Search Results

Search found 30316 results on 1213 pages for 'read the javadoc'.

Page 179/1213 | < Previous Page | 175 176 177 178 179 180 181 182 183 184 185 186  | Next Page >

  • How to set/get Gtk "Style Properties".

    - by PP
    How to set gtk "Style Properties" listed in gtk documentation? like for GtkWidget there are Style Properties: "separator-height" gint : Read "separator-width" gint : Read So how to get and set them? using GTK+ and C. Thanks, PP.

    Read the article

  • Easy way to convert a string of 0's and 1's into a character? Plain C

    - by Nick
    I'm doing a steganography project where I read in bytes from a ppm file and add the least significant bit to an array. So once 8 bytes are read in, I would have 8 bits in my array, which should equal some character in a hidden message. Is there an easy way to convert an array of 0's and 1's into an ascii value? For example, the array: char bits[] = "0,1,1,1,0,1,0,0" would equal 't'. Plain C

    Read the article

  • What does Error 3112 indicate when compacting an MDB file?

    - by Craig Johnston
    What does Error 3112 indicate when compacting an MDB file? The Error description is "Records can't be read; no read permission on 'xyz123.mdb'" There is a known issue with the Compact function on some versions of Access MDBs. Is the solution in this case to run the Microsoft utility JETCOMP.EXE on this file? What are the other possible causes of this error?

    Read the article

  • How to prevent arbitrary code execution vulnerability in our programs?

    - by Calmarius
    You always read in changelogs when your system or browser or any program updates that they fixed a bug that made possible that an attacker can execute any code in your computer with a forged website, or attacking your computer with carefully forged packets, etc... Because you read it so often that means any program can have similar vulnerabilites... What causes this? how to design our programs to prevent similar issues?

    Read the article

  • How can i interpret a time value in ascii into a numerical value?

    - by Bilal
    I have a file which is as follows: 15:03:21 II 0.88 0.64 15:03:31 II 0.88 0.64 15:03:42 II 0.40 0.40 etc. after loading the file in matlab, I want to be able to read the first column (which corresponds to time) and interpret them as numerical values. At the moment, they are interpreted as a string of ascii characters and i can't perform any mathematical operations on them. Does anyone have any suggestions as to how i can read the time as numbers instead of a string of ascii characters?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Delete System Files containing string

    - by Fuzz Evans
    I am trying to write a batch file that will examine a given directory, read each file for a given string "Example" and then delete any files that contain the string. The files are also System Files so I don't know what the exact extension is or if that matters (maybe you can just omit a file type filter and have it read all files?). Some of the files will be locked from reading as well so it needs to handle access denial errors if that occurs, not sure how batch files handle that.

    Read the article

  • MFC: Reading entire file to buffer...

    - by deostroll
    I've meddled with some code but I am unable to read the entire file properly...a lot of junk gets appended to the output. How do I fix this? // wmfParser.cpp : Defines the entry point for the console application. // #include "stdafx.h" #include "wmfParser.h" #include <cstring> #ifdef _DEBUG #define new DEBUG_NEW #endif // The one and only application object CWinApp theApp; using namespace std; int _tmain(int argc, TCHAR* argv[], TCHAR* envp[]) { int nRetCode = 0; // initialize MFC and print and error on failure if (!AfxWinInit(::GetModuleHandle(NULL), NULL, ::GetCommandLine(), 0)) { // TODO: change error code to suit your needs _tprintf(_T("Fatal Error: MFC initialization failed\n")); nRetCode = 1; } else { // TODO: code your application's behavior here. CFile file; CFileException exp; if( !file.Open( _T("c:\\sample.txt"), CFile::modeRead, &exp ) ){ exp.ReportError(); cout<<'\n'; cout<<"Aborting..."; system("pause"); return 0; } ULONGLONG dwLength = file.GetLength(); cout<<"Length of file to read = " << dwLength << '\n'; /* BYTE* buffer; buffer=(BYTE*)calloc(dwLength, sizeof(BYTE)); file.Read(buffer, 25); char* str = (char*)buffer; cout<<"length of string : " << strlen(str) << '\n'; cout<<"string from file: " << str << '\n'; */ char str[100]; file.Read(str, sizeof(str)); cout << "Data : " << str <<'\n'; file.Close(); cout<<"File was closed\n"; //AfxMessageBox(_T("This is a test message box")); system("pause"); } return nRetCode; }

    Read the article

  • Different cache concurrent strategies for root entity and its collection (Hibernate with EHCache)?

    - by grigory
    Given example from Hibernate docs and modifying it so that root level entity (Customer) is read-only while one of its collections (tickets) is read-write: @Entity @Cache(usage = CacheConcurrencyStrategy.READ_ONLY) public class Customer { ... @OneToMany(...) @Cache(usage = CacheConcurrencyStrategy.READ_WRITE) public SortedSet<Ticket> getTickets() { return tickets; } ... } Would collection of tickets get refreshed when accessing customer from cache?

    Read the article

  • dynamically scan pictures in a folder and display using jquery slideshow

    - by Nazmin
    guys, anyone know how to scan a folder using jquery or javascript code snippet, after that get a picture file name and embed in <li></li> or <div></div>, i've used php code to read through the folder and loop through the element to display the thumbnails and all, but it's not work well. I've try on galleria, gallerific, galleryView jquery slideshow plugin but those might not work well with php processing because of predefined configuration or something, can anyone tweak or hack these gallery to dynamically read an image from a folder?

    Read the article

  • im writing a spellchecking program, how do i replace ch in a string..eg..

    - by Ajay Hopkins
    what am i doing wrong/what can i do?? import sys import string def remove(file): punctuation = string.punctuation for ch in file: if len(ch) > 1: print('error - ch is larger than 1 --| {0} |--'.format(ch)) if ch in punctuation: ch = ' ' return ch else: return ch ref = (open("ref.txt","r")) test_file = (open("test.txt", "r")) dictionary = ref.read().split() file = test_file.read().lower() file = remove(file) print(file) p.s, this is in Python 3.1.2

    Read the article

  • How can i get the between cell addresses.

    - by Sathish
    I have a function which accepts fromRange and ToRange of an Excel cell. basically i want to read cell by cell values from the range. suppose if i pass E2 and E9 i want to read in a loop something like Range(E2).value, Range(E3).value and so on till E9 How can i get the between cell addresses. Please help

    Read the article

  • Ship maritime AIS information API

    - by James Cadd
    Is there an API or Web Service that can be used to read AIS data? Most links I read starting at Wikipedia (http://en.wikipedia.org/wiki/Automatic_Identification_System) say that AIS data is freely available but I'm having a hard time finding a provider of the data. A C# example or language agnostic web service would be helpful.

    Read the article

  • Django Piston - how can I create custom methods?

    - by orokusaki
    I put my questions in the code comments for clarity: from piston.handler import AnonymousBaseHandler class AnonymousAPITest(AnonymousBaseHandler): fields = ('update_subscription',) def update_subscription(self, request, months): # Do some stuff here to update a subscription based on the # number of months provided. # How the heck can I call this method? return {'msg': 'Your subscription has been updated!'} def read(self, request): return { 'msg': 'Why would I need a read() method on a fully custom API?' }

    Read the article

  • Image compatibility in iphone and android

    - by damodar
    I developed UI for iphone apps and now want to use the same UI in Android apps. I read that Android use dip for image resolution and i also read that 1 dip=1.5 pixel.I simply multiply the image size by 1.5px. Now the problem is that the image is blur and not as clear as in iphone apps.So will some body suggest me how should i make a design so that it could be used in iphone and android.

    Read the article

  • How to convince someone, that reading books(blogs, so..) is important?

    - by hgulyan
    Dear all, please, help me to convince, that no matter what you're doing, you need to read some stuff, try to learn something new. They say, that they don't want to sit in front of computer in the end of a day and they don't have opportunity to read in working hours, or they're too tired for doing something. Have you faced this kind of situation? What did you do?

    Read the article

  • how to deal with the position in a c# stream

    - by CapsicumDreams
    The (entire) documentation for the position property on a stream says: When overridden in a derived class, gets or sets the position within the current stream. The Position property does not keep track of the number of bytes from the stream that have been consumed, skipped, or both. That's it. OK, so we're fairly clear on what it doesn't tell us, but I'd really like to know what it in fact does stand for. What is 'the position' for? Why would we want to alter or read it? If we change it - what happens? In a pratical example, I have a a stream that periodically gets written to, and I have a thread that attempts to read from it (ideally ASAP). From reading many SO issues, I reset the position field to zero to start my reading. Once this is done: Does this affect where the writer to this stream is going to attempt to put the data? Do I need to keep track of the last write position myself? (ie if I set the position to zero to read, does the writer begin to overwrite everything from the first byte?) If so, do I need a semaphore/lock around this 'position' field (subclassing, perhaps?) due to my two threads accessing it? If I don't handle this property, does the writer just overflow the buffer? Perhaps I don't understand the Stream itself - I'm regarding it as a FIFO pipe: shove data in at one end, and suck it out at the other. If it's not like this, then do I have to keep copying the data past my last read (ie from position 0x84 on) back to the start of my buffer? I've seriously tried to research all of this for quite some time - but I'm new to .NET. Perhaps the Streams have a long, proud (undocumented) history that everyone else implicitly understands. But for a newcomer, it's like reading the manual to your car, and finding out: The accelerator pedal affects the volume of fuel and air sent to the fuel injectors. It does not affect the volume of the entertainment system, or the air pressure in any of the tires, if fitted. Technically true, but seriously, what we want to know is that if we mash it to the floor you go faster..

    Read the article

  • Extracting contents of ConnectionStrings in web.config in Silverlight Business application.

    - by webKite
    I am trying to read dataSource ad Catalog from connectionString in web.config in Silverlight business project. Unfortunately when I used "SqlConnectionStringBuilder", I could not read connectionstring the has "connectionString="metadata=res:///MainDatabase.Main.csdl|res:///MainDatabase.Main.ssdl|......."" where as it work for "connectionString="Data Source=My-PC\SQL_2008;Initial Catalog =...."". I could get them using "Split" however, I don't like that solution. Is there any way to get my requirements? Thanks

    Read the article

  • problem with reading arabic in jsp page?

    - by sword101
    Hey there i have a column in the databsePostgreSQL which contains arabic data when reading the data from the database in the controller it's read fine, encoding is good but when sending the data to the jsp page and trying to read it it appears something like ????????? any ideas why something like this occur?

    Read the article

  • how can i get the file permission of a directory with java

    - by user571652
    i try to check the permission granted to a directory in linux, i mean i have a directory with permission 755 berty@berty-laptop:~$ ls -l / |grep directory drwxr-xr-x 3 root root 4096 2011-01-10 12:33 directory how can i read that permission with java? I've tried using FilePermission but though i have a directory with all the permissions (777) the FilePermission class always returns an exception java.security.AccessControlException: Access denied (java.io.FilePermission /home/directory read) at java.security.AccessController.checkPermission(AccessController.java:103) at com.snippets.Check4DirectoryPermission.checker(Check4DirectoryPermission.java:50) at com.snippets.Check4DirectoryPermission.main(Check4DirectoryPermission.java:70) is there another way to do this?

    Read the article

  • How many colunms in table to keep? - MySQL

    - by Dennis
    I am stuck between row vs colunms table design for storing some items but the decision is which table is easier to manage and if colunms then how many colunms are best to have? For example I have object meta data, ideally there are 45 pieces of information (after being normalized) on the same level that i need to store per object. So is 45 colunms in a heavry read/write table good? Can it work flawless in a real world situation of heavy concurrent read/writes?

    Read the article

  • Combining FileStream and MemoryStream to avoid disk accesses/paging while receiving gigabytes of data?

    - by w128
    I'm receiving a file as a stream of byte[] data packets (total size isn't known in advance) that I need to store somewhere before processing it immediately after it's been received (I can't do the processing on the fly). Total received file size can vary from as small as 10 KB to over 4 GB. One option for storing the received data is to use a MemoryStream, i.e. a sequence of MemoryStream.Write(bufferReceived, 0, count) calls to store the received packets. This is very simple, but obviously will result in out of memory exception for large files. An alternative option is to use a FileStream, i.e. FileStream.Write(bufferReceived, 0, count). This way, no out of memory exceptions will occur, but what I'm unsure about is bad performance due to disk writes (which I don't want to occur as long as plenty of memory is still available) - I'd like to avoid disk access as much as possible, but I don't know of a way to control this. I did some testing and most of the time, there seems to be little performance difference between say 10 000 consecutive calls of MemoryStream.Write() vs FileStream.Write(), but a lot seems to depend on buffer size and the total amount of data in question (i.e the number of writes). Obviously, MemoryStream size reallocation is also a factor. Does it make sense to use a combination of MemoryStream and FileStream, i.e. write to memory stream by default, but once the total amount of data received is over e.g. 500 MB, write it to FileStream; then, read in chunks from both streams for processing the received data (first process 500 MB from the MemoryStream, dispose it, then read from FileStream)? Another solution is to use a custom memory stream implementation that doesn't require continuous address space for internal array allocation (i.e. a linked list of memory streams); this way, at least on 64-bit environments, out of memory exceptions should no longer be an issue. Con: extra work, more room for mistakes. So how do FileStream vs MemoryStream read/writes behave in terms of disk access and memory caching, i.e. data size/performance balance. I would expect that as long as enough RAM is available, FileStream would internally read/write from memory (cache) anyway, and virtual memory would take care of the rest. But I don't know how often FileStream will explicitly access a disk when being written to. Any help would be appreciated.

    Read the article

  • How do I detect server status in a port scanner java implementation

    - by akz
    I am writing a port scanner in Java and I want to be able to distinct the following 4 use cases: port is open port is open and server banner was read port is closed server is not live I have the following code: InetAddress address = InetAddress.getByName("google.com"); int[] ports = new int[]{21, 22, 23, 80, 443}; for (int i = 0; i < ports.length; i++) { int port = ports[i]; Socket socket = null; try { socket = new Socket(address, port); socket.setSoTimeout(500); System.out.println("port " + port + " open"); BufferedReader reader = new BufferedReader( new InputStreamReader(socket.getInputStream())); String line = reader.readLine(); if (line != null) { System.out.println(line); } socket.close(); } catch (SocketTimeoutException ex) { // port was open but nothing was read from input stream ex.printStackTrace(); } catch (ConnectException ex) { // port is closed ex.printStackTrace(); } catch (IOException e) { e.printStackTrace(); } finally { if (socket != null && !socket.isClosed()) { try { socket.close(); } catch (Exception e) { e.printStackTrace(); } } } } The problem is that I get a ConnectionException both when the port is closed and the server cannot be reached but with a different exception message: java.net.ConnectException: Connection timed out: connect when the connection was never established and java.net.ConnectException: Connection refused: connect when the port was closed so I cannot make the distinction between the two use cases without digging into the actual exception message. Same thing happens when I try a different approach for the socket creation. If I use: socket = new Socket(); socket.setSoTimeout(500); socket.connect(new InetSocketAddress(address, port), 1000); I have the same problem but with the SocketTimeoutException instead. I get a java.net.SocketTimeoutException: Read timed out if port was open but there was no banner to be read and java.net.SocketTimeoutException: connect timed out if server is not live or port is closed. Any ideas? Thanks in advance!

    Read the article

< Previous Page | 175 176 177 178 179 180 181 182 183 184 185 186  | Next Page >