find anything that seems to work for UserControl extension on .NET CF. And the Interface method is driving me crazy as even a small change means updating ALL the controls whether they need to 'override' the method or not.

    Read the article

  • Re-usable Obj-C classes with custom values: The right way

    - by Prairiedogg
    I'm trying to reuse a group of Obj-C clases between iPhone applications. The values that differ from app to app have been isolated and I'm trying to figure out the best way to apply these custom values to the classes on an app-to-app basis. Should I hold them in code? // I might have 10 customizable values for each class, that's a long signature! CarController *controller = [[CarController alloc] initWithFontName:@"Vroom" engine:@"Diesel" color:@"Red" number:11]; Should I store them in a big settings.plist? // Wasteful! I sometimes only use 2-3 of 50 settings! AllMyAppSettings *settings = [[AllMyAppSettings alloc] initFromDisk:@"settings.plist"]; MyCustomController *controller = [[MyCustomController alloc] initWithSettings:settings]; [settings release]; Should I have little, optional n_settings.plists for each class? // Sometimes I customize CarControllerSettings *carSettings = [[CarControllerSettings alloc] initFromDisk:@"car_settings.plist"]; CarController *controller = [[CarController alloc] initWithSettings:carSettings]; [carSettings release]; // Sometimes I don't, and CarController falls back to internally stored, reasonable defaults. CarController *controller = [[CarController alloc] initWithSettings:nil]; Or is there an OO solution that I'm not thinking of at all that would be better?

    Read the article

  • Call any webservice from the same $.ajax() call

    - by Andreas
    Hi! Im creating a usercontrol which is controled client side, it has an javascript-file attatched to it. This control has a button and upon click a popup appears, this popup shows a list of my domain entities. My entities are fetched using a call to a webservice. Im trying to get this popup usercontrol to work on all my entities, therefore i have the need to call any webservice needed (one per entity for example) with the same $.ajax() call. I have hiddenfields for the webservice url in my usercontrol which you specify in the markup via a property. So far so good. The problem arise when i need some additional parameters to the webservice (other than pagesize and pageindex). Say for example that one webservice takes an additional parameter "Date". At the moment i have my parameters set up like this: var params = JSON.stringify({ pageSize: _this.pageSize, pageIndex: _this.pageIndex }); and then i call the webservice like so: $.ajax({ webserviceUrl, params, function(result) { //some logic }); }); What i want to do is to be able to add my extra parameters (Date) to "Param" when needed, the specification of these parameters will be done via properties of the usercontrol. So, bottom line, i have a set of default parameters and want to dynamically add optional extra parameters. How is this possible? Thanks in advance.

    Read the article

  • How to write an R function that evaluates an expression within a data-frame

    - by Prasad Chalasani
    Puzzle for the R cognoscenti: Say we have a data-frame: df <- data.frame( a = 1:5, b = 1:5 ) I know we can do things like with(df, a) to get a vector of results. But how do I write a function that takes an expression (such as a or a > 3) and does the same thing inside. I.e. I want to write a function fn that takes a data-frame and an expression as arguments and returns the result of evaluating the expression "within" the data-frame as an environment. Never mind that this sounds contrived (I could just use with as above), but this is just a simplified version of a more complex function I am writing. I tried several variants ( using eval, with, envir, substitute, local, etc) but none of them work. For example if I define fn like so: fn <- function(dat, expr) { eval(expr, envir = dat) } I get this error: > fn( df, a ) Error in eval(expr, envir = dat) : object 'a' not found Clearly I am missing something subtle about environments and evaluation. Is there a way to define such a function?

    Read the article

  • Problem updating collection using JPA

    - by FarmBoy
    I have an entity class Foo foo that contains Collection<Bar> bars. I've tried a variety of ways, but I'm unable to successfully update my collection. One attempt: foo = em.find(key); foo.getBars().clear(); foo.setBars(bars); em.flush; \\ commit, etc. This appends the new collection to the old one. Another attempt: foo = em.find(key); bars = foo.getBars(); for (Bar bar : bars) { em.remove(bar); } em.flush; At this point, I thought I could add the new collection, but I find that the entity foo has been wiped out. Here are some annotations. In Foo: @OneToMany(cascade = { CascadeType.ALL }, mappedBy = "foo") private List<Bar> bars; In Bar: @ManyToOne(optional = false, cascade = { CascadeType.ALL }) @JoinColumn(name = "FOO_ID") private Foo foo; Has anyone else had trouble with this? Any ideas?

    Read the article

  • Compile C++ in Visual Studio

    - by Kasun
    Hi All.. I use this method to compile C++ file in VS. But even i provide the correct file it returns false. Can any one help me... This is class called CL class CL { private const string clexe = @"cl.exe"; private const string exe = "Test.exe", file = "test.cpp"; private string args; public CL(String[] args) { this.args = String.Join(" ", args); this.args += (args.Length > 0 ? " " : "") + "/Fe" + exe + " " + file; } public Boolean Compile(String content, ref string errors) { if (File.Exists(exe)) File.Delete(exe); if (File.Exists(file)) File.Delete(file); File.WriteAllText(file, content); Process proc = new Process(); proc.StartInfo.UseShellExecute = false; proc.StartInfo.RedirectStandardOutput = true; proc.StartInfo.RedirectStandardError = true; proc.StartInfo.FileName = clexe; proc.StartInfo.Arguments = this.args; proc.StartInfo.CreateNoWindow = true; proc.Start(); //errors += proc.StandardError.ReadToEnd(); errors += proc.StandardOutput.ReadToEnd(); proc.WaitForExit(); bool success = File.Exists(exe); return success; } } This is my button click event private void button1_Click(object sender, EventArgs e) { string content = "#include <stdio.h>\nmain(){\nprintf(\"Hello world\");\n}\n"; string errors = ""; CL k = new CL(new string[] { }); if (k.Compile(content, ref errors)) Console.WriteLine("Success!"); else MessageBox.Show("Errors are : ", errors); }

    Read the article

  • Google App engine Url Mapping using WSGIAppl and regx grouping Help Needed

    - by spidee
    Hi take this example from google docs class BrowseHandler(webapp.RequestHandler): > def get(self, category, product_id): > # Display product with given ID in the given category. > > > # Map URLs like /browse/(category)/(product_id) to > BrowseHandler. application = > webapp.WSGIApplication([(r'/browse/(.*)/(.*)', > BrowseHandler) > ], > debug=True) > > def main(): > run_wsgi_app(application) > > if __name__ == '__main__': > main() How can i change the regx groupings so that Product id is optional ie the url http://yourdomain.com/category will be sent to the browse handler in the current above example you must add a product id or at least the / after the category ie http://yourdomain.com/category/ r'/browse/(.)/(.)' Any ideas?

    Read the article

  • Error while sending mail (attachment file)

    - by Surya sasidhar
    hi, in my application i am using to send mail with attachments i write the code like this Using System.Net.Mail; MailMessage mail = new MailMessage(); mail.Body = "<html><body><b> Name Of The Job Seeker: " + txtName.Text + "<br><br>" + "The Mail ID:" + txtEmail.Text + "<br><br>" + " The Mobile Number: " + txtmobile.Text + "<br><br>" + "Position For Applied: " + txtPostionAppl.Text + "<br><br>" + "Description " + txtdescript.Text + "<br><br></b></body></html>"; mail.From = new MailAddress ( txtEmail.Text); mail.To .Add (new MailAddress ( mailid)); mail.Priority = MailPriority.High; FileUpload1.PostedFile.SaveAs("~/Resume/" + FileUpload1.FileName); mail.Attachments.Add(filenme); SmtpMail sm = new SmtpMail(); sm.Send(mail); it is giving error at attachment like mail.Attachemts.Add(filena) like this 'System.Collections.ObjectModel.Collection.Add(System.Net.Mail.Attachment)' has some invalid arguments.

    Read the article

  • Getting Started: Silverlight 4 Business Application

    - by Eric J.
    With the arrival of VS 2010 and Silverlight 4, I decided it's time to look into Silverlight and understand how to build a 3-Tier business application. After several hours of searching for and reading documentation and tutorials, I'm thoroughly confused (and that doesn't happen easily). Here are some specific points I don't understand. I welcome guidance on any of them, and also would appreciate any references to a really good tutorial. Brad Abrahm's What is a .NET RIA services (written for Silverlight 3) seemed very promising, until I realized I don't have System.Web.Ria.dll on my system. Am I missing an optional download? Was this rolled into another DLL for Silverlight 4? Did this go away in favor of something else in Silverlight 4? This recent blog says to start from a Silverlight Business Application, remove unwanted stuff, create a WCF RIA services Class Library project, and copy files and references from the Business Application to the WCF RIA services project, while manually updating resource references (perhaps bug in B2 compiler). Is this really the right road to go down? It seems very clumsy. My requirements are to perform very simple CRUD on straightforward business objects. I'm looking forward to suggestions on how to do that the Silverlight 4 way.

    Read the article

  • a way to use log4j pass values like java -DmyEnvVar=A_VALUE to my code

    - by raticulin
    I need to pass some value to enable certain code in may app (in this case is to optionally enable writing some stats to a file in certain conditions, but it might be anything generally). My java app is installed as a service. So every way I have thought of has some drawbacks: Add another param to main(): cumbersome as customers already have the tool installed, and the command line would need to be changed every time. Adding java -DmyEnvVar=A_VALUE to my command line: same as above. Set an environment variable: service should at least be restarted, and even then you must take care of what user is the service running under etc. Adding the property in the config file: I prefer not to have this visible on the config file so the user does not see it, it is something for debugging etc. So I thought maybe there is some way (or hack) to use log4j loggers to pass that value to my code. I have thought of one way already, although is very limited: Add a dummy class to my codebase com.dummy.DevOptions public class DevOptions { public static final Logger logger = Logger.getLogger(DevOptions.class); In my code, use it like this: if (DevOptions.logger.isInfoEnabled()){ //do my optional stuff } //... if (DevOptions.logger.isDebugEnabled()){ //do other stuff } This allows me to use discriminate among various values, and I could increase the number by adding more loggers to DevOptions. But I wonder whether there is a cleaner way, possibly by configuring the loggers only in log4j.xml??

    Read the article

  • Haskell quiz: a simple function

    - by levy
    I'm not a Haskell programmer, but I'm curious about the following questions. Informal function specification: Let MapProduct be a function that takes a function called F and multiple lists. It returns a list containing the results of calling F with one argument from each list in each possible combination. Example: Call MapProduct with F being a function that simply returns a list of its arguments, and two lists. One of the lists contains the integers 1 and 2, the other one contains the strings "a" and "b". It should return a list that contains the lists: 1 and "a", 1 and "b", 2 and "a", 2 and "b". Questions: How is MapProduct implemented? What is the function's type? What is F's type? Can one guess what the function does just by looking at its type? Can you handle inhomogeneous lists as input? (e.g. 1 and "a" in one of the input lists) What extra limitation (if any) do you need to introduce to implement MapProduct?

    Read the article

  • Forming triangles from points and relations

    - by SiN
    Hello, I want to generate triangles from points and optional relations between them. Not all points form triangles, but many of them do. In the initial structure, I've got a database with the following tables: Nodes(id, value) Relations(id, nodeA, nodeB, value) Triangles(id, relation1_id, relation2_id, relation3_id) In order to generate triangles from both nodes and relations table, I've used the following query: INSERT INTO Triangles SELECT t1.id, t2.id , t3.id, FROM Relations t1, Relations t2, Relations t3 WHERE t1.id < t2.id AND t3.id > t1.id AND ( t1.nodeA = t2.nodeA AND (t3.nodeA = t1.nodeB AND t3.nodeB = t2.nodeB OR t3.nodeA = t2.nodeB AND t3.nodeB = t1.nodeB) OR t1.nodeA = t2.nodeB AND (t3.nodeA = t1.nodeB AND t3.nodeB = t2.nodeA OR t3.nodeA = t2.nodeA AND t3.nodeB = t1.nodeB) ) It's working perfectly on small sized data. (~< 50 points) In some cases however, I've got around 100 points all related to each other which leads to thousands of relations. So when the expected number of triangles is in the hundreds of thousands, or even in the millions, the query might take several hours. My main problem is not in the select query, while I see it execute in Management Studio, the returned results slow. I received around 2000 rows per minute, which is not acceptable for my case. As a matter of fact, the size of operations is being added up exponentionally and that is terribly affecting the performance. I've tried doing it as a LINQ to object from my code, but the performance was even worse. I've also tried using SqlBulkCopy on a reader from C# on the result, also with no luck. So the question is... Any ideas or workarounds?

    Read the article

  • Better language or checking tool?

    - by rwallace
    This is primarily aimed at programmers who use unmanaged languages like C and C++ in preference to managed languages, forgoing some forms of error checking to obtain benefits like the ability to work in extremely resource constrained systems or the last increment of performance, though I would also be interested in answers from those who use managed languages. Which of the following would be of most value? A language that would optionally compile to CLR byte code or to machine code via C, and would provide things like optional array bounds checking, more support for memory management in environments where you can't use garbage collection, and faster compile times than typical C++ projects. (Think e.g. Ada or Eiffel with Python syntax.) A tool that would take existing C code and perform static analysis to look for things like potential null pointer dereferences and array overflows. (Think e.g. an open source equivalent to Coverity.) Something else I haven't thought of. Or put another way, when you're using C family languages, is the top of your wish list more expressiveness, better error checking or something else? The reason I'm asking is that I have a design and prototype parser for #1, and an outline design for #2, and I'm wondering which would be the better use of resources to work on after my current project is up and running; but I think the answers may be useful for other tools programmers also. (As usual with questions of this nature, if the answer you would give is already there, please upvote it.)

    Read the article

  • What is the nicest way to parse this in C++ ?

    - by ereOn
    Hi, In my program, I have a list of "server address" in the following format: host[:port] The brackets here, indicate that the port is optional. host can be a hostname, an IPv4 or IPv6 address. port, if present can be a numeric port number or a service string (like: "http" or "ssh"). If port is present and host is an IPv6 address, host must be in "bracket-enclosed" notation (Example: [::1]) Here are some valid examples: localhost localhost:11211 127.0.0.1:http [::1]:11211 ::1 [::1] And an invalid example: ::1:80 // Invalid: Is this the IPv6 address ::1:80 and a default port, or the IPv6 address ::1 and the port 80 ? ::1:http // This is not ambigous, but for simplicity sake, let's consider this is forbidden as well. My goal is to separate such entries in two parts (obviously host and port). I don't care if either the host or port are invalid as long as they don't contain a : (290.234.34.34.5 is ok for host, it will be rejected in the next process); I just want to separate the two parts, or if there is no port part, to know it somehow. I tried to do something with std::stringstream but everything I come up to seems hacky and not really elegant. How would you do this in C++ ? I don't mind answers in C but C++ is prefered. Any boost solution is welcome as well. Thank you.

    Read the article

  • Why does the WCF 3.5 REST Starter Kit do this?

    - by Brandon
    I am setting up a REST endpoint that looks like the following: [WebInvoke(Method = "POST", UriTemplate = "?format=json", BodyStyle = WebMessageBodyStyle.WrappedRequest, ResponseFormat = WebMessageFormat.Json)] and [WebInvoke(Method = "DELETE", UriTemplate = "?token={token}&format=json", ResponseFormat = WebMessageFormat.Json)] The above throws the following error: UriTemplateTable does not support '?format=json' and '?token={token}&format=json' since they are not equivalent, but cannot be disambiguated because they have equivalent paths and the same common literal values for the query string. See the documentation for UriTemplateTable for more detail. I am not an expert at WCF, but I would imagine that it should map first by the HTTP Method and then by the URI Template. It appears to be backwards. If both of my URI templates are: ?token={token}&format=json This works because they are equivalent and it then appears to look at the HTTP Method where one is POST and the other is DELETE. Is REST supposed to work this way? Why are the URI Template Tables not being sorted first by HTTP Method and then by URI Template? This can cause some serious frustrations when 1 HTTP Method requires a parameter and another does not, or if I want to do optional parameters (e.g. if the 'format' parameter is not passed, default to XML).

    Read the article

  • Regular Expressions .NET

    - by Fosa
    I need a regular expression for some arguments that must match on a string. here it is... The string exists out of minimum 8 en maximum 20 characters. These characters of this string may be characters of the alfabet or special chars --With other words..all charachters except from the whitespaces In the complete string there must be atleast 1 number. The string cannot start with a number or an underscore The last 2 characters of the string must be identical, But it doenst matter if those last --identical characters are capital or non-capital (case insensitive) Must match all : +234567899 a_1de*Gg xy1Me*__ !41deF_hij2lMnopq3ss C234567890123$^67800 *5555555 sDF564zer"" !!!!!!!!!4!!!!!!!!!! abcdefghijklmnopq9ss May not match : Cannot be less then 8 or more then 20 chars: a_1+Eff B41def_hIJ2lmnopq3stt Cannot contain a whitespace: A_4 e*gg b41def_Hij2l nopq3ss Cannot start with a number or an underscore: __1+Eff 841DEf_hij2lmnopq3stt cannot end on 2 diffrent characters: a_1+eFg b41DEf_hij2lmnopq3st Cannot be without a number in the string: abCDefghijklmnopqrss abcdef+++dF !!!!!!!!!!!!!!!!!!!! ------------------------------------------------------ This is what I have so far...But I'm really breaking my head on this... If you Don't know the answer completely it's not a problem... I just want to get in the right direction ([^0-9_])(?=.*\d)(\S{8,20})(?i:[\S])\1

    Read the article

  • PHP preg_match: a pattern which satisfies all MySQL field names (including 'table.field' formations)

    - by gsquare567
    i need a pattern which satisfies mysql field names, but also with the option of having a table name before it examples: mytable.myfield myfield my4732894__7289FiEld here's what i tried: $pattern = "/^[a-zA-Z0-9_]*?[\.[a-zA-Z0-9_]]?$/"; this worked for what i needed before, which was just the field name: $pattern = "/^[a-zA-Z0-9_]*$/"; any ideas why my addition isnt working? maybe i'm making up regex, so i'll explain what i added... the first '?' is to say that it isn't greedy, ie. it will stop if the next part, namely "[.[a-zA-Z0-9_]]?" is satisfied. now, that second part is just the same as the first except it is optional (hence the '?' at the end) and it starts with a period (hence the '[.' and ']' wrapping my old clause. and obviously, the "^" and "$" rep the beginning and end of the string so... any ideas? (also, i'm a tad confused as to why i need to put in those "/"s in the begining/end anyways, so if you could tell me why it's required, that'd be awesome) thanks a lot! (and thanks for reading this all if you actually did... it's quite a ramble)

    Read the article

< Previous Page | 169 170 171 172 173 174 175 176 177 178 179 180  | Next Page >