Search Results

Search found 5279 results on 212 pages for 'optional arguments'.

Page 173/212 | < Previous Page | 169 170 171 172 173 174 175 176 177 178 179 180  | Next Page >

• Should we retire the term "Context"?

  - by MrGumbe

  I'm not sure if there is a more abused term in the world of programming than "Context." A word that has a very clear meaning in the English language has somehow morphed into a hot mess in software development, where the definition where the connotation can be completely different based on what library you happen to be developing in. Tomcat uses the word context to mean the configuration of a web application. Java applets, on the other hand, use an AppletContext to define attributes of the browser and HTML tag that launched it, but the BeanContext is defined as a container. ASP.NET uses the HttpContext object as a grab bag of state - containing information about the current request / response, session, user, server, and application objects. Context Oriented Programming defines the term as "Any information which is computationally accessible may form part of the context upon which behavioral variations depend," which I translate as "anything in the world." The innards of the Windows OS uses the CONTEXT structure to define properties about the hardware environment. The .NET installation classes, however, use the InstallContext property to represent the command line arguments entered to the installation class. The above doesn't even touch how all of us non-framework developers have used the term. I've seen plenty of developers fall into the subconscious trap of "I can't think of anything else to call this class, so I'll name it 'WidgetContext.'" Do you all agree that before naming our class a "Context," we may want to first consider some more descriptive terms? "Environment", "Configuraton", and "ExecutionState" come readily to mind.

  Read the article

• How to write an R function that evaluates an expression within a data-frame

  - by Prasad Chalasani

  Puzzle for the R cognoscenti: Say we have a data-frame: df <- data.frame( a = 1:5, b = 1:5 ) I know we can do things like with(df, a) to get a vector of results. But how do I write a function that takes an expression (such as a or a > 3) and does the same thing inside. I.e. I want to write a function fn that takes a data-frame and an expression as arguments and returns the result of evaluating the expression "within" the data-frame as an environment. Never mind that this sounds contrived (I could just use with as above), but this is just a simplified version of a more complex function I am writing. I tried several variants ( using eval, with, envir, substitute, local, etc) but none of them work. For example if I define fn like so: fn <- function(dat, expr) { eval(expr, envir = dat) } I get this error: > fn( df, a ) Error in eval(expr, envir = dat) : object 'a' not found Clearly I am missing something subtle about environments and evaluation. Is there a way to define such a function?

  Read the article

• DBD::CSV: Problem with userdefined functions

  - by sid_com

  From the SQL::Statement::Functions documentation: Creating User-Defined Functions ... More complex functions can make use of a number of arguments always passed to functions automatically. Functions always receive these values in @_: sub FOO { my( $self, $sth, $rowhash, @params ); } #!/usr/bin/env perl use 5.012; use warnings; use strict; use DBI; my $dbh = DBI->connect( "DBI:CSV:", undef, undef, { RaiseError => 1, } ); my $table = 'wages'; my $array_ref = [ [ 'id', 'number' ], [ 0, 6900 ], [ 1, 3200 ], [ 2, 1800 ], ]; $dbh->do( "CREATE TEMP TABLE $table AS import( ? )", {}, $array_ref ); sub routine { my $self = shift; my $sth = shift; my $rowhash = shift; # return $_[0] / 30; }; $dbh->do( "CREATE FUNCTION routine" ); my $sth = $dbh->prepare( "SELECT id, routine( number ) AS result FROM $table" ); $sth->execute(); $sth->dump_results(); When I try this I get an error-message: DBD::CSV::st execute failed: Use of uninitialized value $_[0] in division (/) at ./so.pl line 27. [for Statement "SELECT id, routine( number ) AS result FROM "wages""] at ./so.pl line 34. When I comment out the third argument I works as expected ( because it looks as if the third argument is missing ): #!/usr/bin/env perl ... sub routine { my $self = shift; my $sth = shift; #my $rowhash = shift; return $_[0] / 30; }; ... 0, 230 1, 106.667 2, 60 3 rows Is this a bug?

  Read the article

• C: incompatible types in assignment

  - by The.Anti.9

  I'm writing a program to check to see if a port is open in C. One line in particular copies one of the arguments to a char array. However, when I try to compile, it says: error: incompatible types in assignment Heres the code. The error is on the assignment of addr #include <sys/socket.h> #include <sys/time.h> #include <sys/types.h> #include <arpa/inet.h> #include <netinet/in.h> #include <errno.h> #include <fcntl.h> #include <stdio.h> #include <netdb.h> #include <stdlib.h> #include <string.h> #include <unistd.h> int main(int argc, char **argv) { u_short port; /* user specified port number */ char addr[1023]; /* will be a copy of the address entered by u */ struct sockaddr_in address; /* the libc network address data structure */ short int sock = -1; /* file descriptor for the network socket */ port = atoi(argv[1]); addr = strncpy(addr, argv[2], 1023); bzero((char *)&address, sizeof(address)); /* init addr struct */ address.sin_addr.s_addr = inet_addr(addr); /* assign the address */ address.sin_port = htons(port); /* translate int2port num */ sock = socket(AF_INET, SOCK_STREAM, 0); if (connect(sock,(struct sockaddr *)&address,sizeof(address)) == 0) { printf("%i is open\n", port); } if (errno == 113) { fprintf(stderr, "Port not open!\n"); } close(sock); return 0; } I'm new to C, so I'm not sure why it would do this.

  Read the article

• Breaking dependencies when you can't make changes to other files?

  - by codemuncher

  I'm doing some stealth agile development on a project. The lead programmer sees unit testing, refactoring, etc as a waste of resources and there is no way to convince him otherwise. His philosophy is "If it ain't broke don't fix it" and I understand his point of view. He's been working on the project for over a decade and knows the code inside and out. I'm not looking to debate development practices. I'm new to the project and I've been tasked with adding a new feature. I've worked on legacy projects before and used agile development practices with good result but those teams were more receptive to the idea and weren't afraid of making changes to code. I've been told I can use whatever development methodology I want but I have to limit my changes to only those necessary to add the feature. I'm using tdd for the new classes I'm writing but I keep running into road blocks caused by the liberal use of global variables and the high coupling in the classes I need to interact with. Normally I'd start extracting interfaces for these classes and make their dependence on the global variables explicit by injecting them as constructor arguments or public properties. I could argue that the changes are necessary but considering the lead never had to make them I doubt he would see it my way. What techniques can I use to break these dependencies without ruffling the lead developer's feathers? I've made some headway using: Extract Interface (for the new classes I'm creating) Extend and override the wayward classes with test stubs. (luckily most methods are public virtual) But these two can only get me so far.

  Read the article

• converting code from non-(C)ontinuation (P)assing (S)tyle to CPS

  - by Delirium tremens

  before: function sc_startSiteCompare(){ var visitinguri; var validateduri; var downloaduris; var compareuris; var tryinguri; sc_setstatus('started'); visitinguri = sc_getvisitinguri(); validateduri = sc_getvalidateduri(visitinguri); downloaduris = new Array(); downloaduris = sc_generatedownloaduris(validateduri); compareuris = new Array(); compareuris = sc_generatecompareuris(validateduri); tryinguri = 0; sc_finishSiteCompare(downloaduris, compareuris, tryinguri); } function sc_getvisitinguri() { var visitinguri; visitinguri = content.location.href; return visitinguri; } after (I'm trying): function sc_startSiteCompare(){ var visitinguri; sc_setstatus('started'); visitinguri = sc_getvisitinguri(sc_startSiteComparec1); } function sc_startSiteComparec1 (visitinguri) { var validateduri; validateduri = sc_getvalidateduri(visitinguri, sc_startSiteComparec2); } function sc_startSiteComparec2 (visitinguri, c) { var downloaduris; downloaduris = sc_generatedownloaduris(validateduri, sc_startSiteComparec3); } function sc_startSiteComparec3 (validateduri, c) { var compareuris; compareuris = sc_generatecompareuris(downloaduris, validateduri, sc_startSiteComparec4); } function sc_startSiteComparec4 (downloaduris, compareuris, validateduri, c) { var tryinguri; tryinguri = 0; sc_finishSiteCompare(downloaduris, compareuris, tryinguri); } function sc_getvisitinguri(c) { var visitinguri; visitinguri = content.location.href; c(visitinguri); } I'm having to pass lots of arguments to functions now. global in procedural code look like this / self in modular code. Any difference? Will I really have to use OO now? As a last resort, does CPS have an alternative?

  Read the article

• summing functions handles in matlab

  - by user552231

  Hi I am trying to sum two function handles, but it doesn't work. for example: y1=@(x)(x*x); y2=@(x)(x*x+3*x); y3=y1+y2 The error I receive is "??? Undefined function or method 'plus' for input arguments of type 'function_handle'." This is just a small example, in reality I actually need to iteratively sum about 500 functions that are dependent on each other. EDIT The solution by Clement J. indeed works but I couldn't manage to generalize this into a loop and ran into a problem. I have the function s=@(x,y,z)((1-exp(-x*y)-z)*exp(-x*y)); And I have a vector v that contains 536 data points and another vector w that also contains 536 data points. My goal is to sum up s(v(i),y,w(i)) for i=1...536 Thus getting one function in the variable y which is the sum of 536 functions. The syntax I tried in order to do this is: sum=@(y)(s(v(1),y,z2(1))); for i=2:536 sum=@(y)(sum+s(v(i),y,z2(i))) end

  Read the article

• How to solve this problem with Python

  - by morpheous

  I am "porting" an application I wrote in C++ into Python. This is the current workflow: Application is started from the console Application parses CLI args Application reads an ini configuration file which specifies which plugins to load etc Application starts a timer Application iterates through each loaded plugin and orders them to start work. This spawns a new worker thread for the plugin The plugins carry out their work and when completed, they die When time interval (read from config file) is up, steps 5-7 is repeated iteratively Since I am new to Python (2 days and counting), the distinction between script, modules and packages are still a bit hazy to me, and I would like to seek advice from Pythonista as to how to implement the workflow described above, using Python as the programing language. In order to keep things simple, I have decided to leave out the time interval stuff out, and instead run the python script/scripts as a cron job instead. This is how I am thinking of approaching it: Encapsulate the whole application in a package which is executable (i.e. can be run from the command line with arguments. Write the plugins as modules (I think maybe its better to implement each module in a separate file?) I havent seen any examples of using threading in Python yet. Could someone provide a snippet of how I could spawn a thread to run a module. Also, I am not sure how to implement the concept of plugins in Python - any advice would be helpful - especially with a code snippet.

  Read the article

• Forming triangles from points and relations

  - by SiN

  Hello, I want to generate triangles from points and optional relations between them. Not all points form triangles, but many of them do. In the initial structure, I've got a database with the following tables: Nodes(id, value) Relations(id, nodeA, nodeB, value) Triangles(id, relation1_id, relation2_id, relation3_id) In order to generate triangles from both nodes and relations table, I've used the following query: INSERT INTO Triangles SELECT t1.id, t2.id , t3.id, FROM Relations t1, Relations t2, Relations t3 WHERE t1.id < t2.id AND t3.id > t1.id AND ( t1.nodeA = t2.nodeA AND (t3.nodeA = t1.nodeB AND t3.nodeB = t2.nodeB OR t3.nodeA = t2.nodeB AND t3.nodeB = t1.nodeB) OR t1.nodeA = t2.nodeB AND (t3.nodeA = t1.nodeB AND t3.nodeB = t2.nodeA OR t3.nodeA = t2.nodeA AND t3.nodeB = t1.nodeB) ) It's working perfectly on small sized data. (~< 50 points) In some cases however, I've got around 100 points all related to each other which leads to thousands of relations. So when the expected number of triangles is in the hundreds of thousands, or even in the millions, the query might take several hours. My main problem is not in the select query, while I see it execute in Management Studio, the returned results slow. I received around 2000 rows per minute, which is not acceptable for my case. As a matter of fact, the size of operations is being added up exponentionally and that is terribly affecting the performance. I've tried doing it as a LINQ to object from my code, but the performance was even worse. I've also tried using SqlBulkCopy on a reader from C# on the result, also with no luck. So the question is... Any ideas or workarounds?

  Read the article

• string comparision and counting the key in target [closed]

  - by mesun

  Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

  Read the article

• Call any webservice from the same $.ajax() call

  - by Andreas

  Hi! Im creating a usercontrol which is controled client side, it has an javascript-file attatched to it. This control has a button and upon click a popup appears, this popup shows a list of my domain entities. My entities are fetched using a call to a webservice. Im trying to get this popup usercontrol to work on all my entities, therefore i have the need to call any webservice needed (one per entity for example) with the same $.ajax() call. I have hiddenfields for the webservice url in my usercontrol which you specify in the markup via a property. So far so good. The problem arise when i need some additional parameters to the webservice (other than pagesize and pageindex). Say for example that one webservice takes an additional parameter "Date". At the moment i have my parameters set up like this: var params = JSON.stringify({ pageSize: _this.pageSize, pageIndex: _this.pageIndex }); and then i call the webservice like so: $.ajax({ webserviceUrl, params, function(result) { //some logic }); }); What i want to do is to be able to add my extra parameters (Date) to "Param" when needed, the specification of these parameters will be done via properties of the usercontrol. So, bottom line, i have a set of default parameters and want to dynamically add optional extra parameters. How is this possible? Thanks in advance.

  Read the article

• Re-usable Obj-C classes with custom values: The right way

  - by Prairiedogg

  I'm trying to reuse a group of Obj-C clases between iPhone applications. The values that differ from app to app have been isolated and I'm trying to figure out the best way to apply these custom values to the classes on an app-to-app basis. Should I hold them in code? // I might have 10 customizable values for each class, that's a long signature! CarController *controller = [[CarController alloc] initWithFontName:@"Vroom" engine:@"Diesel" color:@"Red" number:11]; Should I store them in a big settings.plist? // Wasteful! I sometimes only use 2-3 of 50 settings! AllMyAppSettings *settings = [[AllMyAppSettings alloc] initFromDisk:@"settings.plist"]; MyCustomController *controller = [[MyCustomController alloc] initWithSettings:settings]; [settings release]; Should I have little, optional n_settings.plists for each class? // Sometimes I customize CarControllerSettings *carSettings = [[CarControllerSettings alloc] initFromDisk:@"car_settings.plist"]; CarController *controller = [[CarController alloc] initWithSettings:carSettings]; [carSettings release]; // Sometimes I don't, and CarController falls back to internally stored, reasonable defaults. CarController *controller = [[CarController alloc] initWithSettings:nil]; Or is there an OO solution that I'm not thinking of at all that would be better?

  Read the article

• Update list dom only if list displayed

  - by Nikolaj Borisik

  Sometimes we use one store for few views(list, carousel,dataviews) and when we refresh(load, filter) store data, dom of all view that use this store will be rebuild, but some views is not displayed in this time, and may be will not show with these data. How we can refresh list dom only if it displayed, not every time when it store refresh? Issue examle Ext.define("Test.view.Main", { extend: 'Ext.tab.Panel', config: { tabBarPosition: 'bottom', items: [ ] }, constructor : function(){ this.callParent(arguments); var store = Ext.create('Ext.data.Store',{ data :[ {title : 'One'}, {title : 'Two'}, {title : 'Three'} ] }), firstList = Ext.create('Ext.List',{ title : 'tab1', store : store, itemTpl : '{title}', onItemDisclosure : function(){ store.add({title : 'Four'}); } }), secondList = Ext.create('Ext.List',{ title : 'tab2' , store : store, itemTpl : '{title}' }), thirdList = Ext.create('Ext.List',{ title : 'tab3', store : store, itemTpl : '{title}' }); this.add([ firstList, secondList, thirdList ]) ; } }); When tap on item in the first list, in store will be added new item. And dom of all list will be change although second and third list not displayed I see one option. Create one main store and create separate stores for each views. And when view show fill it store from Main store. But it look not good. Any other ideas?

  Read the article

• Haskell quiz: a simple function

  - by levy

  I'm not a Haskell programmer, but I'm curious about the following questions. Informal function specification: Let MapProduct be a function that takes a function called F and multiple lists. It returns a list containing the results of calling F with one argument from each list in each possible combination. Example: Call MapProduct with F being a function that simply returns a list of its arguments, and two lists. One of the lists contains the integers 1 and 2, the other one contains the strings "a" and "b". It should return a list that contains the lists: 1 and "a", 1 and "b", 2 and "a", 2 and "b". Questions: How is MapProduct implemented? What is the function's type? What is F's type? Can one guess what the function does just by looking at its type? Can you handle inhomogeneous lists as input? (e.g. 1 and "a" in one of the input lists) What extra limitation (if any) do you need to introduce to implement MapProduct?

  Read the article

• Google App engine Url Mapping using WSGIAppl and regx grouping Help Needed

  - by spidee

  Hi take this example from google docs class BrowseHandler(webapp.RequestHandler): > def get(self, category, product_id): > # Display product with given ID in the given category. > > > # Map URLs like /browse/(category)/(product_id) to > BrowseHandler. application = > webapp.WSGIApplication([(r'/browse/(.*)/(.*)', > BrowseHandler) > ], > debug=True) > > def main(): > run_wsgi_app(application) > > if __name__ == '__main__': > main() How can i change the regx groupings so that Product id is optional ie the url http://yourdomain.com/category will be sent to the browse handler in the current above example you must add a product id or at least the / after the category ie http://yourdomain.com/category/ r'/browse/(.)/(.)' Any ideas?

  Read the article

• Can I write a .NETCF Partial Class to extend System.Windows.Forms.UserControl?

  - by eidylon

  Okay... I'm writing a .NET CF (VBNET 2008 3.5 SP1) application, which has one master form, and it dynamically loads specific UserControls based on menu click, in a sort of framework idea. There are certain methods and properties these controls all need to work within the app. Right now I am doing this as an Interface, but this is aggravating as all get up, because some of the methods are optional, and yet I MUST implement them by the nature of interfaces. I would prefer to use inheritance, so that I can have certain code be inherited with overridability, but if I write a class which inherits System.Windows.Forms.UserControl and then inherit my control from that, it squiggles, and tells me that UserControls MUST inherit directly from System.Windows.Forms.UserControl. (Talk about a design flaw!) So next I thought, well, let me use a partial class to extend System.Windows.Forms.UserControl, but when I do that, even though it all seems to compile fine, none of my new properties/methods show up on my controls. Is there any way I can use partial classes to 'extend' System.Windows.Forms.UserControl? For example, can anyone give me a code sample of a partial class which simply adds a MyCount As Integer readonly property to the System.Windows.Forms.UserControl class? If I can just see how to get this going, I can take it from there and add the rest of my functionality. Thanks in advance! I've been searching google, but can't find anything that seems to work for UserControl extension on .NET CF. And the Interface method is driving me crazy as even a small change means updating ALL the controls whether they need to 'override' the method or not.

  Read the article

• Problem updating collection using JPA

  - by FarmBoy

  I have an entity class Foo foo that contains Collection<Bar> bars. I've tried a variety of ways, but I'm unable to successfully update my collection. One attempt: foo = em.find(key); foo.getBars().clear(); foo.setBars(bars); em.flush; \\ commit, etc. This appends the new collection to the old one. Another attempt: foo = em.find(key); bars = foo.getBars(); for (Bar bar : bars) { em.remove(bar); } em.flush; At this point, I thought I could add the new collection, but I find that the entity foo has been wiped out. Here are some annotations. In Foo: @OneToMany(cascade = { CascadeType.ALL }, mappedBy = "foo") private List<Bar> bars; In Bar: @ManyToOne(optional = false, cascade = { CascadeType.ALL }) @JoinColumn(name = "FOO_ID") private Foo foo; Has anyone else had trouble with this? Any ideas?

  Read the article

• Thread mutex behaviour

  - by Alberteddu

  Hi there, I'm learning C. I'm writing an application with multiple threads; I know that when a variable is shared between two or more threads, it is better to lock/unlock using a mutex to avoid deadlock and inconsistency of variables. This is very clear when I want to change or view one variable. int i = 0; /** Global */ static pthread_mutex_t mutex = PTHREAD_MUTEX_INITIALIZER; /** Thread 1. */ pthread_mutex_lock(&mutex); i++; pthread_mutex_unlock(&mutex); /** Thread 2. */ pthread_mutex_lock(&mutex); i++; pthread_mutex_unlock(&mutex); This is correct, I think. The variable i, at the end of the executions, contains the integer 2. Anyway, there are some situations in which I don't know exactly where to put the two function calls. For example, suppose you have a function obtain(), which returns a global variable. I need to call that function from within the two threads. I have also two other threads that call the function set(), defined with a few arguments; this function will set the same global variable. The two functions are necessary when you need to do something before getting/setting the var. /** (0) */ /** Thread 1, or 2, or 3... */ if(obtain() == something) { if(obtain() == somethingElse) { // Do this, sometimes obtain() and sometimes set(random number) (1) } else { // Do that, just obtain(). (2) } } else { // Do this and do that (3) // If # of thread * 3 > 10, then set(3*10) For example. (4) } /** (5) */ Where I have to lock, and where I have to unlock? The situation can be, I think, even more complex. I will appreciate an exhaustive answer. Thank you in advance. —Alberto

  Read the article

• Compile C++ in Visual Studio

  - by Kasun

  Hi All.. I use this method to compile C++ file in VS. But even i provide the correct file it returns false. Can any one help me... This is class called CL class CL { private const string clexe = @"cl.exe"; private const string exe = "Test.exe", file = "test.cpp"; private string args; public CL(String[] args) { this.args = String.Join(" ", args); this.args += (args.Length > 0 ? " " : "") + "/Fe" + exe + " " + file; } public Boolean Compile(String content, ref string errors) { if (File.Exists(exe)) File.Delete(exe); if (File.Exists(file)) File.Delete(file); File.WriteAllText(file, content); Process proc = new Process(); proc.StartInfo.UseShellExecute = false; proc.StartInfo.RedirectStandardOutput = true; proc.StartInfo.RedirectStandardError = true; proc.StartInfo.FileName = clexe; proc.StartInfo.Arguments = this.args; proc.StartInfo.CreateNoWindow = true; proc.Start(); //errors += proc.StandardError.ReadToEnd(); errors += proc.StandardOutput.ReadToEnd(); proc.WaitForExit(); bool success = File.Exists(exe); return success; } } This is my button click event private void button1_Click(object sender, EventArgs e) { string content = "#include <stdio.h>\nmain(){\nprintf(\"Hello world\");\n}\n"; string errors = ""; CL k = new CL(new string[] { }); if (k.Compile(content, ref errors)) Console.WriteLine("Success!"); else MessageBox.Show("Errors are : ", errors); }

  Read the article

• Regular Expressions .NET

  - by Fosa

  I need a regular expression for some arguments that must match on a string. here it is... The string exists out of minimum 8 en maximum 20 characters. These characters of this string may be characters of the alfabet or special chars --With other words..all charachters except from the whitespaces In the complete string there must be atleast 1 number. The string cannot start with a number or an underscore The last 2 characters of the string must be identical, But it doenst matter if those last --identical characters are capital or non-capital (case insensitive) Must match all : +234567899 a_1de*Gg xy1Me*__ !41deF_hij2lMnopq3ss C234567890123$^67800 *5555555 sDF564zer"" !!!!!!!!!4!!!!!!!!!! abcdefghijklmnopq9ss May not match : Cannot be less then 8 or more then 20 chars: a_1+Eff B41def_hIJ2lmnopq3stt Cannot contain a whitespace: A_4 e*gg b41def_Hij2l nopq3ss Cannot start with a number or an underscore: __1+Eff 841DEf_hij2lmnopq3stt cannot end on 2 diffrent characters: a_1+eFg b41DEf_hij2lmnopq3st Cannot be without a number in the string: abCDefghijklmnopqrss abcdef+++dF !!!!!!!!!!!!!!!!!!!! ------------------------------------------------------ This is what I have so far...But I'm really breaking my head on this... If you Don't know the answer completely it's not a problem... I just want to get in the right direction ([^0-9_])(?=.*\d)(\S{8,20})(?i:[\S])\1

  Read the article

• Best way to use Google's hosted jQuery, but fall back to my hosted library on Google fail

  - by Nosredna

  What would be a good way to attempt to load the hosted jQuery at Google (or other Google hosted libs), but load my copy of jQuery if the Google attempt fails? I'm not saying Google is flaky. There are cases where the Google copy is blocked (apparently in Iran, for instance). Would I set up a timer and check for the jQuery object? What would be the danger of both copies coming through? Not really looking for answers like "just use the Google one" or "just use your own." I understand those arguments. I also understand that the user is likely to have the Google version cached. I'm thinking about fallbacks for the cloud in general. Edit: This part added... Since Google suggests using google.load to load the ajax libraries, and it performs a callback when done, I'm wondering if that's the key to serializing this problem. I know it sounds a bit crazy. I'm just trying to figure out if it can be done in a reliable way or not. Update: jQuery now hosted on Microsoft's CDN. http://www.asp.net/ajax/cdn/

  Read the article

• Error while sending mail (attachment file)

  - by Surya sasidhar

  hi, in my application i am using to send mail with attachments i write the code like this Using System.Net.Mail; MailMessage mail = new MailMessage(); mail.Body = "<html><body><b> Name Of The Job Seeker: " + txtName.Text + "<br><br>" + "The Mail ID:" + txtEmail.Text + "<br><br>" + " The Mobile Number: " + txtmobile.Text + "<br><br>" + "Position For Applied: " + txtPostionAppl.Text + "<br><br>" + "Description " + txtdescript.Text + "<br><br></b></body></html>"; mail.From = new MailAddress ( txtEmail.Text); mail.To .Add (new MailAddress ( mailid)); mail.Priority = MailPriority.High; FileUpload1.PostedFile.SaveAs("~/Resume/" + FileUpload1.FileName); mail.Attachments.Add(filenme); SmtpMail sm = new SmtpMail(); sm.Send(mail); it is giving error at attachment like mail.Attachemts.Add(filena) like this 'System.Collections.ObjectModel.Collection.Add(System.Net.Mail.Attachment)' has some invalid arguments.

  Read the article

• Better language or checking tool?

  - by rwallace

  This is primarily aimed at programmers who use unmanaged languages like C and C++ in preference to managed languages, forgoing some forms of error checking to obtain benefits like the ability to work in extremely resource constrained systems or the last increment of performance, though I would also be interested in answers from those who use managed languages. Which of the following would be of most value? A language that would optionally compile to CLR byte code or to machine code via C, and would provide things like optional array bounds checking, more support for memory management in environments where you can't use garbage collection, and faster compile times than typical C++ projects. (Think e.g. Ada or Eiffel with Python syntax.) A tool that would take existing C code and perform static analysis to look for things like potential null pointer dereferences and array overflows. (Think e.g. an open source equivalent to Coverity.) Something else I haven't thought of. Or put another way, when you're using C family languages, is the top of your wish list more expressiveness, better error checking or something else? The reason I'm asking is that I have a design and prototype parser for #1, and an outline design for #2, and I'm wondering which would be the better use of resources to work on after my current project is up and running; but I think the answers may be useful for other tools programmers also. (As usual with questions of this nature, if the answer you would give is already there, please upvote it.)

  Read the article

• Getting Started: Silverlight 4 Business Application

  - by Eric J.

  With the arrival of VS 2010 and Silverlight 4, I decided it's time to look into Silverlight and understand how to build a 3-Tier business application. After several hours of searching for and reading documentation and tutorials, I'm thoroughly confused (and that doesn't happen easily). Here are some specific points I don't understand. I welcome guidance on any of them, and also would appreciate any references to a really good tutorial. Brad Abrahm's What is a .NET RIA services (written for Silverlight 3) seemed very promising, until I realized I don't have System.Web.Ria.dll on my system. Am I missing an optional download? Was this rolled into another DLL for Silverlight 4? Did this go away in favor of something else in Silverlight 4? This recent blog says to start from a Silverlight Business Application, remove unwanted stuff, create a WCF RIA services Class Library project, and copy files and references from the Business Application to the WCF RIA services project, while manually updating resource references (perhaps bug in B2 compiler). Is this really the right road to go down? It seems very clumsy. My requirements are to perform very simple CRUD on straightforward business objects. I'm looking forward to suggestions on how to do that the Silverlight 4 way.

  Read the article

• a way to use log4j pass values like java -DmyEnvVar=A_VALUE to my code

  - by raticulin

  I need to pass some value to enable certain code in may app (in this case is to optionally enable writing some stats to a file in certain conditions, but it might be anything generally). My java app is installed as a service. So every way I have thought of has some drawbacks: Add another param to main(): cumbersome as customers already have the tool installed, and the command line would need to be changed every time. Adding java -DmyEnvVar=A_VALUE to my command line: same as above. Set an environment variable: service should at least be restarted, and even then you must take care of what user is the service running under etc. Adding the property in the config file: I prefer not to have this visible on the config file so the user does not see it, it is something for debugging etc. So I thought maybe there is some way (or hack) to use log4j loggers to pass that value to my code. I have thought of one way already, although is very limited: Add a dummy class to my codebase com.dummy.DevOptions public class DevOptions { public static final Logger logger = Logger.getLogger(DevOptions.class); In my code, use it like this: if (DevOptions.logger.isInfoEnabled()){ //do my optional stuff } //... if (DevOptions.logger.isDebugEnabled()){ //do other stuff } This allows me to use discriminate among various values, and I could increase the number by adding more loggers to DevOptions. But I wonder whether there is a cleaner way, possibly by configuring the loggers only in log4j.xml??

  Read the article

< Previous Page | 169 170 171 172 173 174 175 176 177 178 179 180  | Next Page >