Search Results

Search found 30270 results on 1211 pages for 'bart read'.

Page 178/1211 | < Previous Page | 174 175 176 177 178 179 180 181 182 183 184 185  | Next Page >

  • Reading Excel files from C#

    - by dbkk
    Is there a free or open source library to read Excel files (.xls) directly from a C# program? It does not need to be too fancy, just to select a worksheet and read the data as strings. So far, I've been using Export to Unicode text function of Excel, and parsing the resulting (tab-delimited) file, but I'd like to eliminate the manual step.

    Read the article

  • How to obtain the first cluster of the directory's data in FAT using C# (or at least C++) and Win32A

    - by DarkWalker
    So I have a FAT drive, lets say H: and a directory 'work' (full path 'H:\work'). I need to get the NUMBER of the first cluster of that directory. The number of the first cluster is 2-bytes value, that is stored in the 26th and 27th bytes of the folder enty (wich is 32 bytes). Lets say I am doing it with file, NOT a directory. I can use code like this: static public string GetDirectoryPtr(string dir) { IntPtr ptr = CreateFile(@"H:\Work\dover.docx", GENERIC_READ, FILE_SHARE_READ | FILE_SHARE_WRITE, IntPtr.Zero, OPEN_EXISTING, 0,//FILE_FLAG_BACKUP_SEMANTICS, IntPtr.Zero); try { const uint bytesToRead = 2; byte[] readbuffer = new byte[bytesToRead]; if (ptr.ToInt32() == -1) return String.Format("Error: cannot open direcotory {0}", dir); if (SetFilePointer(ptr, 26, 0, 0) == -1) return String.Format("Error: unable to set file pointer on file {0}", ptr); uint read = 0; // real count of read bytes if (!ReadFile(ptr, readbuffer, bytesToRead, out read, 0)) return String.Format("cant read from file {0}. Error #{1}", ptr, Marshal.GetLastWin32Error()); int result = readbuffer[0] + 16 * 16 * readbuffer[1]; return result.ToString();//ASCIIEncoding.ASCII.GetString(readbuffer); } finally { CloseHandle(ptr); } } And it will return some number, like 19 (quite real to me, this is the only file on the disk). But I DONT need a file, I need a folder. So I am puttin FILE_FLAG_BACKUP_SEMANTICS param for CreateFile call... and dont know what to do next =) msdn is very clear on this issue http://msdn.microsoft.com/en-us/library/aa365258(v=VS.85).aspx It sounds to me like: "There is no way you can get a number of the folder's first cluster". The most desperate thing is that my tutor said smth like "You are going to obtain this or you wont pass this course". The true reason why he is so sure this is possible is because for 10 years (or may be more) he recieved the folder's first cluster number as a HASH of the folder's addres (and I was stupid enough to point this to him, so now I cant do it the same way) PS: This is the most spupid task I have ever had!!! This value is not really used anythere in program, it is only fcking pointless integer.

    Read the article

  • Delete System Files containing string

    - by Fuzz Evans
    I am trying to write a batch file that will examine a given directory, read each file for a given string "Example" and then delete any files that contain the string. The files are also System Files so I don't know what the exact extension is or if that matters (maybe you can just omit a file type filter and have it read all files?). Some of the files will be locked from reading as well so it needs to handle access denial errors if that occurs, not sure how batch files handle that.

    Read the article

  • How do you determine an acceptable response time for App Engine DB requests?

    - by qiq
    According to this discussion of Google App Engine on Hacker News, A DB (read) request takes over 100ms on the datastore. That's insane and unusable for about 90% of applications. How do you determine what is an acceptable response time for a DB read request? I have been using App Engine without noticing any issues with DB responsiveness. But, on the other hand, I'm not sure I would even know what to look for in that regard :)

    Read the article

  • Reading Excel Named Ranges by OLEDB hangs when the source file is open

    - by Sathish
    I am trying to read the Excel Named range using OLEDB using the below code "Select * from [MyNamedRange1]" everything works fine only when the source excel sheet is not opened if it is open then i am not able to read the range names using OLEDB it simply hangs Where as i am able to execute the query "Select * from [Sheet1$]" even if the workbook is open or closed... Any work arounds for reading the range by OLEDB only i dont want to go for interop... I have too many ranges defined in the excel file

    Read the article

  • What if I change my Android App price to free and after i change idea?

    - by Skatephone
    Hi, i have read on the market support that "If you have previously published an application for free, you cannot change it to have a price." But I was wondering, if at the contrary I change my app from payed to free and some time after i want to re change it from free to payed! Can I? And if yes, Have I to wait some period (I have read something like this in the contract)? Tnk's Valerio From Italy

    Read the article

  • ReadFile doesn't work asynchronously on Win7 and Win2k8

    - by f0b0s
    According to MSDN ReadFile can read data 2 different ways: synchronously and asynchronously. I need the second one. The folowing code demonstrates usage with OVERLAPPED struct: #include <windows.h> #include <stdio.h> #include <time.h> void Read() { HANDLE hFile = CreateFileA("c:\\1.avi", GENERIC_READ, 0, NULL, OPEN_EXISTING, FILE_FLAG_OVERLAPPED, NULL); if ( hFile == INVALID_HANDLE_VALUE ) { printf("Failed to open the file\n"); return; } int dataSize = 256 * 1024 * 1024; char* data = (char*)malloc(dataSize); memset(data, 0xFF, dataSize); OVERLAPPED overlapped; memset(&overlapped, 0, sizeof(overlapped)); printf("reading: %d\n", time(NULL)); BOOL result = ReadFile(hFile, data, dataSize, NULL, &overlapped); printf("sent: %d\n", time(NULL)); DWORD bytesRead; result = GetOverlappedResult(hFile, &overlapped, &bytesRead, TRUE); // wait until completion - returns immediately printf("done: %d\n", time(NULL)); CloseHandle(hFile); } int main() { Read(); } On Windows XP output is: reading: 1296651896 sent: 1296651896 done: 1296651899 It means that ReadFile didn't block and returned imediatly at the same second, whereas reading process continued for 3 seconds. It is normal async reading. But on windows 7 and windows 2008 I get following results: reading: 1296661205 sent: 1296661209 done: 1296661209. It is a behavior of sync reading. MSDN says that async ReadFile sometimes can behave as sync (when the file is compressed or encrypted for example). But the return value in this situation should be TRUE and GetLastError() == NO_ERROR. On Windows 7 I get FALSE and GetLastError() == ERROR_IO_PENDING. So WinApi tells me that it is an async call, but when I look at the test I see that it is not! I'm not the only one who found this "bug": read the comment on ReadFile MSDN page. So what's the solution? Does anybody know? It is been 14 months after Denis found this strange behavior.

    Read the article

  • Basic shared memory program in C

    - by nicopuri
    Hi, I want to make a basic chat application in C using Shared memory. I am working in Linux. The application consist in writing the client and the server can read, and if the server write the client can read the message. I tried to do this, but I can't achieve the communication between client and server. The code is the following: Server.c int main(int argc, char **argv) { char *msg; static char buf[SIZE]; int n; msg = getmem(); memset(msg, 0, SIZE); initmutex(); while ( true ) { if( (n = read(0, buf, sizeof buf)) 0 ) { enter(); sprintf(msg, "%.*s", n, buf); printf("Servidor escribe: %s", msg); leave(); }else{ enter(); if ( strcmp(buf, msg) ) { printf("Servidor lee: %s", msg); strcpy(buf, msg); } leave(); sleep(1); } } return 0; } Client.c int main(int argc, char **argv) { char *msg; static char buf[SIZE-1]; int n; msg = getmem(); initmutex(); while(true) { if ( (n = read(0, buf, sizeof buf)) 0 ) { enter(); sprintf(msg, "%.*s", n, buf); printf("Cliente escribe: %s", msg); leave(); }else{ enter(); if ( strcmp(buf, msg) ) { printf("Cliente lee: %s", msg); strcpy(buf, msg); } leave(); sleep(1); } } printf("Cliente termina\n"); return 0; } The shared memory module is the folowing: #include "common.h" void fatal(char *s) { perror(s); exit(1); } char * getmem(void) { int fd; char *mem; if ( (fd = shm_open("/message", O_RDWR|O_CREAT, 0666)) == -1 ) fatal("sh_open"); ftruncate(fd, SIZE); if ( !(mem = mmap(NULL, SIZE, PROT_READ|PROT_WRITE, MAP_SHARED, fd, 0)) ) fatal("mmap"); close(fd); return mem; } static sem_t *sd; void initmutex(void) { if ( !(sd = sem_open("/mutex", O_RDWR|O_CREAT, 0666, 1)) ) fatal("sem_open"); } void enter(void) { sem_wait(sd); } void leave(void) { sem_post(sd); }

    Read the article

  • problem with Double and Rational Number

    - by altair211
    Hi, I am writing a function in which I need to read a string contains floating point number and turn it back to Rational. But When I do toRational (read input :: Double), it will not turn for eg: 0.9 into 9 % 10 as expected, but instead 81..... % 9007... Thx

    Read the article

  • What does Error 3112 indicate when compacting an MDB file?

    - by Craig Johnston
    What does Error 3112 indicate when compacting an MDB file? The Error description is "Records can't be read; no read permission on 'xyz123.mdb'" There is a known issue with the Compact function on some versions of Access MDBs. Is the solution in this case to run the Microsoft utility JETCOMP.EXE on this file? What are the other possible causes of this error?

    Read the article

  • OleDB Jet - Float issues in reading excel data

    - by Patrick
    When I read a sheet into a DataTable using the OleDbDataReader, floating point numbers loose their precision. I tried forcing OleDb to read the excel data as string, but although the data is now contained in a DataRow with each Column defined as System.String it looses precision (18.125 - 18.124962832). Any idea how to avoid this behaviour?

    Read the article

  • Problem with reading data from plist iphone sdk

    - by neha
    Hi all, I'm creating a myDb.plist file in my resources folder and trying to read it, but it's not getting read. I'm using the following code. NSString* plistPath = [[NSBundle mainBundle] pathForResource:@"myDb" ofType:@"plist"]; contentArray = [NSArray arrayWithContentsOfFile:plistPath]; contentArray is showing null. Can anybody please help me? Thanx in advance.

    Read the article

  • Flash caroussel xml parse html link

    - by Marvin
    Hello I am trying to modify a carousel script I have in flash. Its normal function is making some icons rotate and when clicked they zoom in, fade all others and display a little text. On that text I would like to have a link like a "read more". If I use CDATA it wont display a thing, if I use alt char like &#60;a href=&#34;www.google.com&#34;&#62; Read more + &#60;/a&#62; It just displays the text as: <a href="www.google.com"> Read more + </a>. The flash dynamic text box wont render it as html. I dont enough as2 to figure out how to add this. My code: var xml:XML = new XML(); xml.ignoreWhite = true; //definições do xml xml.onLoad = function() { var nodes = this.firstChild.childNodes; numOfItems = nodes.length; for(var i=0;i<numOfItems;i++) { var t = home.attachMovie("item","item"+i,i+1); t.angle = i * ((Math.PI*2)/numOfItems); t.onEnterFrame = mover; t.toolText = nodes[i].attributes.tooltip; t.content = nodes[i].attributes.content; t.icon.inner.loadMovie(nodes[i].attributes.image); t.r.inner.loadMovie(nodes[i].attributes.image); t.icon.onRollOver = over; t.icon.onRollOut = out; t.icon.onRelease = released; } } And the xml: <?xml version="1.0" encoding="UTF-8"?> <icons> <icon image="images/product.swf" tooltip="Product" content="Hello this is some random text &#60;a href=&#34;www.google.com&#34;&#62; Read More + &#60;/a&#62; "/> </icons> Any suggestions? Thanks.

    Read the article

  • Outlook Crashes with Event ID 1000

    - by Deepak N
    We deployed a VSTO addin for outlook 2003. After installing the addin one of the user's outlook crashes when a contact is opened, i.e, when ItemProperties of the contact are read.Some theses properties are read using MAPI.There is no exception being logged even though we have try/catch and logging in all methods. The event log has following message The description for Event ID 1000 from source Microsoft Office 11 cannot be found Source : Microsoft Office 11 The following information was included with the event: outlook.exe 11.0.8312.0 4a403990 msvcr80.dll 8.0.50727.3053 4889d619 0 0001500a

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • How to set/get Gtk "Style Properties".

    - by PP
    How to set gtk "Style Properties" listed in gtk documentation? like for GtkWidget there are Style Properties: "separator-height" gint : Read "separator-width" gint : Read So how to get and set them? using GTK+ and C. Thanks, PP.

    Read the article

  • How can i interpret a time value in ascii into a numerical value?

    - by Bilal
    I have a file which is as follows: 15:03:21 II 0.88 0.64 15:03:31 II 0.88 0.64 15:03:42 II 0.40 0.40 etc. after loading the file in matlab, I want to be able to read the first column (which corresponds to time) and interpret them as numerical values. At the moment, they are interpreted as a string of ascii characters and i can't perform any mathematical operations on them. Does anyone have any suggestions as to how i can read the time as numbers instead of a string of ascii characters?

    Read the article

  • Ship maritime AIS information API

    - by James Cadd
    Is there an API or Web Service that can be used to read AIS data? Most links I read starting at Wikipedia (http://en.wikipedia.org/wiki/Automatic_Identification_System) say that AIS data is freely available but I'm having a hard time finding a provider of the data. A C# example or language agnostic web service would be helpful.

    Read the article

  • im writing a spellchecking program, how do i replace ch in a string..eg..

    - by Ajay Hopkins
    what am i doing wrong/what can i do?? import sys import string def remove(file): punctuation = string.punctuation for ch in file: if len(ch) > 1: print('error - ch is larger than 1 --| {0} |--'.format(ch)) if ch in punctuation: ch = ' ' return ch else: return ch ref = (open("ref.txt","r")) test_file = (open("test.txt", "r")) dictionary = ref.read().split() file = test_file.read().lower() file = remove(file) print(file) p.s, this is in Python 3.1.2

    Read the article

  • Easy way to convert a string of 0's and 1's into a character? Plain C

    - by Nick
    I'm doing a steganography project where I read in bytes from a ppm file and add the least significant bit to an array. So once 8 bytes are read in, I would have 8 bits in my array, which should equal some character in a hidden message. Is there an easy way to convert an array of 0's and 1's into an ascii value? For example, the array: char bits[] = "0,1,1,1,0,1,0,0" would equal 't'. Plain C

    Read the article

  • MFC: Reading entire file to buffer...

    - by deostroll
    I've meddled with some code but I am unable to read the entire file properly...a lot of junk gets appended to the output. How do I fix this? // wmfParser.cpp : Defines the entry point for the console application. // #include "stdafx.h" #include "wmfParser.h" #include <cstring> #ifdef _DEBUG #define new DEBUG_NEW #endif // The one and only application object CWinApp theApp; using namespace std; int _tmain(int argc, TCHAR* argv[], TCHAR* envp[]) { int nRetCode = 0; // initialize MFC and print and error on failure if (!AfxWinInit(::GetModuleHandle(NULL), NULL, ::GetCommandLine(), 0)) { // TODO: change error code to suit your needs _tprintf(_T("Fatal Error: MFC initialization failed\n")); nRetCode = 1; } else { // TODO: code your application's behavior here. CFile file; CFileException exp; if( !file.Open( _T("c:\\sample.txt"), CFile::modeRead, &exp ) ){ exp.ReportError(); cout<<'\n'; cout<<"Aborting..."; system("pause"); return 0; } ULONGLONG dwLength = file.GetLength(); cout<<"Length of file to read = " << dwLength << '\n'; /* BYTE* buffer; buffer=(BYTE*)calloc(dwLength, sizeof(BYTE)); file.Read(buffer, 25); char* str = (char*)buffer; cout<<"length of string : " << strlen(str) << '\n'; cout<<"string from file: " << str << '\n'; */ char str[100]; file.Read(str, sizeof(str)); cout << "Data : " << str <<'\n'; file.Close(); cout<<"File was closed\n"; //AfxMessageBox(_T("This is a test message box")); system("pause"); } return nRetCode; }

    Read the article

  • How to prevent arbitrary code execution vulnerability in our programs?

    - by Calmarius
    You always read in changelogs when your system or browser or any program updates that they fixed a bug that made possible that an attacker can execute any code in your computer with a forged website, or attacking your computer with carefully forged packets, etc... Because you read it so often that means any program can have similar vulnerabilites... What causes this? how to design our programs to prevent similar issues?

    Read the article

< Previous Page | 174 175 176 177 178 179 180 181 182 183 184 185  | Next Page >