Search Results

Search found 34110 results on 1365 pages for 'gdata python client'.

Page 178/1365 | < Previous Page | 174 175 176 177 178 179 180 181 182 183 184 185  | Next Page >

  • Python: How best to parse a simple grammar?

    - by Rosarch
    Ok, so I've asked a bunch of smaller questions about this project, but I still don't have much confidence in the designs I'm coming up with, so I'm going to ask a question on a broader scale. I am parsing pre-requisite descriptions for a course catalog. The descriptions almost always follow a certain form, which makes me think I can parse most of them. From the text, I would like to generate a graph of course pre-requisite relationships. (That part will be easy, after I have parsed the data.) Some sample inputs and outputs: "CS 2110" => ("CS", 2110) # 0 "CS 2110 and INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, 3300, 3140" => [("CS", 2110), ("CS", 3300), ("CS", 3140)] # 1 "CS 2110 or INFO 3300" => [[("CS", 2110)], [("INFO", 3300)]] # 2 "MATH 2210, 2230, 2310, or 2940" => [[("MATH", 2210), ("MATH", 2230), ("MATH", 2310)], [("MATH", 2940)]] # 3 If the entire description is just a course, it is output directly. If the courses are conjoined ("and"), they are all output in the same list If the course are disjoined ("or"), they are in separate lists Here, we have both "and" and "or". One caveat that makes it easier: it appears that the nesting of "and"/"or" phrases is never greater than as shown in example 3. What is the best way to do this? I started with PLY, but I couldn't figure out how to resolve the reduce/reduce conflicts. The advantage of PLY is that it's easy to manipulate what each parse rule generates: def p_course(p): 'course : DEPT_CODE COURSE_NUMBER' p[0] = (p[1], int(p[2])) With PyParse, it's less clear how to modify the output of parseString(). I was considering building upon @Alex Martelli's idea of keeping state in an object and building up the output from that, but I'm not sure exactly how that is best done. def addCourse(self, str, location, tokens): self.result.append((tokens[0][0], tokens[0][1])) def makeCourseList(self, str, location, tokens): dept = tokens[0][0] new_tokens = [(dept, tokens[0][1])] new_tokens.extend((dept, tok) for tok in tokens[1:]) self.result.append(new_tokens) For instance, to handle "or" cases: def __init__(self): self.result = [] # ... self.statement = (course_data + Optional(OR_CONJ + course_data)).setParseAction(self.disjunctionCourses) def disjunctionCourses(self, str, location, tokens): if len(tokens) == 1: return tokens print "disjunction tokens: %s" % tokens How does disjunctionCourses() know which smaller phrases to disjoin? All it gets is tokens, but what's been parsed so far is stored in result, so how can the function tell which data in result corresponds to which elements of token? I guess I could search through the tokens, then find an element of result with the same data, but that feel convoluted... What's a better way to approach this problem?

    Read the article

  • tkinter python entry not being displayed

    - by user1050619
    I have created a Form with labels and entries..but for some reason the entries are not being created, peoplegui.py from tkinter import * from tkinter.messagebox import showerror import shelve shelvename = 'class-shelve' fieldnames = ('name','age','job','pay') def makewidgets(): global entries window = Tk() window.title('People Shelve') form = Frame(window) form.pack() entries = {} for (ix, label) in enumerate(('key',) + fieldnames): lab = Label(form, text=label) ent = Entry(form) lab.grid(row=ix, column=0) lab.grid(row=ix, column=1) entries[label] = ent Button(window, text="Fetch", command=fetchRecord).pack(side=LEFT) Button(window, text="Update", command=updateRecord).pack(side=LEFT) Button(window, text="Quit", command=window.quit).pack(side=RIGHT) return window def fetchRecord(): print('In fetch') def updateRecord(): print('In update') if __name__ == '__main__': window = makewidgets() window.mainloop() When I run it the labels are created but not the entries.

    Read the article

  • Find&Replace using Python - Binary file

    - by Aaron Hoffman
    Hello, I'm attempting to do a "find and replace" in a file on a Mac OS X computer. Although it appears to work correctly. It seems that the file is somehow altered. The text editor that I use (Text Wrangler) is unable to even open the file once this is completed. Here is the code as I have it: import fileinput for line in fileinput.FileInput("testfile.txt",inplace=1): line = line.replace("newhost",host) print line, When I view the file from the terminal, it does say "testfile" may be a binary file. See it anyway? Is there a chance that this replace is corrupting the file? Do I have another option for this to work? I really appreciate the help. Thank you, Aaron UPDATE: the actual file is NOT a .txt file it is a .plist file which is preference file in Mac OS X if that makes any difference

    Read the article

  • Copying 2D lists in python

    - by SuperString
    Hi I want to copy a 2D list, so that if I modify 1 list, the other is not modified. For 1 D list, I just do this: a = [1,2] b = a[:] And now if I modify b, a is not modified. But this doesn't work for 2D list: a = [[1,2],[3,4]] b = a[:] If I modify b, a gets modified as well. How do I fix this?

    Read the article

  • Python implementation of avro slow?

    - by lazy1
    I'm reading some data from avro file using the avro library. It takes about a minute to load 33K objects from the file. This seem very slow to me, specially with the Java version reading the same file in about 1sec. Here is the code, am I doing something wrong? import avro.datafile import avro.io from time import time def load(filename): fo = open(filename, "rb") reader = avro.datafile.DataFileReader(fo, avro.io.DatumReader()) for i, record in enumerate(reader): pass return i + 1 def main(argv=None): import sys from argparse import ArgumentParser argv = argv or sys.argv parser = ArgumentParser(description="Read avro file") start = time() num_records = load("events.avro") end = time() print("{0} records in {1} seconds".format(num_records, end - start)) if __name__ == "__main__": main()

    Read the article

  • Python for statement giving an Invalid Syntax error with list

    - by Cold Diamondz
    I have some code in which is throwing an error (I'm using repl.it) import random students = ['s1:0','s2:0','s3:0'] while True: print'\n'*50 print'Ticket Machine'.center(80) print'-'*80 print'1. Clear Student Ticket Values'.center(80) print'2. Draw Tickets'.center(80) menu = raw_input('-'*80+'\nChoose an Option: ') if menu == '1': print'\n'*50 print'CLEARED!' students = ['s1:0','s2:0','s3:0'] raw_input('Press enter to return to the main menu!') elif menu == '2': tickets = [] print'\n'*50 times = int(raw_input('How many tickets to draw? ') for a in students: for i in range(a.split(':')[1]): tickets.append(a.split(':')[0]) for b in range(1,times+1): print str(b) + '. ' + random.choice(tickets) else: print'\n'*50 print'That was not an option!' raw_input('Press enter to return to the main menu!') But it is throwing this error: File "<stdin>", line 19 for a in students: ^ SyntaxError: invalid syntax I am planning on using this in a class, but I can't use it until the bug is fixed, also, student names have been removed for privacy reasons.

    Read the article

  • how can i randomly print an element from a list in python

    - by lm
    So far i have this, which prints out every word in my list, but i am trying to print only one word at random. Any suggestions? def main(): # open a file wordsf = open('words.txt', 'r') word=random.choice('wordsf') words_count=0 for line in wordsf: word= line.rstrip('\n') print(word) words_count+=1 # close the file wordsf.close()

    Read the article

  • Python Tkinter after loop not working fast enough

    - by user2658538
    I am making a simple metronome where it plays a tick sound every few milliseconds depending on the bpm and plays the sound using the winsound module. I use tkinter because there will be a gui component later but for now the metronome code is working, it plays the sound at a constant rate, but even though I set the after loop to play the sound every few milliseconds, it waits longer and the beat is slower than it should be. Is it a problem with the code or a problem with the way I calculate the time? Thanks. Here is my code. from Tkinter import * import winsound,time,threading root=Tk() c=Canvas(root) c.pack() class metronome(): def __init__(self,root,canvas,tempo=100): self.root=root self.root.bind("<1>",self.stop) self.c=canvas self.thread=threading.Thread(target=self.play) self.thread.daemon=True self.pause=False self.tempo=tempo/60.0 self.tempo=1.0/self.tempo self.tempo*=1000 def play(self): winsound.PlaySound("tick.wav",winsound.SND_FILENAME) self.sound=self.c.after(int(self.tempo),self.play) def stop(self,e): self.c.after_cancel(self.sound) beat=metronome(root,c,120) beat.thread.start() root.mainloop()

    Read the article

  • Using the AND and NOT Operator in Python

    - by NoahClark
    Here is my custom class that I have that represents a triangle. I'm trying to write code that checks to see if self.a, self.b, and self.c are greater than 0, which would mean that I have Angle, Angle, Angle. Below you will see the code that checks for A and B, however when I use just self.a != 0 then it works fine. I believe I'm not using & correctly. Any ideas? Here is how I am calling it: print myTri.detType() class Triangle: # Angle A To Angle C Connects Side F # Angle C to Angle B Connects Side D # Angle B to Angle A Connects Side E def __init__(self, a, b, c, d, e, f): self.a = a self.b = b self.c = c self.d = d self.e = e self.f = f def detType(self): #Triangle Type AAA if self.a != 0 & self.b != 0: return self.a #If self.a > 10: #return AAA #Triangle Type AAS #elif self.a = 0: #return AAS #Triangle Type ASA #Triangle Type SAS #Triangle Type SSS #else: #return unknown

    Read the article

  • Python - calendar.timegm() vs. time.mktime()

    - by ibz
    I seem to have a hard time getting my head around this. What's the difference between calendar.timegm() and time.mktime()? Say I have a datetime.datetime with no tzinfo attached, shouldn't the two give the same output? Don't they both give the number of seconds between epoch and the date passed as a parameter? And since the date passed has no tzinfo, isn't that number of seconds the same? >>> import calendar >>> import time >>> import datetime >>> d = datetime.datetime(2010, 10, 10) >>> calendar.timegm(d.timetuple()) 1286668800 >>> time.mktime(d.timetuple()) 1286640000.0 >>>

    Read the article

  • Exposing boost::scoped_ptr in boost::python

    - by Rupert Jones
    Hello, I am getting a compile error, saying that the copy constructor of the scoped_ptr is private with the following code snippet: class a {}; struct s { boost::scoped_ptr<a> p; }; BOOST_PYTHON_MODULE( module ) { class_<s>( "s" ); } This example works with a shared_ptr though. It would be nice, if anyone knows the answer. Thanks

    Read the article

  • Python - pickling fails for numpy.void objects

    - by I82Much
    >>> idmapfile = open("idmap", mode="w") >>> pickle.dump(idMap, idmapfile) >>> idmapfile.close() >>> idmapfile = open("idmap") >>> unpickled = pickle.load(idmapfile) >>> unpickled == idMap False idMap[1] {1537: (552, 1, 1537, 17.793827056884766, 3), 1540: (4220, 1, 1540, 19.31205940246582, 3), 1544: (592, 1, 1544, 18.129131317138672, 3), 1675: (529, 1, 1675, 18.347782135009766, 3), 1550: (4048, 1, 1550, 19.31205940246582, 3), 1424: (1528, 1, 1424, 19.744396209716797, 3), 1681: (1265, 1, 1681, 19.596025466918945, 3), 1560: (3457, 1, 1560, 20.530569076538086, 3), 1690: (477, 1, 1690, 17.395542144775391, 3), 1691: (554, 1, 1691, 13.446117401123047, 3), 1436: (3010, 1, 1436, 19.596025466918945, 3), 1434: (3183, 1, 1434, 19.744396209716797, 3), 1441: (3570, 1, 1441, 20.589576721191406, 3), 1435: (476, 1, 1435, 19.640911102294922, 3), 1444: (527, 1, 1444, 17.98480224609375, 3), 1478: (1897, 1, 1478, 19.596025466918945, 3), 1575: (614, 1, 1575, 19.371648788452148, 3), 1586: (2189, 1, 1586, 19.31205940246582, 3), 1716: (3470, 1, 1716, 19.158674240112305, 3), 1590: (2278, 1, 1590, 19.596025466918945, 3), 1463: (991, 1, 1463, 19.31205940246582, 3), 1594: (1890, 1, 1594, 19.596025466918945, 3), 1467: (1087, 1, 1467, 19.31205940246582, 3), 1596: (3759, 1, 1596, 19.744396209716797, 3), 1602: (3011, 1, 1602, 20.530569076538086, 3), 1547: (490, 1, 1547, 17.994071960449219, 3), 1605: (658, 1, 1605, 19.31205940246582, 3), 1606: (1794, 1, 1606, 16.964881896972656, 3), 1719: (1826, 1, 1719, 19.596025466918945, 3), 1617: (583, 1, 1617, 11.894925117492676, 3), 1492: (3441, 1, 1492, 20.500667572021484, 3), 1622: (3215, 1, 1622, 19.31205940246582, 3), 1628: (2761, 1, 1628, 19.744396209716797, 3), 1502: (1563, 1, 1502, 19.596025466918945, 3), 1632: (1108, 1, 1632, 15.457141876220703, 3), 1468: (3779, 1, 1468, 19.596025466918945, 3), 1642: (3970, 1, 1642, 19.744396209716797, 3), 1518: (612, 1, 1518, 18.570245742797852, 3), 1647: (854, 1, 1647, 16.964881896972656, 3), 1650: (2099, 1, 1650, 20.439058303833008, 3), 1651: (540, 1, 1651, 18.552841186523438, 3), 1653: (613, 1, 1653, 19.237197875976563, 3), 1532: (537, 1, 1532, 18.885730743408203, 3)} >>> unpickled[1] {1537: (64880, 1638, 56700, -1.0808743559293829e+18, 152), 1540: (64904, 1638, 0, 0.0, 0), 1544: (54472, 1490, 0, 0.0, 0), 1675: (6464, 1509, 0, 0.0, 0), 1550: (43592, 1510, 0, 0.0, 0), 1424: (43616, 1510, 0, 0.0, 0), 1681: (0, 0, 0, 0.0, 0), 1560: (400, 152, 400, 2.1299736657737219e-43, 0), 1690: (408, 152, 408, 2.7201111331839077e+26, 34), 1435: (424, 152, 61512, 1.0122952080313192e-39, 0), 1436: (400, 152, 400, 20.250289916992188, 3), 1434: (424, 152, 62080, 1.0122952080313192e-39, 0), 1441: (400, 152, 400, 12.250144958496094, 3), 1691: (424, 152, 42608, 15.813941955566406, 3), 1444: (400, 152, 400, 19.625289916992187, 3), 1606: (424, 152, 42432, 5.2947192852601414e-22, 41), 1575: (400, 152, 400, 6.2537390010262572e-36, 0), 1586: (424, 152, 42488, 1.0122601755697111e-39, 0), 1716: (400, 152, 400, 6.2537390010262572e-36, 0), 1590: (424, 152, 64144, 1.0126357235581501e-39, 0), 1463: (400, 152, 400, 6.2537390010262572e-36, 0), 1594: (424, 152, 32672, 17.002994537353516, 3), 1467: (400, 152, 400, 19.750289916992187, 3), 1596: (424, 152, 7176, 1.0124003054161436e-39, 0), 1602: (400, 152, 400, 18.500289916992188, 3), 1547: (424, 152, 7000, 1.0124003054161436e-39, 0), 1605: (400, 152, 400, 20.500289916992188, 3), 1478: (424, 152, 42256, -6.0222748507426518e+30, 222), 1719: (400, 152, 400, 6.2537390010262572e-36, 0), 1617: (424, 152, 16472, 1.0124283313854301e-39, 0), 1492: (400, 152, 400, 6.2537390010262572e-36, 0), 1622: (424, 152, 35304, 1.0123190301052127e-39, 0), 1628: (400, 152, 400, 6.2537390010262572e-36, 0), 1502: (424, 152, 63152, 19.627988815307617, 3), 1632: (400, 152, 400, 19.375289916992188, 3), 1468: (424, 152, 38088, 1.0124213248931084e-39, 0), 1642: (400, 152, 400, 6.2537390010262572e-36, 0), 1518: (424, 152, 63896, 1.0127436235399031e-39, 0), 1647: (400, 152, 400, 6.2537390010262572e-36, 0), 1650: (424, 152, 53424, 16.752857208251953, 3), 1651: (400, 152, 400, 19.250289916992188, 3), 1653: (424, 152, 50624, 1.0126497365427934e-39, 0), 1532: (400, 152, 400, 6.2537390010262572e-36, 0)} The keys come out fine, the values are screwed up. I tried same thing loading file in binary mode; didn't fix the problem. Any idea what I'm doing wrong? Edit: Here's the code with binary. Note that the values are different in the unpickled object. >>> idmapfile = open("idmap", mode="wb") >>> pickle.dump(idMap, idmapfile) >>> idmapfile.close() >>> idmapfile = open("idmap", mode="rb") >>> unpickled = pickle.load(idmapfile) >>> unpickled==idMap False >>> unpickled[1] {1537: (12176, 2281, 56700, -1.0808743559293829e+18, 152), 1540: (0, 0, 15934, 2.7457842047810522e+26, 108), 1544: (400, 152, 400, 4.9518498821046956e+27, 53), 1675: (408, 152, 408, 2.7201111331839077e+26, 34), 1550: (456, 152, 456, -1.1349175514578289e+18, 152), 1424: (432, 152, 432, 4.5939047815653343e-40, 11), 1681: (408, 152, 408, 2.1299736657737219e-43, 0), 1560: (376, 152, 376, 2.1299736657737219e-43, 0), 1690: (376, 152, 376, 2.1299736657737219e-43, 0), 1435: (376, 152, 376, 2.1299736657737219e-43, 0), 1436: (376, 152, 376, 2.1299736657737219e-43, 0), 1434: (376, 152, 376, 2.1299736657737219e-43, 0), 1441: (376, 152, 376, 2.1299736657737219e-43, 0), 1691: (376, 152, 376, 2.1299736657737219e-43, 0), 1444: (376, 152, 376, 2.1299736657737219e-43, 0), 1606: (25784, 2281, 376, -3.2883343074537754e+26, 34), 1575: (24240, 2281, 376, 2.1299736657737219e-43, 0), 1586: (24240, 2281, 376, 2.1299736657737219e-43, 0), 1716: (24240, 2281, 376, -3.0093091599657311e-35, 26), 1590: (24240, 2281, 376, 2.1299736657737219e-43, 0), 1463: (24240, 2281, 376, 2.1299736657737219e-43, 0), 1594: (24240, 2281, 376, -4123208450048.0, 196), 1467: (25784, 2281, 376, 2.1299736657737219e-43, 0), 1596: (25784, 2281, 376, 2.1299736657737219e-43, 0), 1602: (25784, 2281, 376, -5.9963281433905448e+26, 76), 1547: (25784, 2281, 376, -218106240.0, 139), 1605: (25784, 2281, 376, -3.7138649803377281e+27, 56), 1478: (376, 152, 376, 2.1299736657737219e-43, 0), 1719: (25784, 2281, 376, 2.1299736657737219e-43, 0), 1617: (25784, 2281, 376, -1.4411779941597184e+17, 237), 1492: (25784, 2281, 376, 2.8596493694487798e-30, 80), 1622: (25784, 2281, 376, 184686084096.0, 93), 1628: (1336, 152, 1336, 3.1691839245470052e+29, 179), 1502: (1272, 152, 1272, -5.2042207205116645e-17, 99), 1632: (1208, 152, 1208, 2.1299736657737219e-43, 0), 1468: (1144, 152, 1144, 2.1299736657737219e-43, 0), 1642: (1080, 152, 1080, 2.1299736657737219e-43, 0), 1518: (1016, 152, 1016, 4.0240902787680023e+35, 145), 1647: (952, 152, 952, -985172619034624.0, 237), 1650: (888, 152, 888, 12094787289088.0, 66), 1651: (824, 152, 824, 2.1299736657737219e-43, 0), 1653: (760, 152, 760, 0.00018310768064111471, 238), 1532: (696, 152, 696, 8.8978061885676389e+26, 125)} OK I've isolated the problem, but don't know why it's so. First, apparently what I'm pickling are not tuples (though they look like it), but instead numpy.void types. Here is a series to illustrate the problem. first = run0.detections[0] >>> first (1, 19, 1578, 82.637763977050781, 1) >>> type(first) <type 'numpy.void'> >>> firstTuple = tuple(first) >>> theFile = open("pickleTest", "w") >>> pickle.dump(first, theFile) >>> theTupleFile = open("pickleTupleTest", "w") >>> pickle.dump(firstTuple, theTupleFile) >>> theFile.close() >>> theTupleFile.close() >>> first (1, 19, 1578, 82.637763977050781, 1) >>> firstTuple (1, 19, 1578, 82.637764, 1) >>> theFile = open("pickleTest", "r") >>> theTupleFile = open("pickleTupleTest", "r") >>> unpickledTuple = pickle.load(theTupleFile) >>> unpickledVoid = pickle.load(theFile) >>> type(unpickledVoid) <type 'numpy.void'> >>> type(unpickledTuple) <type 'tuple'> >>> unpickledTuple (1, 19, 1578, 82.637764, 1) >>> unpickledTuple == firstTuple True >>> unpickledVoid == first False >>> unpickledVoid (7936, 1705, 56700, -1.0808743559293829e+18, 152) >>> first (1, 19, 1578, 82.637763977050781, 1)

    Read the article

  • Python - werid behavior

    - by orokusaki
    I've done what I shouldn't have done and written 4 modules (6 hours or so) without running any tests along the way. I have a method inside of /mydir/__init__.py called get_hash(), and a class inside of /mydir/utils.py called SpamClass. /mydir/utils.py imports get_hash() from /mydir/__init__. /mydir/__init__.py imports SpamClass from /mydir/utils.py. Both the class and the method work fine on their own but for some reason if I try to import /mydir/, I get an import error saying "Cannot import name get_hash" from /mydir/__init__.py. The only stack trace is the line saying that __init__.py imported SpamClass. The next line is where the error occurs in in SpamClass when trying to import get_hash. Why is this?

    Read the article

  • Efficient way in Python to remove an element from a comma-separated string

    - by ensnare
    I'm looking for the most efficient way to add an element to a comma-separated string while maintaining alphabetical order for the words: For example: string = 'Apples, Bananas, Grapes, Oranges' subtraction = 'Bananas' result = 'Apples, Grapes, Oranges' Also, a way to do this but while maintaining IDs: string = '1:Apples, 4:Bananas, 6:Grapes, 23:Oranges' subtraction = '4:Bananas' result = '1:Apples, 6:Grapes, 23:Oranges' Sample code is greatly appreciated. Thank you so much.

    Read the article

  • Unique elements of list within list in python

    - by user2901061
    We are given a list of animals in different zoos and need to find which zoos have animals that are not in any others. The animals of each zoo are separated by spaces, and each zoo is originally separated by a comma. I am currently enumerating over all of the zoos to split each animal and create lists within lists for different zoos as such: for i, zoo in enumerate(zoos): zoos[i] = zoo.split() However, I then do not know how to tell and count how many of the zoos have unique animals. I figure it is something else with enumerate and possibly sets, but cannot get it down exactly. Any help is greatly appreciated. Thanks

    Read the article

  • [Tkinter/Python] Different line widths with canvas.create_line?

    - by Sam
    Does anyone have any idea why I get different line widths on the canvas in the following example? from Tkinter import * bigBoxSize = 150 class cFrame(Frame): def __init__(self, master, cwidth=450, cheight=450): Frame.__init__(self, master, relief=RAISED, height=550, width=600, bg = "grey") self.canvasWidth = cwidth self.canvasHeight = cheight self.canvas = Canvas(self, bg="white", width=cwidth, height=cheight, border =0) self.drawGridLines() self.canvas.pack(side=TOP, pady=20, padx=20) def drawGridLines(self, linewidth = 10): self.canvas.create_line(0, 0, self.canvasWidth, 0, width= linewidth ) self.canvas.create_line(0, 0, 0, self.canvasHeight, width= linewidth ) self.canvas.create_line(0, self.canvasHeight, self.canvasWidth + 2, self.canvasHeight, width= linewidth ) self.canvas.create_line(self.canvasWidth, self.canvasHeight, self.canvasWidth, 1, width= linewidth ) self.canvas.create_line(0, bigBoxSize, self.canvasWidth, bigBoxSize, width= linewidth ) self.canvas.create_line(0, bigBoxSize * 2, self.canvasWidth, bigBoxSize * 2, width= linewidth) root = Tk() C = cFrame(root) C.pack() root.mainloop() It's really frustrating me as I have no idea what's happening. If anyone can help me out then that'd be fantastic. Thanks!

    Read the article

  • Python RegExp exception

    - by Jasie
    How do I split on all nonalphanumeric characters, EXCEPT the apostrophe? re.split('\W+',text) works, but will also split on apostrophes. How do I add an exception to this rule? Thanks!

    Read the article

  • Python - Problems using mechanize to log into a difficult website

    - by user1781599
    × 139886 I am trying to log in to betfair.com by using mechanize. I have tried several ways but it always fail. This is the code I have developed so far, can anyone help me to identify what is wrong with it and how I can improve it to log into my betfair account? Thanks, import cookielib import urllib import urllib2 from BeautifulSoup import BeautifulSoup import mechanize from mechanize import Browser import re bf_username_name = "username" bf_password_name = "password" bf_form_name = "loginForm" bf_username = "xxxxx" bf_password = "yyyyy" urlLogIn = "http://www.betfair.com/" accountUrl = "https://myaccount.betfair.com/account/home?rlhm=0&" # This url I will use to verify if log in has been successful br = mechanize.Browser(factory=mechanize.RobustFactory()) br.addheaders = [("User-Agent","Mozilla/5.0 (Macintosh; Intel Mac OS X 10_5_8) AppleWebKit/537.1 (KHTML, like Gecko) Chrome/21.0.1180.90 Safari/537.1")] br.open(urlLogIn) br.select_form(nr=0) print br.form br.form[bf_username_name] = bf_username br.form[bf_password_name] = bf_password print br.form #just to check username and psw have been recorded correctly responseSubmit = br.submit() response = br.open(accountUrl) text_file = open("LogInResponse.html", "w") text_file.write(responseSubmit.read()) #this file should show the home page with me logged in, but it show home page as if I was not logged it text_file.close() text_file = open("Account.html", "w") text_file.write(response.read()) #this file should show my account page, but it should a pop up with an error text_file.close()

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • varargs in lambda functions in Python

    - by brain_damage
    Is it possible a lambda function to have variable number of arguments? For example, I want to write a metaclass, which creates a method for every method of some other class and this newly created method returns the opposite value of the original method and has the same number of arguments. And I want to do this with lambda function. How to pass the arguments? Is it possible? class Negate(type): def __new__(mcs, name, bases, _dict): extended_dict = _dict.copy() for (k, v) in _dict.items(): if hasattr(v, '__call__'): extended_dict["not_" + k] = lambda s, *args, **kw: not v(s, *args, **kw) return type.__new__(mcs, name, bases, extended_dict) class P(metaclass=Negate): def __init__(self, a): self.a = a def yes(self): return True def maybe(self, you_can_chose): return you_can_chose But the result is totally wrong: >>>p = P(0) >>>p.yes() True >>>p.not_yes() # should be False Traceback (most recent call last): File "<pyshell#150>", line 1, in <module> p.not_yes() File "C:\Users\Nona\Desktop\p10.py", line 51, in <lambda> extended_dict["not_" + k] = lambda s, *args, **kw: not v(s, *args, **kw) TypeError: __init__() takes exactly 2 positional arguments (1 given) >>>p.maybe(True) True >>>p.not_maybe(True) #should be False True

    Read the article

< Previous Page | 174 175 176 177 178 179 180 181 182 183 184 185  | Next Page >