Search Results

Search found 5279 results on 212 pages for 'optional arguments'.

Page 173/212 | < Previous Page | 169 170 171 172 173 174 175 176 177 178 179 180  | Next Page >

• Regular Expressions .NET

  - by Fosa

  I need a regular expression for some arguments that must match on a string. here it is... The string exists out of minimum 8 en maximum 20 characters. These characters of this string may be characters of the alfabet or special chars --With other words..all charachters except from the whitespaces In the complete string there must be atleast 1 number. The string cannot start with a number or an underscore The last 2 characters of the string must be identical, But it doenst matter if those last --identical characters are capital or non-capital (case insensitive) Must match all : +234567899 a_1de*Gg xy1Me*__ !41deF_hij2lMnopq3ss C234567890123$^67800 *5555555 sDF564zer"" !!!!!!!!!4!!!!!!!!!! abcdefghijklmnopq9ss May not match : Cannot be less then 8 or more then 20 chars: a_1+Eff B41def_hIJ2lmnopq3stt Cannot contain a whitespace: A_4 e*gg b41def_Hij2l nopq3ss Cannot start with a number or an underscore: __1+Eff 841DEf_hij2lmnopq3stt cannot end on 2 diffrent characters: a_1+eFg b41DEf_hij2lmnopq3st Cannot be without a number in the string: abCDefghijklmnopqrss abcdef+++dF !!!!!!!!!!!!!!!!!!!! ------------------------------------------------------ This is what I have so far...But I'm really breaking my head on this... If you Don't know the answer completely it's not a problem... I just want to get in the right direction ([^0-9_])(?=.*\d)(\S{8,20})(?i:[\S])\1

  Read the article

• Refining Search Results [PHP/MySQL]

  - by Dae

  I'm creating a set of search panes that allow users to tweak their results set after submitting a query. We pull commonly occurring values in certain fields from the results and display them in order of their popularity - you've all seen this sort of thing on eBay. So, if a lot of rows in our results were created in 2009, we'll be able to click "2009" and see only rows created in that year. What in your opinion is the most efficient way of applying these filters? My working solution was to discard entries from the results that didn't match the extra arguments, like: while($row = mysql_fetch_assoc($query)) { foreach($_GET as $key => $val) { if($val !== $row[$key]) { continue 2; } } // Output... } This method should hopefully only query the database once in effect, as adding filters doesn't change the query - MySQL can cache and reuse one data set. On the downside it makes pagination a bit of a headache. The obvious alternative would be to build any additional criteria into the initial query, something like: $sql = "SELECT * FROM tbl MATCH (title, description) AGAINST ('$search_term')"; foreach($_GET as $key => $var) { $sql .= " AND ".$key." = ".$var; } Are there good reasons to do this instead? Or are there better options altogether? Maybe a temporary table? Any thoughts much appreciated!

  Read the article

• ASP.NET MVC 2 - Custom route doesn't find controller action

  - by mcfroob

  For some reason my application isn't routing to my controller method correctly. I have a routelink like this in my webpage - <%= Html.RouteLink("View", "Blog", new { id=(item.BlogId), slug=(item.Slug) }) %> In global.asax.cs I have the following routes - routes.IgnoreRoute("{resource}.axd/{*pathInfo}"); routes.MapRoute( "MoreBlogs", "Blog/Page/{page}", new { controller = "Blog", action = "Index" } ); routes.MapRoute( "Blog", "Blog/View/{id}/{slug}", new { controller = "Blog", action = "View"} ); routes.MapRoute( "Default", // Route name "{controller}/{action}/{id}", // URL with parameters new { controller = "Blog", action = "Index", id = UrlParameter.Optional } // Parameter defaults ); And then I have a class BlogController that has a method - public ActionResult View(int id, string slug) { ... etc. } I put a breakpoint in the first line of the View method but it's not getting hit at all. I checked with a route debugger for the format localhost/Blog/View/1/test and it matched my custom route. All I'm getting is a 404 while running this, I can't work out why the route won't post to the view method in my controller - any ideas?

  Read the article

• Being pressured to GOTO the dark-side

  - by Dan McG

  We have a situation at work where developers working on a legacy (core) system are being pressured into using GOTO statements when adding new features into existing code that is already infected with spagetti code. Now, I understand there may be arguments for using 'just one little GOTO' instead of spending the time on refactoring to a more maintainable solution. The issue is, this isolated 'just one little GOTO' isn't so isolated. At least once every week or so there is a new 'one little GOTO' to add. This codebase is already a horror to work with due to code dating back to or before 1984 being riddled with GOTOs that would make many Pastafarians believe it was inspired by the Flying Spagetti Monster itself. Unfortunately the language this is written in doesn't have any ready made refactoring tools, so it makes it harder to push the 'Refactor to increase productivity later' because short-term wins are the only wins paid attention to here... Has anyone else experienced this issue whereby everybody agrees that we cannot be adding new GOTOs to jump 2000 lines to a random section, but continually have Anaylsts insist on doing it just this one time and having management approve it? tldr; How can one go about addressing the issue of developers being pressured (forced) to continually add GOTO statements (by add, I mean add to jump to random sections many lines away) because it 'gets that feature in quicker'? I'm beginning to fear we may loses valuable developers to the raptors over this...

  Read the article

• recvfrom returns invalid argument when *from* is passed

  - by Aditya Sehgal

  I am currently writing a small UDP server program in linux. The UDP server will receive packets from two different peers and will perform different operations based on from which peer it received the packet. I am trying to determine the source from where I receive the packet. However, when select returns and recvfrom is called, it returns with an error of Invalid Argument. If I pass NULL as the second last arguments, recvfrom succeeds. I have tried declaring fromAddr as struct sockaddr_storage, struct sockaddr_in, struct sockaddr without any success. Is their something wrong with this code? Is this the correct way to determine the source of the packet? The code snippet follows. ` /*TODO : update for TCP. use recv */ if((pkInfo->rcvLen=recvfrom(psInfo->sockFd, pkInfo->buffer, MAX_PKTSZ, 0, /* (struct sockaddr*)&fromAddr,*/ NULL, &(addrLen) )) < 0) { perror("RecvFrom failed\n"); } else { /*Apply Filter */ #if 0 struct sockaddr_in* tmpAddr; tmpAddr = (struct sockaddr_in* )&fromAddr; printf("Received Msg From %s\n",inet_ntoa(tmpAddr->sin_addr)); #endif printf("Packet Received of len = %d\n",pkInfo->rcvLen); } `

  Read the article

• How to write an R function that evaluates an expression within a data-frame

  - by Prasad Chalasani

  Puzzle for the R cognoscenti: Say we have a data-frame: df <- data.frame( a = 1:5, b = 1:5 ) I know we can do things like with(df, a) to get a vector of results. But how do I write a function that takes an expression (such as a or a > 3) and does the same thing inside. I.e. I want to write a function fn that takes a data-frame and an expression as arguments and returns the result of evaluating the expression "within" the data-frame as an environment. Never mind that this sounds contrived (I could just use with as above), but this is just a simplified version of a more complex function I am writing. I tried several variants ( using eval, with, envir, substitute, local, etc) but none of them work. For example if I define fn like so: fn <- function(dat, expr) { eval(expr, envir = dat) } I get this error: > fn( df, a ) Error in eval(expr, envir = dat) : object 'a' not found Clearly I am missing something subtle about environments and evaluation. Is there a way to define such a function?

  Read the article

• Why does Python sometimes upgrade a string to unicode and sometimes not?

  - by samtregar

  I'm confused. Consider this code working the way I expect: >>> foo = u'Émilie and Juañ are turncoats.' >>> bar = "foo is %s" % foo >>> bar u'foo is \xc3\x89milie and Jua\xc3\xb1 are turncoats.' And this code not at all working the way I expect: >>> try: ... raise Exception(foo) ... except Exception as e: ... foo2 = e ... >>> bar = "foo2 is %s" % foo2 ------------------------------------------------------------ Traceback (most recent call last): File "<ipython console>", line 1, in <module> UnicodeEncodeError: 'ascii' codec can't encode characters in position 0-1: ordinal not in range(128) Can someone explain what's going on here? Why does it matter whether the unicode data is in a plain unicode string or stored in an Exception object? And why does this fix it: >>> bar = u"foo2 is %s" % foo2 >>> bar u'foo2 is \xc3\x89milie and Jua\xc3\xb1 are turncoats.' I am quite confused! Thanks for the help! UPDATE: My coding buddy Randall has added to my confusion in an attempt to help me! Send in the reinforcements to explain how this is supposed to make sense: >>> class A: ... def __str__(self): return "string" ... def __unicode__(self): return "unicode" ... >>> "%s %s" % (u'niño', A()) u'ni\xc3\xb1o unicode' >>> "%s %s" % (A(), u'niño') u'string ni\xc3\xb1o' Note that the order of the arguments here determines which method is called!

  Read the article

• Encode_JSON Errors in Lasso 8.6.2 After Period of Time

  - by ATP_JD

  We are in the process of converting apps from Lasso 8 to Lasso 9, and as an intermediate step, have upgraded from 8.5.5 to 8.6.2 (which runs alongside 9 on our new box, in different virtual hosts). I am finding that with 8.6.2 we are getting a slew of errors on pages that call encode_json. The weird thing with these errors is that they don't start happening until some period of time after the site starts. Then, some hours later, all encode_json calls begin to fail with error messages like this: An error occurred while processing your request. Error Information Error Message: No tag, type or constant was defined under the name "?????????????????" with arguments: array: (pair: (-find)=([\x{0020}-\x{21}\x{23}-\x{5b}\x{5d}-\x{10fff}])), (r) at: onCompare with params: 'r' at: JSON with params: 'reload', -Options=array: (-Internal) at: JSON with params: @map: (reload)=(false), (tcstring)=(LZU), (timestring)=(10:42 AM&nbsp;&nbsp;&nbsp;1442Z) at: [...].lasso with params: 'pageloadtime'='1383038310' on line: 31 at position: 1 Error Code: -9948 (Yes, those Chinese(?) characters are in the error message.) I have removed the 8.5.5 encode_json tag from LassoStartup, so we are using the correct built-in method. The encode_json method fails for any and all parameters I throw at it from simple strings to arrays of maps. Upon restarting the site, encode_json resumes working for an hour or two, seemingly depending on load. On 8.5.5, we don't have this problem. Does anyone have experience with this issue? Any advice regarding trying the 8.5.5 tag swap encode_json to see if I can override the built-in method? Maybe it will work better? Thanks in advance for your time and assistance. -Justin

  Read the article

• C: incompatible types in assignment

  - by The.Anti.9

  I'm writing a program to check to see if a port is open in C. One line in particular copies one of the arguments to a char array. However, when I try to compile, it says: error: incompatible types in assignment Heres the code. The error is on the assignment of addr #include <sys/socket.h> #include <sys/time.h> #include <sys/types.h> #include <arpa/inet.h> #include <netinet/in.h> #include <errno.h> #include <fcntl.h> #include <stdio.h> #include <netdb.h> #include <stdlib.h> #include <string.h> #include <unistd.h> int main(int argc, char **argv) { u_short port; /* user specified port number */ char addr[1023]; /* will be a copy of the address entered by u */ struct sockaddr_in address; /* the libc network address data structure */ short int sock = -1; /* file descriptor for the network socket */ port = atoi(argv[1]); addr = strncpy(addr, argv[2], 1023); bzero((char *)&address, sizeof(address)); /* init addr struct */ address.sin_addr.s_addr = inet_addr(addr); /* assign the address */ address.sin_port = htons(port); /* translate int2port num */ sock = socket(AF_INET, SOCK_STREAM, 0); if (connect(sock,(struct sockaddr *)&address,sizeof(address)) == 0) { printf("%i is open\n", port); } if (errno == 113) { fprintf(stderr, "Port not open!\n"); } close(sock); return 0; } I'm new to C, so I'm not sure why it would do this.

  Read the article

• How do i make multi call with SudzC

  - by laxonline

  I am developing magento eCommerce stores in iPhone. For that, i have using Sudzc service class for SOAP WS call. Now, I'm trying to create a cart session its working fine. im getting the cardid. And i need to add one product to cart with some arguments. below is the php request example i need to call same this PHP Request Example $proxy = new SoapClient('http://beta.saletab.com/api/soap/?wsdl'); $sessionId = $proxy->login('xxxx', 'zzzzzzzzzzzzzzzzzzzzzzzzz'); //print_r($sessionId); $shoppingCartId = $proxy->call( $sessionId, 'cart.create'); $result = $proxy->call($sessionId,'cart_product.add',array($shoppingCartId,array('product_id'=>"3109",'qty' => 2)),0); echo "REQUEST HEADERS:\n" . $result->__getLastRequestHeaders() . "\n"; IOS Request im trying to send some product details like productid, sku & cardid SDZMagentoService *service = [SDZMagentoService service]; NSString *sessionId = [IMAPP_DELEGATE getUserDefault:IMAPI_SESSIONID]; NSString *cartId = [IMAPP_DELEGATE getUserDefault:IMAPI_CARTSESSIONID]; NSDictionary *argu = [[NSDictionary alloc] initWithObjectsAndKeys:@"3109",@"product_id",@"2",@"qty",cartId,@"card_id", nil]; [service call:self action:@selector(cartTest:) sessionId:sessionId resourcePath:@"cart_product.add" args:argu];

  Read the article

• DBD::CSV: Problem with userdefined functions

  - by sid_com

  From the SQL::Statement::Functions documentation: Creating User-Defined Functions ... More complex functions can make use of a number of arguments always passed to functions automatically. Functions always receive these values in @_: sub FOO { my( $self, $sth, $rowhash, @params ); } #!/usr/bin/env perl use 5.012; use warnings; use strict; use DBI; my $dbh = DBI->connect( "DBI:CSV:", undef, undef, { RaiseError => 1, } ); my $table = 'wages'; my $array_ref = [ [ 'id', 'number' ], [ 0, 6900 ], [ 1, 3200 ], [ 2, 1800 ], ]; $dbh->do( "CREATE TEMP TABLE $table AS import( ? )", {}, $array_ref ); sub routine { my $self = shift; my $sth = shift; my $rowhash = shift; # return $_[0] / 30; }; $dbh->do( "CREATE FUNCTION routine" ); my $sth = $dbh->prepare( "SELECT id, routine( number ) AS result FROM $table" ); $sth->execute(); $sth->dump_results(); When I try this I get an error-message: DBD::CSV::st execute failed: Use of uninitialized value $_[0] in division (/) at ./so.pl line 27. [for Statement "SELECT id, routine( number ) AS result FROM "wages""] at ./so.pl line 34. When I comment out the third argument I works as expected ( because it looks as if the third argument is missing ): #!/usr/bin/env perl ... sub routine { my $self = shift; my $sth = shift; #my $rowhash = shift; return $_[0] / 30; }; ... 0, 230 1, 106.667 2, 60 3 rows Is this a bug?

  Read the article

• string comparision and counting the key in target [closed]

  - by mesun

  Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

  Read the article

• F# How to tokenise user input: separating numbers, units, words?

  - by David White

  I am fairly new to F#, but have spent the last few weeks reading reference materials. I wish to process a user-supplied input string, identifying and separating the constituent elements. For example, for this input: XYZ Hotel: 6 nights at 220EUR / night plus 17.5% tax the output should resemble something like a list of tuples: [ ("XYZ", Word); ("Hotel:", Word); ("6", Number); ("nights", Word); ("at", Operator); ("220", Number); ("EUR", CurrencyCode); ("/", Operator); ("night", Word); ("plus", Operator); ("17.5", Number); ("%", PerCent); ("tax", Word) ] Since I'm dealing with user input, it could be anything. Thus, expecting users to comply with a grammar is out of the question. I want to identify the numbers (could be integers, floats, negative...), the units of measure (optional, but could include SI or Imperial physical units, currency codes, counts such as "night/s" in my example), mathematical operators (as math symbols or as words including "at" "per", "of", "discount", etc), and all other words. I have the impression that I should use active pattern matching -- is that correct? -- but I'm not exactly sure how to start. Any pointers to appropriate reference material or similar examples would be great.

  Read the article

• Google App engine Url Mapping using WSGIAppl and regx grouping Help Needed

  - by spidee

  Hi take this example from google docs class BrowseHandler(webapp.RequestHandler): > def get(self, category, product_id): > # Display product with given ID in the given category. > > > # Map URLs like /browse/(category)/(product_id) to > BrowseHandler. application = > webapp.WSGIApplication([(r'/browse/(.*)/(.*)', > BrowseHandler) > ], > debug=True) > > def main(): > run_wsgi_app(application) > > if __name__ == '__main__': > main() How can i change the regx groupings so that Product id is optional ie the url http://yourdomain.com/category will be sent to the browse handler in the current above example you must add a product id or at least the / after the category ie http://yourdomain.com/category/ r'/browse/(.)/(.)' Any ideas?

  Read the article

• Problem updating collection using JPA

  - by FarmBoy

  I have an entity class Foo foo that contains Collection<Bar> bars. I've tried a variety of ways, but I'm unable to successfully update my collection. One attempt: foo = em.find(key); foo.getBars().clear(); foo.setBars(bars); em.flush; \\ commit, etc. This appends the new collection to the old one. Another attempt: foo = em.find(key); bars = foo.getBars(); for (Bar bar : bars) { em.remove(bar); } em.flush; At this point, I thought I could add the new collection, but I find that the entity foo has been wiped out. Here are some annotations. In Foo: @OneToMany(cascade = { CascadeType.ALL }, mappedBy = "foo") private List<Bar> bars; In Bar: @ManyToOne(optional = false, cascade = { CascadeType.ALL }) @JoinColumn(name = "FOO_ID") private Foo foo; Has anyone else had trouble with this? Any ideas?

  Read the article

• How to transform a production to LL(1) grammar for a list separated by a semicolon?

  - by Subb

  Hi, I'm reading this introductory book on parsing (which is pretty good btw) and one of the exercice is to "build a parser for your favorite language." Since I don't want to die today, I thought I could do a parser for something relatively simple, ie a simplified CSS. Note: This book teach you how to right a LL(1) parser using the recursive-descent algorithm. So, as a sub-exercice, I am building the grammar from what I know of CSS. But I'm stuck on a production that I can't transform in LL(1) : //EBNF block = "{", declaration, {";", declaration}, [";"], "}" //BNF <block> =:: "{" <declaration> "}" <declaration> =:: <single-declaration> <opt-end> | <single-declaration> ";" <declaration> <opt-end> =:: "" | ";" This describe a CSS block. Valid block can have the form : { property : value } { property : value; } { property : value; property : value } { property : value; property : value; } ... The problem is with the optional ";" at the end, because it overlap with the starting character of {";", declaration}, so when my parser meet a semicolon in this context, it doesn't know what to do. The book talk about this problem, but in its example, the semicolon is obligatory, so the rule can be modified like this : block = "{", declaration, ";", {declaration, ";"}, "}" So, Is it possible to achieve what I'm trying to do using a LL(1) parser?

  Read the article

• Should we retire the term "Context"?

  - by MrGumbe

  I'm not sure if there is a more abused term in the world of programming than "Context." A word that has a very clear meaning in the English language has somehow morphed into a hot mess in software development, where the definition where the connotation can be completely different based on what library you happen to be developing in. Tomcat uses the word context to mean the configuration of a web application. Java applets, on the other hand, use an AppletContext to define attributes of the browser and HTML tag that launched it, but the BeanContext is defined as a container. ASP.NET uses the HttpContext object as a grab bag of state - containing information about the current request / response, session, user, server, and application objects. Context Oriented Programming defines the term as "Any information which is computationally accessible may form part of the context upon which behavioral variations depend," which I translate as "anything in the world." The innards of the Windows OS uses the CONTEXT structure to define properties about the hardware environment. The .NET installation classes, however, use the InstallContext property to represent the command line arguments entered to the installation class. The above doesn't even touch how all of us non-framework developers have used the term. I've seen plenty of developers fall into the subconscious trap of "I can't think of anything else to call this class, so I'll name it 'WidgetContext.'" Do you all agree that before naming our class a "Context," we may want to first consider some more descriptive terms? "Environment", "Configuraton", and "ExecutionState" come readily to mind.

  Read the article

• Re-usable Obj-C classes with custom values: The right way

  - by Prairiedogg

  I'm trying to reuse a group of Obj-C clases between iPhone applications. The values that differ from app to app have been isolated and I'm trying to figure out the best way to apply these custom values to the classes on an app-to-app basis. Should I hold them in code? // I might have 10 customizable values for each class, that's a long signature! CarController *controller = [[CarController alloc] initWithFontName:@"Vroom" engine:@"Diesel" color:@"Red" number:11]; Should I store them in a big settings.plist? // Wasteful! I sometimes only use 2-3 of 50 settings! AllMyAppSettings *settings = [[AllMyAppSettings alloc] initFromDisk:@"settings.plist"]; MyCustomController *controller = [[MyCustomController alloc] initWithSettings:settings]; [settings release]; Should I have little, optional n_settings.plists for each class? // Sometimes I customize CarControllerSettings *carSettings = [[CarControllerSettings alloc] initFromDisk:@"car_settings.plist"]; CarController *controller = [[CarController alloc] initWithSettings:carSettings]; [carSettings release]; // Sometimes I don't, and CarController falls back to internally stored, reasonable defaults. CarController *controller = [[CarController alloc] initWithSettings:nil]; Or is there an OO solution that I'm not thinking of at all that would be better?

  Read the article

• Forming triangles from points and relations

  - by SiN

  Hello, I want to generate triangles from points and optional relations between them. Not all points form triangles, but many of them do. In the initial structure, I've got a database with the following tables: Nodes(id, value) Relations(id, nodeA, nodeB, value) Triangles(id, relation1_id, relation2_id, relation3_id) In order to generate triangles from both nodes and relations table, I've used the following query: INSERT INTO Triangles SELECT t1.id, t2.id , t3.id, FROM Relations t1, Relations t2, Relations t3 WHERE t1.id < t2.id AND t3.id > t1.id AND ( t1.nodeA = t2.nodeA AND (t3.nodeA = t1.nodeB AND t3.nodeB = t2.nodeB OR t3.nodeA = t2.nodeB AND t3.nodeB = t1.nodeB) OR t1.nodeA = t2.nodeB AND (t3.nodeA = t1.nodeB AND t3.nodeB = t2.nodeA OR t3.nodeA = t2.nodeA AND t3.nodeB = t1.nodeB) ) It's working perfectly on small sized data. (~< 50 points) In some cases however, I've got around 100 points all related to each other which leads to thousands of relations. So when the expected number of triangles is in the hundreds of thousands, or even in the millions, the query might take several hours. My main problem is not in the select query, while I see it execute in Management Studio, the returned results slow. I received around 2000 rows per minute, which is not acceptable for my case. As a matter of fact, the size of operations is being added up exponentionally and that is terribly affecting the performance. I've tried doing it as a LINQ to object from my code, but the performance was even worse. I've also tried using SqlBulkCopy on a reader from C# on the result, also with no luck. So the question is... Any ideas or workarounds?

  Read the article

• Thread mutex behaviour

  - by Alberteddu

  Hi there, I'm learning C. I'm writing an application with multiple threads; I know that when a variable is shared between two or more threads, it is better to lock/unlock using a mutex to avoid deadlock and inconsistency of variables. This is very clear when I want to change or view one variable. int i = 0; /** Global */ static pthread_mutex_t mutex = PTHREAD_MUTEX_INITIALIZER; /** Thread 1. */ pthread_mutex_lock(&mutex); i++; pthread_mutex_unlock(&mutex); /** Thread 2. */ pthread_mutex_lock(&mutex); i++; pthread_mutex_unlock(&mutex); This is correct, I think. The variable i, at the end of the executions, contains the integer 2. Anyway, there are some situations in which I don't know exactly where to put the two function calls. For example, suppose you have a function obtain(), which returns a global variable. I need to call that function from within the two threads. I have also two other threads that call the function set(), defined with a few arguments; this function will set the same global variable. The two functions are necessary when you need to do something before getting/setting the var. /** (0) */ /** Thread 1, or 2, or 3... */ if(obtain() == something) { if(obtain() == somethingElse) { // Do this, sometimes obtain() and sometimes set(random number) (1) } else { // Do that, just obtain(). (2) } } else { // Do this and do that (3) // If # of thread * 3 > 10, then set(3*10) For example. (4) } /** (5) */ Where I have to lock, and where I have to unlock? The situation can be, I think, even more complex. I will appreciate an exhaustive answer. Thank you in advance. —Alberto

  Read the article

• How to solve this problem with Python

  - by morpheous

  I am "porting" an application I wrote in C++ into Python. This is the current workflow: Application is started from the console Application parses CLI args Application reads an ini configuration file which specifies which plugins to load etc Application starts a timer Application iterates through each loaded plugin and orders them to start work. This spawns a new worker thread for the plugin The plugins carry out their work and when completed, they die When time interval (read from config file) is up, steps 5-7 is repeated iteratively Since I am new to Python (2 days and counting), the distinction between script, modules and packages are still a bit hazy to me, and I would like to seek advice from Pythonista as to how to implement the workflow described above, using Python as the programing language. In order to keep things simple, I have decided to leave out the time interval stuff out, and instead run the python script/scripts as a cron job instead. This is how I am thinking of approaching it: Encapsulate the whole application in a package which is executable (i.e. can be run from the command line with arguments. Write the plugins as modules (I think maybe its better to implement each module in a separate file?) I havent seen any examples of using threading in Python yet. Could someone provide a snippet of how I could spawn a thread to run a module. Also, I am not sure how to implement the concept of plugins in Python - any advice would be helpful - especially with a code snippet.

  Read the article

• Haskell quiz: a simple function

  - by levy

  I'm not a Haskell programmer, but I'm curious about the following questions. Informal function specification: Let MapProduct be a function that takes a function called F and multiple lists. It returns a list containing the results of calling F with one argument from each list in each possible combination. Example: Call MapProduct with F being a function that simply returns a list of its arguments, and two lists. One of the lists contains the integers 1 and 2, the other one contains the strings "a" and "b". It should return a list that contains the lists: 1 and "a", 1 and "b", 2 and "a", 2 and "b". Questions: How is MapProduct implemented? What is the function's type? What is F's type? Can one guess what the function does just by looking at its type? Can you handle inhomogeneous lists as input? (e.g. 1 and "a" in one of the input lists) What extra limitation (if any) do you need to introduce to implement MapProduct?

  Read the article

• Best way to use Google's hosted jQuery, but fall back to my hosted library on Google fail

  - by Nosredna

  What would be a good way to attempt to load the hosted jQuery at Google (or other Google hosted libs), but load my copy of jQuery if the Google attempt fails? I'm not saying Google is flaky. There are cases where the Google copy is blocked (apparently in Iran, for instance). Would I set up a timer and check for the jQuery object? What would be the danger of both copies coming through? Not really looking for answers like "just use the Google one" or "just use your own." I understand those arguments. I also understand that the user is likely to have the Google version cached. I'm thinking about fallbacks for the cloud in general. Edit: This part added... Since Google suggests using google.load to load the ajax libraries, and it performs a callback when done, I'm wondering if that's the key to serializing this problem. I know it sounds a bit crazy. I'm just trying to figure out if it can be done in a reliable way or not. Update: jQuery now hosted on Microsoft's CDN. http://www.asp.net/ajax/cdn/

  Read the article

• Node.js/Express Partials problem: Can't be nested too deep?

  - by heorling

  I'm learning Node.js, Express, haml.js and liking it. I've run into a prety annoying problem though. I'm pretty new to this but have been getting nice results so far. I'm writing a jquery heavy web app that relies on a table containing divs. The divs slide around, switch back and fourth and are resized etc to my hearts content. What I'm looking for a way to switch (template?) the divs. Since I've been building in express and mimicking the chat example it would make sense to use partials. The rub is that I've been using inexplicit divs in haml, held within a td. The divs are cunstructed as follows: %tr %td .class1.class2.class3.classetc Which has worked fine cross browser. Parsing the classes works great for the js code to pass arguments around, fetch values etc. What I'd like to be able to do is something like: %tr %td .class1.class2.class3.classetc %ul#messages != this.partial('message.html.haml', { collection: messages }) Any combination I've tried with this has failed however. And I might have tried them all. If I could put a partial into that div I'd probably be set. And you can nest them as long as you use #ids instead of .classes. But if you use more than one class it breaks! I think that's the most accurate way of summing it up. How do you do this? I've checked out various templating solutions like mu.js and micro template like by John Resig. I earlier checked out this thread on templating engines. It's very possible I'm making some fundamental mistake here, I'm new to this. What's a good way to do this?

  Read the article

• Can I write a .NETCF Partial Class to extend System.Windows.Forms.UserControl?

  - by eidylon

  Okay... I'm writing a .NET CF (VBNET 2008 3.5 SP1) application, which has one master form, and it dynamically loads specific UserControls based on menu click, in a sort of framework idea. There are certain methods and properties these controls all need to work within the app. Right now I am doing this as an Interface, but this is aggravating as all get up, because some of the methods are optional, and yet I MUST implement them by the nature of interfaces. I would prefer to use inheritance, so that I can have certain code be inherited with overridability, but if I write a class which inherits System.Windows.Forms.UserControl and then inherit my control from that, it squiggles, and tells me that UserControls MUST inherit directly from System.Windows.Forms.UserControl. (Talk about a design flaw!) So next I thought, well, let me use a partial class to extend System.Windows.Forms.UserControl, but when I do that, even though it all seems to compile fine, none of my new properties/methods show up on my controls. Is there any way I can use partial classes to 'extend' System.Windows.Forms.UserControl? For example, can anyone give me a code sample of a partial class which simply adds a MyCount As Integer readonly property to the System.Windows.Forms.UserControl class? If I can just see how to get this going, I can take it from there and add the rest of my functionality. Thanks in advance! I've been searching google, but can't find anything that seems to work for UserControl extension on .NET CF. And the Interface method is driving me crazy as even a small change means updating ALL the controls whether they need to 'override' the method or not.

  Read the article

< Previous Page | 169 170 171 172 173 174 175 176 177 178 179 180  | Next Page >