Search Results

Search found 8258 results on 331 pages for 'sequence points'.

Page 182/331 | < Previous Page | 178 179 180 181 182 183 184 185 186 187 188 189  | Next Page >

• Apache/Varnish/PHP: Just to confirm, is it possible to automatically update $_SERVER['REMOTE_ADDR'] to have the real client's IP?

  - by user1284857

  I just cannot seem to get the real client IP to show in PHP's $_SERVER['REMOTE_ADDR']. It shows in $_SERVER['X_FORWARDED_FOR'], but the $_SERVER['REMOTE_ADDR'] always points to the Varnish service IP. I've played around with just about every Varnish vcl suggestion I could find. I've installed Apache module mod_rpaf. But I still cannot get $_SERVER['REMOTE_ADDR'] to reflect the client's real IP... So my question is, is this even possible? Does everyone who uses Varnish have to do something like this for all PHP applications?: $_SERVER['REMOTE_ADDR'] = $_SERVER['X_FORWARDED_FOR']; Or am I simply not configuring it correctly?

  Read the article

• sequencing function calls in javascript - are callbacks the only way?

  - by tim

  I read through various threads like this one for example. But it really escapes me how to accomplish the following: I have 4 functions, and want them happen one after another in sequence. Notice they are in incorrect order, to get my point across. I want the result that will output "1, 2, 3, 4' function firstFunction(){ // some very time consuming asynchronous code... console.log('1'); } function thirdFunction(){ // definitely dont wanna do this until secondFunction is finished console.log('3'); } function secondFunction(){ // waits for firstFunction to be completed console.log('2'); } function fourthFunction(){ // last function, not executed until the other 3 are done. console.log('4'); } I tried to figure out callbacks but am getting lost :( Isn't there some simple way to do this? Like looping through an array...

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• Creating a file path in C#

  - by Jason

  So I'm trying to create a path in C#. I use Environment.Machinename and store it a variable serverName. Then I create another string variable and have some other path extension in there. Here is my code so far: string serverName = Environment.MachineName; string folderName = "\\AlarmLogger"; No matter what I do I can't seem to obtain only one backslash prior to AlarmLogger. Any ideas how I can specify a path in C#? Edit: I'm wondering if my code doesn't seem to want to paste correctly. Anyways when i paste it I only see one backslash but my code has two. Because of the escape character sequence. But something like string test = @"\" + serverName + folderName doesn't seem to want to work for me.

  Read the article

• How to change the text int JLabel under the while or for loop?

  - by guilgamos

  I want to create a simple clock by using java. The code is very simply that i will give an example shown below for(int i=0;i<=60;i++) jLabel11.setText( Integer.toString(i) ); The problem is while I'm running my program the result didn't show the update in sequence. I mean it show only 60 digit immediately. It didn't show the change from 1 to 2 to 3 ... something like this. How can i fix this problem. Thank you in advance.

  Read the article

• Multiple Concurrent Changes Using SVN, GIT, and CVS

  - by KlaxSmashing

  At work, we are using SVN, CVS, and GIT because there any many projects that were started at various times. Anyway, a common sequence that occurs is as follows: Working on task A, making changes to project Has new task B, some bug or functionality needs to be done on project, independent of task A but may affect same set of files Check in task B Check in task A Unfortunately, what I do at this time is two maintain 2 working copies of each project. So I can always work on task B from a clean copy. As you can imagine, this is wasteful and also, does not scale well (task C, D, E, etc.) For each of these versioning systems, are there commands that can help me do the following: "Save" task A, reverting working copy to current repository Work on task B, check in changes "Restore" task A changes back to working copy

  Read the article

• How to encode(represent) an ornament?

  - by Daniyar

  I would like to find a numeric representation of kazakh national ornaments for generating new ones. The ornaments essentially consist of combinations of relatively basic ornaments. Usually the ornaments are symmetrical. Here are few examples of basic elements: (The images are a bit distorted) And this is an example of a more complex ornament: How could I encode an ornament's representation in as few numbers as possible? So that I could write a program that would generate an ornament, given some sequence of numbers Any ideas are appreciated. As I write this, I have thought that generating images of snowlfakes may be somewhat relevant, although it's possibly just a fractal.

  Read the article

• for (Object object : list) [java] construction

  - by EugeneP

  My question, is, whether the sequence of elements picked from a list will always be the same, is this construction behaviour is deterministic for java "List"s - descendants of java.util.List 2) question, if I use for(Object o: list) construction and inside the loop's body increment a variable, will it be the index of list's elements? So, how it goes through list's elements, from 0 to size()-1 or chaotically? List.get(i) will always return this element? 3) question ( I suppose for the 2-nd question the answer will be negative, so:) for (int i=0; i < list.size(); i++) { } is the best way if I need to save the index of an element and later get it back from a list by its id?

  Read the article

• Faster way of initializing arrays in Delphi

  - by Max

  I'm trying to squeeze every bit of performance in my Delphi application and now I came to a procedure which works with dynamic arrays. The slowest line in it is SetLength(Result, Len); which is used to initialize the dynamic array. When I look at the code for the SetLength procedure I see that it is far from optimal. The call sequence is as follows: _DynArraySetLength - DynArraySetLength DynArraySetLength gets the array length (which is zero for initialization) and then uses ReallocMem which is also unnecessary for initilization. I was doing SetLength to initialize dynamic array all the time. Maybe I'm missing something? Is there a faster way to do this?

  Read the article

• Clojure: find repetition

  - by demi

  Let we have a list of integers: 1, 2, 5, 13, 6, 5, 7 and I want to find the first number has a duplicate before it and return a vector of two indices, In my sample, it's 5 at [2, 5]. What I did so far is loop, but can I do it more elegant, short way? (defn get-cycle [xs] (loop [[x & xs_rest] xs, indices {}, i 0] (if (nil? x) [0 i] ; Sequence is over before we found a duplicate. (if-let [x_index (indices x)] [x_index i] (recur xs_rest (assoc indices x i) (inc i)))))) No need to return number itself, because I can get it by index and, second, it may be not always there.

  Read the article

• dynamic memory allocation [closed]

  - by gcc

  i wanna write a program that creates (allocating memory) and manipulates (adding elements and increasing memory etc.) integer arrays dynamically according to given input sequences. input sequence which starts with the maximum number of arrays, includes integers to be put into arrays and some one letter characters which are commands to carry out some tasks (activating next array, deleting an array etc). also, i wanna create *c_arrays which is the address of the array whose elements are the actual capacities (How many integer slots are already allocated for an array?) of arrays how should i organize(set up) the algorithm?

  Read the article

• How to apply Seq map function?

  - by netmatrix01

  Hello All, I been recently playing with F# . I was wondering instead of using a for loop to generate a sequence to element which are multiplied with every other element in the list how can I use a Seq map function or something similar to generate something like below. So for e.g. I have a list [1..10] I would like to apply a fun which generates a result something like [(1*1); (1*2);(1*3); (1*4); (1*5)......(2*1);(2*2);(2*3).....(3*1);(3*2)...] How can i achieve this ?. Many thanks for all you help.

  Read the article

• Complete Guide to Symbolic Links (symlinks) on Windows or Linux

  - by Matthew Guay

  Want to easily access folders and files from different folders without maintaining duplicate copies?  Here’s how you can use Symbolic Links to link anything in Windows 7, Vista, XP, and Ubuntu. So What Are Symbolic Links Anyway? Symbolic links, otherwise known as symlinks, are basically advanced shortcuts. You can create symbolic links to individual files or folders, and then these will appear like they are stored in the folder with the symbolic link even though the symbolic link only points to their real location. There are two types of symbolic links: hard and soft. Soft symbolic links work essentially the same as a standard shortcut.  When you open a soft link, you will be redirected to the folder where the files are stored.  However, a hard link makes it appear as though the file or folder actually exists at the location of the symbolic link, and your applications won’t know any different. Thus, hard links are of the most interest in this article. Why should I use Symbolic Links? There are many things we use symbolic links for, so here’s some of the top uses we can think of: Sync any folder with Dropbox – say, sync your Pidgin Profile Across Computers Move the settings folder for any program from its original location Store your Music/Pictures/Videos on a second hard drive, but make them show up in your standard Music/Pictures/Videos folders so they’ll be detected my your media programs (Windows 7 Libraries can also be good for this) Keep important files accessible from multiple locations And more! If you want to move files to a different drive or folder and then symbolically link them, follow these steps: Close any programs that may be accessing that file or folder Move the file or folder to the new desired location Follow the correct instructions below for your operating system to create the symbolic link. Caution: Make sure to never create a symbolic link inside of a symbolic link. For instance, don’t create a symbolic link to a file that’s contained in a symbolic linked folder. This can create a loop, which can cause millions of problems you don’t want to deal with. Seriously. Create Symlinks in Any Edition of Windows in Explorer Creating symlinks is usually difficult, but thanks to the free Link Shell Extension, you can create symbolic links in all modern version of Windows pain-free.  You need to download both Visual Studio 2005 redistributable, which contains the necessary prerequisites, and Link Shell Extension itself (links below).  Download the correct version (32 bit or 64 bit) for your computer. Run and install the Visual Studio 2005 Redistributable installer first. Then install the Link Shell Extension on your computer. Your taskbar will temporally disappear during the install, but will quickly come back. Now you’re ready to start creating symbolic links.  Browse to the folder or file you want to create a symbolic link from.  Right-click the folder or file and select Pick Link Source. To create your symlink, right-click in the folder you wish to save the symbolic link, select “Drop as…”, and then choose the type of link you want.  You can choose from several different options here; we chose the Hardlink Clone.  This will create a hard link to the file or folder we selected.  The Symbolic link option creates a soft link, while the smart copy will fully copy a folder containing symbolic links without breaking them.  These options can be useful as well.   Here’s our hard-linked folder on our desktop.  Notice that the folder looks like its contents are stored in Desktop\Downloads, when they are actually stored in C:\Users\Matthew\Desktop\Downloads.  Also, when links are created with the Link Shell Extension, they have a red arrow on them so you can still differentiate them. And, this works the same way in XP as well. Symlinks via Command Prompt Or, for geeks who prefer working via command line, here’s how you can create symlinks in Command Prompt in Windows 7/Vista and XP. In Windows 7/Vista In Windows Vista and 7, we’ll use the mklink command to create symbolic links.  To use it, we have to open an administrator Command Prompt.  Enter “command” in your start menu search, right-click on Command Prompt, and select “Run as administrator”. To create a symbolic link, we need to enter the following in command prompt: mklink /prefix link_path file/folder_path First, choose the correct prefix.  Mklink can create several types of links, including the following: /D – creates a soft symbolic link, which is similar to a standard folder or file shortcut in Windows.  This is the default option, and mklink will use it if you do not enter a prefix. /H – creates a hard link to a file /J – creates a hard link to a directory or folder So, once you’ve chosen the correct prefix, you need to enter the path you want for the symbolic link, and the path to the original file or folder.  For example, if I wanted a folder in my Dropbox folder to appear like it was also stored in my desktop, I would enter the following: mklink /J C:\Users\Matthew\Desktop\Dropbox C:\Users\Matthew\Documents\Dropbox Note that the first path was to the symbolic folder I wanted to create, while the second path was to the real folder. Here, in this command prompt screenshot, you can see that I created a symbolic link of my Music folder to my desktop.   And here’s how it looks in Explorer.  Note that all of my music is “really” stored in C:\Users\Matthew\Music, but here it looks like it is stored in C:\Users\Matthew\Desktop\Music. If your path has any spaces in it, you need to place quotes around it.  Note also that the link can have a different name than the file it links to.  For example, here I’m going to create a symbolic link to a document on my desktop: mklink /H “C:\Users\Matthew\Desktop\ebook.pdf”  “C:\Users\Matthew\Downloads\Before You Call Tech Support.pdf” Don’t forget the syntax: mklink /prefix link_path Target_file/folder_path In Windows XP Windows XP doesn’t include built-in command prompt support for symbolic links, but we can use the free Junction tool instead.  Download Junction (link below), and unzip the folder.  Now open Command Prompt (click Start, select All Programs, then Accessories, and select Command Prompt), and enter cd followed by the path of the folder where you saved Junction. Junction only creates hard symbolic links, since you can use shortcuts for soft ones.  To create a hard symlink, we need to enter the following in command prompt: junction –s link_path file/folder_path As with mklink in Windows 7 or Vista, if your file/folder path has spaces in it make sure to put quotes around your paths.  Also, as usual, your symlink can have a different name that the file/folder it points to. Here, we’re going to create a symbolic link to our My Music folder on the desktop.  We entered: junction -s “C:\Documents and Settings\Administrator\Desktop\Music” “C:\Documents and Settings\Administrator\My Documents\My Music” And here’s the contents of our symlink.  Note that the path looks like these files are stored in a Music folder directly on the Desktop, when they are actually stored in My Documents\My Music.  Once again, this works with both folders and individual files. Please Note: Junction would work the same in Windows 7 or Vista, but since they include a built-in symbolic link tool we found it better to use it on those versions of Windows. Symlinks in Ubuntu Unix-based operating systems have supported symbolic links since their inception, so it is straightforward to create symbolic links in Linux distros such as Ubuntu.  There’s no graphical way to create them like the Link Shell Extension for Windows, so we’ll just do it in Terminal. Open terminal (open the Applications menu, select Accessories, and then click Terminal), and enter the following: ln –s file/folder_path link_path Note that this is opposite of the Windows commands; you put the source for the link first, and then the path second. For example, let’s create a symbolic link of our Pictures folder in our Desktop.  To do this, we entered: ln -s /home/maguay/Pictures /home/maguay/Desktop   Once again, here is the contents of our symlink folder.  The pictures look as if they’re stored directly in a Pictures folder on the Desktop, but they are actually stored in maguay\Pictures. Delete Symlinks Removing symbolic links is very simple – just delete the link!  Most of the command line utilities offer a way to delete a symbolic link via command prompt, but you don’t need to go to the trouble.   Conclusion Symbolic links can be very handy, and we use them constantly to help us stay organized and keep our hard drives from overflowing.  Let us know how you use symbolic links on your computers! Download Link Shell Extension for Windows 7, Vista, and XP Download Junction for XP Similar Articles Productive Geek Tips Using Symlinks in Windows VistaHow To Figure Out Your PC’s Host Name From the Command PromptInstall IceWM on Ubuntu LinuxAdd Color Coding to Windows 7 Media Center Program GuideSync Your Pidgin Profile Across Multiple PCs with Dropbox TouchFreeze Alternative in AutoHotkey The Icy Undertow Desktop Windows Home Server – Backup to LAN The Clear & Clean Desktop Use This Bookmarklet to Easily Get Albums Use AutoHotkey to Assign a Hotkey to a Specific Window Latest Software Reviews Tinyhacker Random Tips DVDFab 6 Revo Uninstaller Pro Registry Mechanic 9 for Windows PC Tools Internet Security Suite 2010 Gadfly is a cool Twitter/Silverlight app Enable DreamScene in Windows 7 Microsoft’s “How Do I ?” Videos Home Networks – How do they look like & the problems they cause Check Your IMAP Mail Offline In Thunderbird Follow Finder Finds You Twitter Users To Follow

  Read the article

• Creating a dynamic proxy generator with c# – Part 4 – Calling the base method

  - by SeanMcAlinden

  Creating a dynamic proxy generator with c# – Part 1 – Creating the Assembly builder, Module builder and caching mechanism Creating a dynamic proxy generator with c# – Part 2 – Interceptor Design Creating a dynamic proxy generator with c# – Part 3 – Creating the constructors   The plan for calling the base methods from the proxy is to create a private method for each overridden proxy method, this will allow the proxy to use a delegate to simply invoke the private method when required. Quite a few helper classes have been created to make this possible so as usual I would suggest download or viewing the code at http://rapidioc.codeplex.com/. In this post I’m just going to cover the main points for when creating methods. Getting the methods to override The first two notable methods are for getting the methods. private static MethodInfo[] GetMethodsToOverride<TBase>() where TBase : class {     return typeof(TBase).GetMethods().Where(x =>         !methodsToIgnore.Contains(x.Name) &&                              (x.Attributes & MethodAttributes.Final) == 0)         .ToArray(); } private static StringCollection GetMethodsToIgnore() {     return new StringCollection()     {         "ToString",         "GetHashCode",         "Equals",         "GetType"     }; } The GetMethodsToIgnore method string collection contains an array of methods that I don’t want to override. In the GetMethodsToOverride method, you’ll notice a binary AND which is basically saying not to include any methods marked final i.e. not virtual. Creating the MethodInfo for calling the base method This method should hopefully be fairly easy to follow, it’s only function is to create a MethodInfo which points to the correct base method, and with the correct parameters. private static MethodInfo CreateCallBaseMethodInfo<TBase>(MethodInfo method) where TBase : class {     Type[] baseMethodParameterTypes = ParameterHelper.GetParameterTypes(method, method.GetParameters());       return typeof(TBase).GetMethod(        method.Name,        BindingFlags.Instance | BindingFlags.Public | BindingFlags.NonPublic,        null,        baseMethodParameterTypes,        null     ); }   /// <summary> /// Get the parameter types. /// </summary> /// <param name="method">The method.</param> /// <param name="parameters">The parameters.</param> public static Type[] GetParameterTypes(MethodInfo method, ParameterInfo[] parameters) {     Type[] parameterTypesList = Type.EmptyTypes;       if (parameters.Length > 0)     {         parameterTypesList = CreateParametersList(parameters);     }     return parameterTypesList; }   Creating the new private methods for calling the base method The following method outline how I’ve created the private methods for calling the base class method. private static MethodBuilder CreateCallBaseMethodBuilder(TypeBuilder typeBuilder, MethodInfo method) {     string callBaseSuffix = "GetBaseMethod";       if (method.IsGenericMethod || method.IsGenericMethodDefinition)     {                         return MethodHelper.SetUpGenericMethod             (                 typeBuilder,                 method,                 method.Name + callBaseSuffix,                 MethodAttributes.Private | MethodAttributes.HideBySig             );     }     else     {         return MethodHelper.SetupNonGenericMethod             (                 typeBuilder,                 method,                 method.Name + callBaseSuffix,                 MethodAttributes.Private | MethodAttributes.HideBySig             );     } } The CreateCallBaseMethodBuilder is the entry point method for creating the call base method. I’ve added a suffix to the base classes method name to keep it unique. Non Generic Methods Creating a non generic method is fairly simple public static MethodBuilder SetupNonGenericMethod(     TypeBuilder typeBuilder,     MethodInfo method,     string methodName,     MethodAttributes methodAttributes) {     ParameterInfo[] parameters = method.GetParameters();       Type[] parameterTypes = ParameterHelper.GetParameterTypes(method, parameters);       Type returnType = method.ReturnType;       MethodBuilder methodBuilder = CreateMethodBuilder         (             typeBuilder,             method,             methodName,             methodAttributes,             parameterTypes,             returnType         );       ParameterHelper.SetUpParameters(parameterTypes, parameters, methodBuilder);       return methodBuilder; }   private static MethodBuilder CreateMethodBuilder (     TypeBuilder typeBuilder,     MethodInfo method,     string methodName,     MethodAttributes methodAttributes,     Type[] parameterTypes,     Type returnType ) { MethodBuilder methodBuilder = typeBuilder.DefineMethod(methodName, methodAttributes, returnType, parameterTypes); return methodBuilder; } As you can see, you simply have to declare a method builder, get the parameter types, and set the method attributes you want.   Generic Methods Creating generic methods takes a little bit more work. /// <summary> /// Sets up generic method. /// </summary> /// <param name="typeBuilder">The type builder.</param> /// <param name="method">The method.</param> /// <param name="methodName">Name of the method.</param> /// <param name="methodAttributes">The method attributes.</param> public static MethodBuilder SetUpGenericMethod     (         TypeBuilder typeBuilder,         MethodInfo method,         string methodName,         MethodAttributes methodAttributes     ) {     ParameterInfo[] parameters = method.GetParameters();       Type[] parameterTypes = ParameterHelper.GetParameterTypes(method, parameters);       MethodBuilder methodBuilder = typeBuilder.DefineMethod(methodName,         methodAttributes);       Type[] genericArguments = method.GetGenericArguments();       GenericTypeParameterBuilder[] genericTypeParameters =         GetGenericTypeParameters(methodBuilder, genericArguments);       ParameterHelper.SetUpParameterConstraints(parameterTypes, genericTypeParameters);       SetUpReturnType(method, methodBuilder, genericTypeParameters);       if (method.IsGenericMethod)     {         methodBuilder.MakeGenericMethod(genericArguments);     }       ParameterHelper.SetUpParameters(parameterTypes, parameters, methodBuilder);       return methodBuilder; }   private static GenericTypeParameterBuilder[] GetGenericTypeParameters     (         MethodBuilder methodBuilder,         Type[] genericArguments     ) {     return methodBuilder.DefineGenericParameters(GenericsHelper.GetArgumentNames(genericArguments)); }   private static void SetUpReturnType(MethodInfo method, MethodBuilder methodBuilder, GenericTypeParameterBuilder[] genericTypeParameters) {     if (method.IsGenericMethodDefinition)     {         SetUpGenericDefinitionReturnType(method, methodBuilder, genericTypeParameters);     }     else     {         methodBuilder.SetReturnType(method.ReturnType);     } }   private static void SetUpGenericDefinitionReturnType(MethodInfo method, MethodBuilder methodBuilder, GenericTypeParameterBuilder[] genericTypeParameters) {     if (method.ReturnType == null)     {         methodBuilder.SetReturnType(typeof(void));     }     else if (method.ReturnType.IsGenericType)     {         methodBuilder.SetReturnType(genericTypeParameters.Where             (x => x.Name == method.ReturnType.Name).First());     }     else     {         methodBuilder.SetReturnType(method.ReturnType);     }             } Ok, there are a few helper methods missing, basically there is way to much code to put in this post, take a look at the code at http://rapidioc.codeplex.com/ to follow it through completely. Basically though, when dealing with generics there is extra work to do in terms of getting the generic argument types setting up any generic parameter constraints setting up the return type setting up the method as a generic All of the information is easy to get via reflection from the MethodInfo.   Emitting the new private method Emitting the new private method is relatively simple as it’s only function is calling the base method and returning a result if the return type is not void. ILGenerator il = privateMethodBuilder.GetILGenerator();   EmitCallBaseMethod(method, callBaseMethod, il);   private static void EmitCallBaseMethod(MethodInfo method, MethodInfo callBaseMethod, ILGenerator il) {     int privateParameterCount = method.GetParameters().Length;       il.Emit(OpCodes.Ldarg_0);       if (privateParameterCount > 0)     {         for (int arg = 0; arg < privateParameterCount; arg++)         {             il.Emit(OpCodes.Ldarg_S, arg + 1);         }     }       il.Emit(OpCodes.Call, callBaseMethod);       il.Emit(OpCodes.Ret); } So in the main method building method, an ILGenerator is created from the method builder. The ILGenerator performs the following actions: Load the class (this) onto the stack using the hidden argument Ldarg_0. Create an argument on the stack for each of the method parameters (starting at 1 because 0 is the hidden argument) Call the base method using the Opcodes.Call code and the MethodInfo we created earlier. Call return on the method   Conclusion Now we have the private methods prepared for calling the base method, we have reached the last of the relatively easy part of the proxy building. Hopefully, it hasn’t been too hard to follow so far, there is a lot of code so I haven’t been able to post it all so please check it out at http://rapidioc.codeplex.com/. The next section should be up fairly soon, it’s going to cover creating the delegates for calling the private methods created in this post.   Kind Regards, Sean.

  Read the article

• 500 Metro Style WP7 Icons

  - by Bil Simser

  I was inspired by The Noun Project, a project that offers up “Metro-style” icons in SVG format. The project is licensed under a public domain license and while it’s a great project, all of the content is in SVG format. Jon Galloway has a great post (from 2007) talking about the differences between SVG and XAML so I highly recommend that for some background. I thought it would be helpful to the WPF/Windows Phone 7/Silverlight community to provide the content in alternative formats for use in your applications. The Goods I’ve put together a package of the 500 icons (502 actually) in PNG, XAML and the original SVG format along with a couple of sample projects so you can see them in action. There’s a WPF desktop app: And a Windows Phone 7 app: Building It To get all the content first I wrote up a quick program to suck the original SVG files. Luckily they’re all in a common path just named 1.SVG, 2.SVG, and so on. Easy sleazy to grab the contents. Once I had 500 SVG files I used the latest copy of XamlTune, an open source CodePlex project that has a command line conversion tool to convert the directory of SVG files into XAML (the tool also created a PNG file of each SVG so that’s just icing on the cake). Conversions The conversion from SVG to XAML isn’t 100%. While you can just drop the content into a WPF app, it doesn’t work that way for WP7. There are just some small adjustments I made to each format so you’ll have to do the same. Follow the information below or refer to the sample applications. As a sample, here’s an icon we want to use: Here’s the original SVG file: <svg version="1.0" id="Layer_1" xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" x="0px" y="0px" width="100px" height="94.616px" viewBox="0 0 100 94.616" enable-background="new 0 0 100 94.616" xml:space="preserve"> <path d="M25.076,15.639c4.324,0.009,7.824-3.488,7.82-7.82C32.9,3.512,29.4,0.012,25.076,0c-4.313,0.012-7.814,3.512-7.821,7.819 C17.262,12.15,20.763,15.648,25.076,15.639L25.076,15.639z"/> <path d="M4.593,43.388h6.861l4.137-15.135h1.716L13.22,43.388h24.318l-4.389-15.135h1.817l2.32,7.415 c1.08,3.131,3.852,3.851,6.003,1.162l8.375-10.142c2.651-3.42-2.104-7.021-4.844-4.035l-4.993,5.952 c0.007,0.095-0.96-3.278-0.96-3.278c-1.135-3.978-4.918-7.903-10.595-7.922H19.576c-5.071,0.019-9.043,4.434-9.888,7.214 L4.593,43.388L4.593,43.388z"/> <polygon points="56.206,22.753 56.206,7.163 49.192,7.163 49.192,22.753 56.206,22.753 "/> <path d="M79.87,15.738c4.332-0.014,7.831-3.516,7.82-7.82c0.011-4.332-3.488-7.833-7.82-7.82c-4.306-0.013-7.806,3.488-7.821,7.82 C72.064,12.222,75.564,15.725,79.87,15.738L79.87,15.738z"/> <path d="M89.759,89.556v-43.19h5.751V22.804c0.007-3.079-2.757-5.448-6.71-5.449H70.436c-3.65,0.001-4.539,1.186-5.551,2.168 L49.597,37.889c-3.098,3.848,2.428,8.333,5.55,4.743L69.88,25.226v64.43c-0.019,6.475,9.06,6.686,9.081,0.201v-36.58h1.765v36.379 C80.748,96.109,89.772,96.13,89.759,89.556L89.759,89.556z"/> <polygon points="100,54.035 100,45.155 0,45.155 0,54.035 100,54.035 "/> </svg> Here’s the XAML that XamlTune created. It can be used in any WPF app without any changes: <Canvas Name="Layer_1" Width="100" Height="94.616" ClipToBounds="True" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation"> <Path Fill="#FF000000"> <Path.Data> <PathGeometry FillRule="Nonzero" Figures="M25.076,15.639C29.4,15.648 32.9,12.151 32.896,7.819 32.9,3.512 29.4,0.012 25.076,0 20.763,0.012 17.262,3.512 17.255,7.819 17.262,12.15 20.763,15.648 25.076,15.639L25.076,15.639z" /> </Path.Data> </Path> <Path Fill="#FF000000"> <Path.Data> <PathGeometry FillRule="Nonzero" Figures="M4.593,43.388L11.454,43.388 15.591,28.253 17.307,28.253 13.22,43.388 37.538,43.388 33.149,28.253 34.966,28.253 37.286,35.668C38.366,38.799,41.138,39.519,43.289,36.83L51.664,26.688C54.315,23.268,49.56,19.667,46.82,22.653L41.827,28.605C41.834,28.7 40.867,25.327 40.867,25.327 39.732,21.349 35.949,17.424 30.272,17.405L19.576,17.405C14.505,17.424,10.533,21.839,9.688,24.619L4.593,43.388 4.593,43.388z" /> </Path.Data> </Path> <Path Fill="#FF000000"> <Path.Data> <PathGeometry FillRule="Nonzero" Figures="M56.206,22.753L56.206,7.163 49.192,7.163 49.192,22.753 56.206,22.753z" /> </Path.Data> </Path> <Path Fill="#FF000000"> <Path.Data> <PathGeometry FillRule="Nonzero" Figures="M79.87,15.738C84.202,15.724 87.701,12.222 87.69,7.918 87.701,3.586 84.202,0.0849999999999991 79.87,0.097999999999999 75.564,0.084999999999999 72.064,3.586 72.049,7.918 72.064,12.222 75.564,15.725 79.87,15.738L79.87,15.738z" /> </Path.Data> </Path> <Path Fill="#FF000000"> <Path.Data> <PathGeometry FillRule="Nonzero" Figures="M89.759,89.556L89.759,46.366 95.51,46.366 95.51,22.804C95.517,19.725,92.753,17.356,88.8,17.355L70.436,17.355C66.786,17.356,65.897,18.541,64.885,19.523L49.597,37.889C46.499,41.737,52.025,46.222,55.147,42.632L69.88,25.226 69.88,89.656C69.861,96.131,78.94,96.342,78.961,89.857L78.961,53.277 80.726,53.277 80.726,89.656C80.748,96.109,89.772,96.13,89.759,89.556L89.759,89.556z" /> </Path.Data> </Path> <Path Fill="#FF000000"> <Path.Data> <PathGeometry FillRule="Nonzero" Figures="M100,54.035L100,45.155 0,45.155 0,54.035 100,54.035z" /> </Path.Data> </Path> </Canvas> The XAML works AS-IS in a WPF application but there are some changes I did to get it to work in a WP7 app. Here’s the modified XAML in a WP7 application: <Canvas Grid.Row="0" Grid.Column="0" Name="Icon_1" Width="100" Height="94.616"> <Path Fill="#FF000000" Data="M25.076,15.639C29.4,15.648 32.9,12.151 32.896,7.819 32.9,3.512 29.4,0.012 25.076,0 20.763,0.012 17.262,3.512 17.255,7.819 17.262,12.15 20.763,15.648 25.076,15.639L25.076,15.639z"> </Path> <Path Fill="#FF000000" Data="M4.593,43.388L11.454,43.388 15.591,28.253 17.307,28.253 13.22,43.388 37.538,43.388 33.149,28.253 34.966,28.253 37.286,35.668C38.366,38.799,41.138,39.519,43.289,36.83L51.664,26.688C54.315,23.268,49.56,19.667,46.82,22.653L41.827,28.605C41.834,28.7 40.867,25.327 40.867,25.327 39.732,21.349 35.949,17.424 30.272,17.405L19.576,17.405C14.505,17.424,10.533,21.839,9.688,24.619L4.593,43.388 4.593,43.388z"> </Path> <Path Fill="#FF000000" Data="M56.206,22.753L56.206,7.163 49.192,7.163 49.192,22.753 56.206,22.753z"> </Path> <Path Fill="#FF000000" Data="M79.87,15.738C84.202,15.724 87.701,12.222 87.69,7.918 87.701,3.586 84.202,0.0849999999999991 79.87,0.097999999999999 75.564,0.084999999999999 72.064,3.586 72.049,7.918 72.064,12.222 75.564,15.725 79.87,15.738L79.87,15.738z"> </Path> <Path Fill="#FF000000" Data="M89.759,89.556L89.759,46.366 95.51,46.366 95.51,22.804C95.517,19.725,92.753,17.356,88.8,17.355L70.436,17.355C66.786,17.356,65.897,18.541,64.885,19.523L49.597,37.889C46.499,41.737,52.025,46.222,55.147,42.632L69.88,25.226 69.88,89.656C69.861,96.131,78.94,96.342,78.961,89.857L78.961,53.277 80.726,53.277 80.726,89.656C80.748,96.109,89.772,96.13,89.759,89.556L89.759,89.556z"> </Path> <Path Fill="#FF000000" Data="M100,54.035L100,45.155 0,45.155 0,54.035 100,54.035z"> </Path> </Canvas> All I did was take the data portion and put it directly into a Data attribute on the Path. Note that while it does show up in the app (on the emulator or device) it wouldn’t show up in Visual Studio for me. Maybe some XAML guru out there can tell me why. You can just as easily use the PNG files in WP7 but if you want the crispness of vector graphics, go for the XAML version. Of course with XamlTune being open source you could always modify the output of that program to cater it to your app. If you do make a change that’s worthy please consider submitting a patch to the project so everyone can benefit. Hope this helps and happy programming! Resources and Links Sample Project and Icons XamlTune an open source project to convert SVG to XAML The Noun Project source of the original files Jon Galloways post on SVG and XAML StackOverflow question on converting SVG to XAML

  Read the article

• Pluralsight Meet the Author Podcast on Structuring JavaScript Code

  - by dwahlin

  I had the opportunity to talk with Fritz Onion from Pluralsight about one of my recent courses titled Structuring JavaScript Code for one of their Meet the Author podcasts. We talked about why JavaScript patterns are important for building more re-useable and maintainable apps, pros and cons of different patterns, and how to go about picking a pattern as a project is started. The course provides a solid walk-through of converting what I call “Function Spaghetti Code” into more modular code that’s easier to maintain, more re-useable, and less susceptible to naming conflicts. Patterns covered in the course include the Prototype Pattern, Revealing Module Pattern, and Revealing Prototype Pattern along with several other tips and techniques that can be used. Meet the Author:  Dan Wahlin on Structuring JavaScript Code   The transcript from the podcast is shown below: [Fritz]  Hello, this is Fritz Onion with another Pluralsight author interview. Today we’re talking with Dan Wahlin about his new course, Structuring JavaScript Code. Hi, Dan, it’s good to have you with us today. [Dan]  Thanks for having me, Fritz. [Fritz]  So, Dan, your new course, which came out in December of 2011 called Structuring JavaScript Code, goes into several patterns of usage in JavaScript as well as ways of organizing your code and what struck me about it was all the different techniques you described for encapsulating your code. I was wondering if you could give us just a little insight into what your motivation was for creating this course and sort of why you decided to write it and record it. [Dan]  Sure. So, I got started with JavaScript back in the mid 90s. In fact, back in the days when browsers that most people haven’t heard of were out and we had JavaScript but it wasn’t great. I was on a project in the late 90s that was heavy, heavy JavaScript and we pretty much did what I call in the course function spaghetti code where you just have function after function, there’s no rhyme or reason to how those functions are structured, they just kind of flow and it’s a little bit hard to do maintenance on it, you really don’t get a lot of reuse as far as from an object perspective. And so coming from an object-oriented background in JAVA and C#, I wanted to put something together that highlighted kind of the new way if you will of writing JavaScript because most people start out just writing functions and there’s nothing with that, it works, but it’s definitely not a real reusable solution. So the course is really all about how to move from just kind of function after function after function to the world of more encapsulated code and more reusable and hopefully better maintenance in the process. [Fritz]  So I am sure a lot of people have had similar experiences with their JavaScript code and will be looking forward to seeing what types of patterns you’ve put forth. Now, a couple I noticed in your course one is you start off with the prototype pattern. Do you want to describe sort of what problem that solves and how you go about using it within JavaScript? [Dan]  Sure. So, the patterns that are covered such as the prototype pattern and the revealing module pattern just as two examples, you know, show these kind of three things that I harp on throughout the course of encapsulation, better maintenance, reuse, those types of things. The prototype pattern specifically though has a couple kind of pros over some of the other patterns and that is the ability to extend your code without touching source code and what I mean by that is let’s say you’re writing a library that you know either other teammates or other people just out there on the Internet in general are going to be using. With the prototype pattern, you can actually write your code in such a way that we’re leveraging the JavaScript property and by doing that now you can extend my code that I wrote without touching my source code script or you can even override my code and perform some new functionality. Again, without touching my code.  And so you get kind of the benefit of the almost like inheritance or overriding in object oriented languages with this prototype pattern and it makes it kind of attractive that way definitely from a maintenance standpoint because, you know, you don’t want to modify a script I wrote because I might roll out version 2 and now you’d have to track where you change things and it gets a little tricky. So with this you just override those pieces or extend them and get that functionality and that’s kind of some of the benefits that that pattern offers out of the box. [Fritz]  And then the revealing module pattern, how does that differ from the prototype pattern and what problem does that solve differently? [Dan]  Yeah, so the prototype pattern and there’s another one that’s kind of really closely lined with revealing module pattern called the revealing prototype pattern and it also uses the prototype key word but it’s very similar to the one you just asked about the revealing module pattern. [Fritz]  Okay. [Dan]  This is a really popular one out there. In fact, we did a project for Microsoft that was very, very heavy JavaScript. It was an HMTL5 jQuery type app and we use this pattern for most of the structure if you will for the JavaScript code and what it does in a nutshell is allows you to get that encapsulation so you have really a single function wrapper that wraps all your other child functions but it gives you the ability to do public versus private members and this is kind of a sort of debate out there on the web. Some people feel that all JavaScript code should just be directly accessible and others kind of like to be able to hide their, truly their private stuff and a lot of people do that. You just put an underscore in front of your field or your variable name or your function name and that kind of is the defacto way to say hey, this is private. With the revealing module pattern you can do the equivalent of what objective oriented languages do and actually have private members that you literally can’t get to as an external consumer of the JavaScript code and then you can expose only those members that you want to be public. Now, you don’t get the benefit though of the prototype feature, which is I can’t easily extend the revealing module pattern type code if you don’t like something I’m doing, chances are you’re probably going to have to tweak my code to fix that because we’re not leveraging prototyping but in situations where you’re writing apps that are very specific to a given target app, you know, it’s not a library, it’s not going to be used in other apps all over the place, it’s a pattern I actually like a lot, it’s very simple to get going and then if you do like that public/private feature, it’s available to you. [Fritz]  Yeah, that’s interesting. So it’s almost, you can either go private by convention just by using a standard naming convention or you can actually enforce it by using the prototype pattern. [Dan]  Yeah, that’s exactly right. [Fritz]  So one of the things that I know I run across in JavaScript and I’m curious to get your take on is we do have all these different techniques of encapsulation and each one is really quite different when you’re using closures versus simply, you know, referencing member variables and adding them to your objects that the syntax changes with each pattern and the usage changes. So what would you recommend for people starting out in a brand new JavaScript project? Should they all sort of decide beforehand on what patterns they’re going to stick to or do you change it based on what part of the library you’re working on? I know that’s one of the points of confusion in this space. [Dan]  Yeah, it’s a great question. In fact, I just had a company ask me about that. So which one do I pick and, of course, there’s not one answer fits all. [Fritz]  Right. [Dan]  So it really depends what you just said is absolutely in my opinion correct, which is I think as a, especially if you’re on a team or even if you’re just an individual a team of one, you should go through and pick out which pattern for this particular project you think is best. Now if it were me, here’s kind of the way I think of it. If I were writing a let’s say base library that several web apps are going to use or even one, but I know that there’s going to be some pieces that I’m not really sure on right now as I’m writing I and I know people might want to hook in that and have some better extension points, then I would look at either the prototype pattern or the revealing prototype. Now, really just a real quick summation between the two the revealing prototype also gives you that public/private stuff like the revealing module pattern does whereas the prototype pattern does not but both of the prototype patterns do give you the benefit of that extension or that hook capability. So, if I were writing a library that I need people to override things or I’m not even sure what I need them to override, I want them to have that option, I’d probably pick a prototype, one of the prototype patterns. If I’m writing some code that is very unique to the app and it’s kind of a one off for this app which is what I think a lot of people are kind of in that mode as writing custom apps for customers, then my personal preference is the revealing module pattern you could always go with the module pattern as well which is very close but I think the revealing module patterns a little bit cleaner and we go through that in the course and explain kind of the syntax there and the differences. [Fritz]  Great, that makes a lot of sense. [Fritz]  I appreciate you taking the time, Dan, and I hope everyone takes a chance to look at your course and sort of make these decisions for themselves in their next JavaScript project. Dan’s course is, Structuring JavaScript Code and it’s available now in the Pluralsight Library. So, thank you very much, Dan. [Dan]  Thanks for having me again.

  Read the article

• Free cloud web service development

  - by hyde

  I am looking for a free (as in beer) combination of services, for learning "cloud SW development" and very small scale private use (say, a private streamlined web shopping&todo list with simple auth). The combination should include the full set of needed services: DVCS service (like github) A cloud service to run the backend code A suitable data storage service (preferably not SQL), accessed by the backend (if not included in the backend service) A web service, serving the web pages seen by user, to access the backend functionality A "cloud IDE" (ideally one, two is ok too) for both backend and HTML/javascript coding If (backend) deployment uses some CI, then that Other points: Backend programming language can be anything, except VB or PHP Everything has to be in the cloud, nothing permanent on a local PC (graphics is not part of the question) Looking for ready-to-use service combination, not a virtual server where I can set anything up myself I don't care if service insists on displaying ads in the user web UI "Cheap" and "free trial" are ok too, if "free" does not exist As per example use case, storage, CPU and bandwidth quota requirements are negligible Google finds several services of course, all requiring at least registration before testing, so I'm looking for a known-good combination, so ideal answer starts with "I use this service combo: ...", contains links to services and brief description and personal experiences.

  Read the article

• Globe Trotters: Asian Healthcare CIOs need ‘Security Inside Out’ Approach

  - by Tanu Sood

  In our second edition of Globe trotters, wanted to share a feature article that was recently published in Enterprise Innovation. EnterpriseInnovation.net, part of Questex Media Group, is Asia's premier business and technology publication. The article featured MOH Holdings (a holding company of Singapore’s Public Healthcare Institutions) and highlighted the project around National Electronic Health Record (NEHR) system currently being deployed within Singapore.  According to the feature, the NEHR system was built to facilitate seamless exchanges of medical information as patients move across different healthcare settings and to give healthcare providers more timely access to patient’s healthcare records in Singapore. The NEHR consolidates all clinically relevant information from patients’ visits across the healthcare system throughout their lives and pulls them in as a single record. It allows for data sharing, making it accessible to authorized healthcare providers, across the continuum of care throughout the country. In healthcare, patient data privacy is critical as is the need to avoid unauthorized access to the electronic medical records. As Alan Dawson, director for infrastructure and operations at MOH Holdings is quoted in the feature, “Protecting the perimeter is no longer enough. Healthcare CIOs today need to adopt a ‘security inside out’ approach that protects information assets all the way from databases to end points.” Oracle has long advocated the ‘Security Inside Out’ approach. From operating systems, infrastructure to databases, middleware all the way to applications, organizations need to build in security at every layer and between these layers. This comprehensive approach to security has never been as important as it is today in the social, mobile, cloud (SoMoClo) world. To learn more about Oracle’s Security Inside Out approach, visit our Security page. And for more information on how to prevent unauthorized access, streamline user administration, bolster security and enforce compliance in healthcare, learn more about Oracle Identity Management.

  Read the article

• Turning a board game idea into a browser based, slow paced gameplay

  - by guillaume31

  Suppose I want to create a strategy game with global mutable state shared between all players (think game board). But unlike a board game, I don't want it to be real time action and/or turn-based. Instead, players should be able to log in at any time of the day and spend a fixed number of action points per day as they wish. As opposed to a few hours, game sessions would run over a few weeks. This is meant to reward good strategy rather than time spent playing (as an alternative, hardcore players could always play multiple games in parallel instead) as well as all kind of issues related to live playing like disconnections and synchronization. The game should remain addictive still have a low time investment footprint for casual players. So far so good, but this still leaves open the question of when to solve actions and when they should be visible. I want to avoid "ninja play" like doing all your moves just a few minutes before daily point reset to take other players by surprise, or people spamming F5 to place a well-timed action which would defeat the whole point of a non real-time game. I thought of a couple of approaches to that : Resolve all events in a single scheduled process running once a day. This basically means a "blind" gameplay where players can take actions but don't see their results immediately. The thing is, I played a similar browser game a few years ago and didn't like the fact that you feel disconnected and powerless until there's that deus ex machina telling you what really happened during all that time. You see the world evolve in large increments of one day, which often doesn't seem like seeing it evolve at all. For actions that have an big impact on the game or on other players (attacks, big achievements), make them visible to everyone immediately but delay their effect by something like 24 hours. Opposing players could be notified when such an event happens, so that they can react to it. Do you have any other ideas how I could go about solving this ? Are there any known approaches in similar existing games ?

  Read the article

• Day 2 - Game Design Documentation

  - by dapostolov

  So yesterday I didn't cut any code for my game but I was able to do a tiny bit of research on the XNA Game Development Technology and the communities out there and do you know what? I feel I'm a bit closer to my goal. The bad news is today I didn't cut code either. However, not all is lost because I wanted to get my ideas on paper and today I just did that.  Today, I began to jot down notes about the game and how I felt the visual elements would interact with each other. Unlike my workplace, my personal level of documentation is nothing more than a task list or a mind map of my ideas; it helps me streamline my solutions quiet effectively and circumvent the long process of articulating each thought to the n-th degree. I truly dislike documentation (because I have an extremely hard time articulating my thought and solutions); however, because I tend to do a really good job with documentation I tend to get stuck writing the buggers. But as a generalist remark: 'No Developer likes documentation.' For now let's stick with my basic notes and call this post a living document. Here are my notes, fresh, from after watching the new first episode of Merlin second season! Actually, a quick recommendation to anyone who is reading this (if anyone is): I truly recommend you envelope yourself in the medium or task you're trying to tackle. Be one with moment and feel it! For instance: Are you writing a fantasy script / game? What would the music of the genre sound like? For me the Conan the Barbarian soundtrack by Basil Poledouris is frackin awesome. There are many other good CD's out there, which I listen to (some who even use medival instruments, but Conan I keep returning to. It's a creative trigger for me. Ask yourself what would the imagery look like? Time to surf google for artist renditions of fantasy! What would the game feel like? Start playing some of your favorite games that inspire you, be wary though, have some self control and don't let it absorb your time. Anyhow, onto the documentation... Screens, Scenes, and Sprites. Oh My! (groan...) The first thing that came to mind were the screens, I thought the following would suffice: Menu Screen Character Customisation Screen Loading Screen? Battle Ground The Menu Screen Ok. So, the thought here is when the game loads a huge title is displayed: Wizard Wars. The player is prompted with 3 menu items: 1 Player Game, 2 Player Game, and Exit. Since I'm targetting the PC platform, as a non-networked game to start, I picture myself running my mouse over each menu option and the visual element of the menu item changes, along with a sound to indicate that I am over a curent menu item. And as I move my mouse away, it changes back, and possibly an exit mouse sound. Maybe on the screen somewhere is a brazier alit with a magical tome open right beside it, OR, maybe the tome is the menu! I hear the menu music as mellow, not obtrusive or piercing. On a menu item select, a confirmation sound bellows to indicate the players selection. The Esc key will always return me to the previous screens or desktop. The menu screen must feel...dark, like a really important ritual is about to happen and thus the music should build up. 1 Player Game - > Customize Character(s) 2 Player Game - > Customize Character(s) Exit - > Back to Windows Notes: So the first thing I pick up here are a couple things: First and foremost, my artistic abilities suck crap, so I may have to hire an artist (now that i've said that, lets get techy) graphical objects will be positioned within a scene on each screen / window. Menu items will be represented grapically, possibly animated, and have sound / animation effects triggered by user input or a time line. I have an animated scene involving a brazier or fire on a stick IF I was to move this game to the xbox, I'd have to track which menu item is currently selected (unless I do a mouse pointer type thing.) WindowObject has a scene A Scene has many GameObjects GameObject has a position graphic or animation MenuObject is a GameObject which has a mouse in, mouse out, and click event which either does something graphically (animation), does something with sound, or moves to another screen.  Character Customisation Screen With either the 1 or 2 player option selected, both selections will come to this screen; a wizard requires a name, powers, and vestements of course! Player one will configure his character first and then player two. I considered a split screen for PC but to have two people fighting over a keyboard would probably suck. For XBox, a split screen could work; maybe when I get into the networking portion (phase 2 blog?) of this game I will remove the 2 player option for PC and provide only multiplayer and I will leave 2 player for xbox...hmm... Anyhow...I picture the creation process as follows: Name: (textbox / keyboard entry) - for xbox, this would have to be different. Robe Color: (color box, or something) Stats: Speed, Oomph, and Health. (as sliders) 1 as minimum and 10 as maximum. Ok, Back, and Cancel buttons / options. Each stat has a benefit which are listed below. The idea is the player decides if he wants his wizard to run fast, be a tank and ... hit with a purse.Regardless, the player will have a pool of 12 points to use. Ideally, A balanced wizard will have 5 in each attribute. Spells? The only spell of choice is a ball of fire which comes without question. The music and screen should still feel like a ritual. The Character Speed Basically, how fast your character moves and casts. Oomph (Best Monster Truck Voice): PURE POWAH!!! The damage output of your fireball. Health How much damage you can take. Notes: I realise the game dynamics may sound uninteresting at the moment; but I think after a couple releases, we could have some other grand ideas such as: saved profiles, gold to upgrade arsenal of spells, talents, etc...but for now...a vanilla fireball thrower mage will suffice for this experiment. OK. So... a MenuObject  may need to be loosely coupled to allow future items such as networking? may be a button? a CharacterObject has a name speed oomph health and a funky robe color. cap on the three stats (1-10) an arsenal of 1 spell (possibly could expand this) The Loading Screen As is. The Battleground Screen For now, I'm keeping the screen as max resolution for the PC. The screen isn't going to move or even be a split screen. I'm not aiming high here because I want to see what level of change is involved when new features / concepts are added to game content. I'm interested to find out if we could apply techniques such as MVC or MVVM to this type of development or is it too tightly coupled? This reminds me when when my best friend and I were brainstorming our game idea (this is going back a while...1994, 6?) and he cringed at the thought of bringing business technology into games, especially when I suggested a database to store character information and COM / DCOM as the medium, but it seems I wasn't far off (reflecting); just like his implementation of a xml "config file" for dynamic direct-x menus back before .net in 1999...anyhow...i digress... The Battle One screen, two characters lobing balls of fire at each other...It doesn't get better than that. Every so often a scroll appears...and the fireballs bounce off walls, or the wizard has rapid fire, or even scrolls of healing! The scroll options are endless. Two bars at the top, each the color of the wizard (with their name beside the bar) indicate how much health they have. Possibly the appearance of the scrolls means the battle is taking too long? I'm thinking 1 player controls: up, down, left, right and space to fire the button. Or even possibly, mouse click and shift - mouse button to fire a spell in the direction they are facing. Two player controls: a, s, d, f and space AND arrows (up, down, left, right) and Del key or Crtl. The game ends when a player has 0 health and a dialog box appears asking for a rematch / reconfigure / exit. Health goes down when a fireball (friendly or not), connects with a wizard. When a wizard connects with a scroll, a countdown clock / icon appears near the health bar and the wizard begins to glow. For the most part, a wizard can have only scroll 1 effect on him at a time. Notes: Ok, there's alot to cover here. a CharacterObject is a GameObject it travels at a set velocity it travels in a direction it has sounds (walking, running, casting, impact, dying, laughing, whistling, other?) it has animations (walking, running, casting, impact, dying, laughing, idle, other?) it has a lifespan (determined by health) it is alive or dead it has a position a ScrollObject is a GameObject it carries a transferance of points "damage" (or healing, bad scroll effect?) (determinde by caster) it carries a transferance of "other" it is stationary it has a sound on impact it has a stationary animation it has an impact animation / or transfers an impact animation it has a fade animation? it has a lifespan (determined by game) it is alive or dead it has a position a WallObject is a GameObject it has a sound on fireball impact? it is a still image / stationary it has an impact animation / or transfers an impact animation it is dead it has a position A FireBall is a GameObject it carries a transferance of poinst "damage" (or healing, bad scroll effect?) (determinde by caster) it travels at a set velocity it travels in a direction it has a sound it has a travel animation it has an impact animation / or transfers an impact animation it has a fade animation? it has a lifespan (determined by caster) it is alive or dead it has a position As I look at this, I can see some common attributes in each object that I can carry up to the GameObject. I think I'm going to end the documentation here, it's taken me a bit of time to type this all out, tomorrow. I'll load up my IDE and my paint studio to get some good old fashioned cowboy hacking going!   D.

  Read the article

• Do game-theoretic considerations stand in the way of this market-based game-mechanic achieving its goals?

  - by BerndBrot

  Mechanic The mechanic is called "market manipulation" and is supposed to work like this: Players can enter the London Stock Exchange (LSE) LSE displays the stock prices of 8 to 10 companies and derivatives. This number is relatively small to ensure that players will collide in their efforts to manipulate the market in their favor. The prices are calculated based on real world prices of these companies and derivatives (in real time) any market manipulations that were conducted by the players any market corrections of the system Players can buy and sell shares with cash, a resource in the game, at current in-game market value Players can manipulate the market, i.e. let the price of a share either rise or fall, by some amount, over a certain period of time. Manipulating the market requires spending certain in-game resources and is therefore limited. The system continuously corrects market manipulations by letting the in-game prices converge towards their real world counterparts at a rate of 2% of the difference between the two per hour. Because of this market correction mechanism, pushing up prices (and screwing down prices) becomes increasingly difficult the higher (lower) the price already is. Goals Players are supposed to collide (and have incentives to collide) in their efforts to manipulate the market in their favor, especially when it comes to manipulation efforts by different groups. Prices should not resolve around any equilibrium points. The more variance the better. Band-wagoning should always involve risk (recognizing that prices start rising should not be a sure sign that they will keep rising so that everybody can make easy profits even when they don't manipulate the market themselves) Question Are there any game-theoretic considerations that prevent the mechanic from achieving these goals?

  Read the article

• SQLAuthority News – Guest Post – FAULT Contract in WCF with Learning Video

  - by pinaldave

  This is guest post by one of my very good friends and .NET MVP, Dhananjay Kumar. The very first impression one gets when they meet him is his politeness. He is an extremely nice person, but has superlative knowledge in .NET and is truly helpful to all of us. Objective: This article will give a basic introduction on: How to handle Exception at service side? How to use Fault contract at Service side? How to handle Service Exception at client side? A Few Points about Exception at Service Exception is technology-specific. Exception should not be shared beyond service boundary. Since Exception is technology-specific, it cannot be propagated to other clients. Exception is of many types. CLR Exception Windows32 Exception Runtime Exception at service C++ Exception Exception is very much native to the technology in which service is made. Exception must be converted from technology-specific information to natural information that can be communicated to the client. SOAP Fault FaultException<T> Service should throw FaultException<T>, instead of the usual CLR exception. FaultException<T> is a specialization of Fault Exception. Any client that programs against FaultException can handle the Exception thrown by FaultException<T>. The type parameter T conveys the error detail. T can be of any type like Exception, CLR Type or any type that can be serialized. T can be of type Data contract. T is a generic parameter that conveys the error details. You can read complete article http://dhananjaykumar.net/2010/05/23/fault-contract-in-wcf-with-learning-video/ Reference: Pinal Dave (http://blog.sqlauthority.com) Filed under: SQL, SQL Authority, SQL Query, SQL Server, SQL Tips and Tricks, SQLAuthority News, T SQL, Technology

  Read the article

• Using Microsoft's Chart Controls In An ASP.NET Application: Serializing Chart Data

  In most usage scenarios, the data displayed in a Microsoft Chart control comes from some dynamic source, such as from a database query. The appearance of the chart can be modified dynamically, as well; past installments in this article series showed how to programmatically customize the axes, labels, and other appearance-related settings. However, it is possible to statically define the chart's data and appearance strictly through the control's declarative markup. One of the demos examined in the Getting Started article rendered a column chart with seven columns whose labels and values were defined statically in the <asp:Series> tag's <Points> collection. Given this functionality, it should come as no surprise that the Microsoft Chart Controls also support serialization. Serialization is the process of persisting the state of a control or an object to some other medium, such as to disk. Deserialization is the inverse process, and involves taking the persisted data and recreating the control or object. With just a few lines of code you can persist the appearance settings, the data, or both to a file on disk or to any stream. Likewise, it takes just a few lines of codes to reconstitute a chart from the persisted information. This article shows how to use the Microsoft Chart Control's serialization functionality by examining a demo application that allows users to create custom charts, specifying the data to plot and some appearance-related settings. The user can then save a "snapshot" of this chart, which persists its appearance and data to a record in a database. From another page, users can view these saved chart snapshots. Read on to learn more! Read More >

  Read the article

• Queued Loadtest to remove Concurrency issues using Shared Data Service in OpenScript

  - by stefan.thieme(at)oracle.com

  Queued Processing to remove Concurrency issues in Loadtest ScriptsSome scripts act on information returned by the server, e.g. act on first item in the returned list of pending tasks/actions. This may lead to concurrency issues if the virtual users simulated in a load test scenario are not synchronized in some way.As the load test cases should be carried out in a comparable and straight forward manner simply cancel a transaction in case a collision occurs is clearly not an option. In case you increase the number of virtual users this approach would lead to a high number of requests for the early steps in your transaction (e.g. login, retrieve list of action points, assign an action point to the virtual user) but later steps would be rarely visited successfully or at all, depending on the application logic.A way to tackle this problem is to enqueue the virtual users in a Shared Data Service queue. Only the first virtual user in this queue will be allowed to carry out the critical steps (retrieve list of action points, assign an action point to the virtual user) in your transaction at any one time.Once a virtual user has passed the critical path it will dequeue himself from the head of the queue and continue with his actions. This does theoretically allow virtual users to run in parallel all steps of the transaction which are not part of the critical path.In practice it has been seen this is rarely the case, though it does not allow adding more than N users to perform a transaction without causing delays due to virtual users waiting in the queue. N being the time of the total transaction divided by the sum of the time of all critical steps in this transaction.While this problem can be circumvented by allowing multiple queues to act on individual segments of the list of actions, e.g. per country filter, ends with 0..9 filter, etc.This would require additional handling of these additional queues of slots for the virtual users at the head of the queue in order to maintain the mutually exclusive access to the first element in the list returned by the server at any one time of the load test. Such an improved handling of multiple queues and/or multiple slots is above the subject of this paper.Shared Data Services Pre-RequisitesStart WebLogic Server to host Shared Data ServicesYou will have to make sure that your WebLogic server is installed and started. Shared Data Services may not work if you installed only the minimal installation package for OpenScript. If however you installed the default package including OLT and OTM, you may follow the instructions below to start and verify WebLogic installation.To start the WebLogic Server deployed underneath of Oracle Load Testing and/or Oracle Test Manager you can go to your Start menu, Oracle Application Testing Suite and select the Restart Oracle Application Testing Suite Application Service entry from the Tools submenu.To verify the service has been started you can run the Microsoft Management Console for Services by Selecting Run from the Start Menu and entering services.msc. Look for the entry that reads Oracle Application Testing Suite Application Service, once it has changed it status from Starting to Started you can proceed to verify the login. Please note that this may take several minutes, I would say up to 10 minutes depending on the strength of your CPU horse-power.Verify WebLogic Server user credentialsYou will have to make sure that your WebLogic Server is installed and started. Next open the Oracle WebLogic Server Adminstration Console on http://localhost:8088/console.It may take a while until the application is deployed and started. It may display the following until the Administration Console has been deployed on the fly.Afterwards you can login using the username oats and the password that you selected during install time for your Application Testing Suite administrative purposes.This will bring up the Home page of you WebLogic Server. You have actually verified that you are able to login with these credentials already. However if you want to check the details, navigate to Security Realms, myrealm, Users and Groups tab.Here you could add users to your WebLogic Server which could be used in the later steps. Details on the Groups required for such a custom user to work are exceeding this quick overview and have to be selected with the WebLogic Server Adminstration Guide in mind.Shared Data Services pre-requisites for Load testingOpenScript Preferences have to be set to enable Encryption and provide a default Shared Data Service Connection for Playback.These are pre-requisites you want to use for load testing with Shared Data Services.Please note that the usage of the Connection Parameters (individual directive in the script) for Shared Data Services did not playback reliably in the current version 9.20.0370 of Oracle Load Testing (OLT) and encryption of credentials still seemed to be mandatory as well.General Encryption settingsSelect OpenScript Preferences from the View menu and navigate to the General, Encryption entry in the tree on the left. Select the Encrypt script data option from the list and enter the same password that you used for securing your WebLogic Server Administration Console.Enable global shared data access credentialsSelect OpenScript Preferences from the View menu and navigate to the Playback, Shared Data entry in the tree on the left. Enable the global shared data access credentials and enter the Address, User name and Password determined for your WebLogic Server to host Shared Data Services.Please note, that you may want to replace the localhost in Address with the hosts realname in case you plan to run load tests with Loadtest Agents running on remote systems.Queued Processing of TransactionsEnable Shared Data Services Module in Script PropertiesThe Shared Data Services Module has to be enabled for each Script that wants to employ the Shared Data Service Queue functionality in OpenScript. It can be enabled under the Script menu selecting Script Properties. On the Script Properties Dialog select the Modules section and check Shared Data to enable Shared Data Service Module for your script. Checking the Shared Data Services option will effectively add a line to your script code that adds the sharedData ScriptService to your script class of IteratingVUserScript.@ScriptService oracle.oats.scripting.modules.sharedData.api.SharedDataService sharedData;Record your scriptRecord your script as usual and then add the following things for Queue handling in the Initialize code block, before the first step and after the last step of your critical path and in the Finalize code block.The java code to be added at individual locations is explained in the following sections in full detail.Create a Shared Data Queue in InitializeTo create a Shared Data Queue go to the Java view of your script and enter the following statements to the initialize() code block.info("Create queueA with life time of 120 minutes");sharedData.createQueue("queueA", 120);This will create an instantiation of the Shared Data Queue object named queueA which is maintained for upto 120 minutes.If you want to use the code for multiple scripts, make sure to use a different queue name for each one here and in the subsequent steps. You may even consider to use a dynamic queueName based on filters of your result list being concurrently accessed.Prepare a unique id for each IterationIn order to keep track of individual virtual users in our queue we need to create a unique identifier from the virtual user id and the used username right after retrieving the next record from our databank file.getDatabank("Usernames").getNextDatabankRecord();getVariables().set("usernameValue1","VU_{{@vuid}}_{{@iterationnum}}_{{db.Usernames.Username}}_{{@timestamp}}_{{@random(10000)}}");String usernameValue = getVariables().get("usernameValue1");info("Now running virtual user " + usernameValue);As you can see from the above code block, we have set the OpenScript variable usernameValue1 to VU_{{@vuid}}_{{@iterationnum}}_{{db.Usernames.Username}}_{{@timestamp}}_{{@random(10000)}} which is a concatenation of the virtual user id and the iterationnumber for general uniqueness; as well as the username from our databank, the timestamp and a random number for making it further unique and ease spotting of errors.Not all of these fields are actually required to make it really unique, but adding the queue name may also be considered to help troubleshoot multiple queues.The value is then retrieved with the getVariables.get() method call and assigned to the usernameValue String used throughout the script.Please note that moving the getDatabank("Usernames").getNextDatabankRecord(); call to the initialize block was later considered to remove concurrency of multiple virtual users running with the same userid and therefor accessing the same "My Inbox" in step 6. This will effectively give each virtual user a userid from the databank file. Make sure you have enough userids to remove this second hurdle.Enqueue and attend Queue before Critical PathTo maintain the right order of virtual users being allowed into the critical path of the transaction the following pseudo step has to be added in front of the first critical step. In the case of this example this is right in front of the step where we retrieve the list of actions from which we select the first to be assigned to us.beginStep("[0] Waiting in the Queue", 0);{info("Enqueued virtual user " + usernameValue + " at the end of queueA");sharedData.offerLast("queueA", usernameValue);info("Wait until the user is the first in queueA");String queueValue1 = null;do {// we wait for at least 0.7 seconds before we check the head of the// queue. This is the time it takes one user to move through the// critical path, i.e. pass steps [5] Enter country and [6] Assign// to meThread.sleep(700);queueValue1 = (String) sharedData.peekFirst("queueA");info("The first user in queueA is currently: '" + queueValue1 + "' " + queueValue1.getClass() + " length " + queueValue1.length() );info("The current user is '"+ usernameValue + "' " + usernameValue.getClass() + " length " + usernameValue.length() + ": indexOf " + usernameValue.indexOf(queueValue1) + " equals " + usernameValue.equals(queueValue1) );} while ( queueValue1.indexOf(usernameValue) < 0 );info("Now the user is the first in queueA");}endStep();This will enqueue the username to the tail of our Queue. It will will wait for at least 700 milliseconds, the time it takes for one user to exit the critical path and then compare the head of our queue with it's username. This last step will be repeated while the two are not equal (indexOf less than zero). If they are equal the indexOf will yield a value of zero or larger and we will perform the critical steps.Dequeue after Critical PathAfter the virtual user has left the critical path and complete its last step the following code block needs to dequeue the virtual user. In the case of our example this is right after the action has been actually assigned to the virtual user. This will allow the next virtual user to retrieve the list of actions still available and in turn let him make his selection/assignment.info("Get and remove the current user from the head of queueA");String pollValue1 = (String) sharedData.pollFirst("queueA");The current user is removed from the head of the queue. The next one will now be able to match his username against the head of the queue.Clear and Destroy Queue for FinishWhen the script has completed, it should clear and destroy the queue. This code block can be put in the finish block of your script and/or in a separate script in order to clear and remove the queue in case you have spotted an error or want to reset the queue for some reason.info("Clear queueA");sharedData.clearQueue("queueA");info("Destroy queueA");sharedData.destroyQueue("queueA");The users waiting in queueA are cleared and the queue is destroyed. If you have scripts still executing they will be caught in a loop.I found it better to maintain a separate Reset Queue script which contained only the following code in the initialize() block. I use to call this script to make sure the queue is cleared in between multiple Loadtest runs. This script could also even be added as the first in a larger scenario, which would execute it only once at very start of the Loadtest and make sure the queues do not contain any stale entries.info("Create queueA with life time of 120 minutes");sharedData.createQueue("queueA", 120);info("Clear queueA");sharedData.clearQueue("queueA");This will create a Shared Data Queue instance of queueA and clear all entries from this queue.Monitoring QueueWhile creating the scripts it was useful to monitor the contents, i.e. the current first user in the Queue. The following code block will make sure the Shared Data Queue is accessible in the initialize() block.info("Create queueA with life time of 120 minutes");sharedData.createQueue("queueA", 120);In the run() block the following code will continuously monitor the first element of the Queue and write an informational message with the current username Value to the Result window.info("Monitor the first users in queueA");String queueValue1 = null;do {queueValue1 = (String) sharedData.peekFirst("queueA");if (queueValue1 != null)info("The first user in queueA is currently: '" + queueValue1 + "' " + queueValue1.getClass() + " length " + queueValue1.length() );} while ( true );This script can be run from OpenScript parallel to a loadtest performed by the Oracle Load Test.However it is not recommend to run this in a production loadtest as the performance impact is unknown. Accessing the Queue's head with the peekFirst() method has been reported with about 2 seconds response time by both OpenScript and OTL. It is advised to log a Service Request to see if this could be lowered in future releases of Application Testing Suite, as the pollFirst() and even offerLast() writing to the tail of the Queue usually returned after an average 0.1 seconds.Debugging QueueWhile debugging the scripts the following was useful to remove single entries from its head, i.e. the current first user in the Queue. The following code block will make sure the Shared Data Queue is accessible in the initialize() block.info("Create queueA with life time of 120 minutes");sharedData.createQueue("queueA", 120);In the run() block the following code will remove the first element of the Queue and write an informational message with the current username Value to the Result window.info("Get and remove the current user from the head of queueA");String pollValue1 = (String) sharedData.pollFirst("queueA");info("The first user in queueA was currently: '" + pollValue1 + "' " + pollValue1.getClass() + " length " + pollValue1.length() );ReferencesOracle Functional Testing OpenScript User's Guide Version 9.20 [E15488-05]Chapter 17 Using the Shared Data Modulehttp://download.oracle.com/otn/nt/apptesting/oats-docs-9.21.0030.zipOracle Fusion Middleware Oracle WebLogic Server Administration Console Online Help 11g Release 1 (10.3.4) [E13952-04]Administration Console Online Help - Manage users and groupshttp://download.oracle.com/docs/cd/E17904_01/apirefs.1111/e13952/taskhelp/security/ManageUsersAndGroups.htm

  Read the article

• DirectCompute

  In my previous blog post I introduced the concept of GPGPU ending with:On Windows, there is already a cross-GPU-vendor way of programming GPUs and that is the Direct X API. Specifically, on Windows Vista and Windows 7, the DirectX 11 API offers a dedicated subset of the API for GPGPU programming: DirectCompute. You use this API on the CPU side, to set up and execute the kernels on the GPU. The kernels are written in a language called HLSL (High Level Shader Language). You can use DirectCompute with HLSL to write a "compute shader", which is the term DirectX uses for what I've been referring to in this post as "kernel".In this post I want to share some links to get you started with DirectCompute and HLSL.1. Watch the recording of the PDC 09 session: DirectX11 DirectCompute.2. If session recordings is your thing there are two more on DirectCompute from nvidia's GTC09 conference 1015 (pdf, mp4) and 1411 (mp4 plus the presenter's written version of the session).3. Over at gamedev there is an old Compute Shader tutorial. At the same site, there is a 3-part blog post on Compute Shader: Introduction, Resources and Addressing.4. From PDC, you can also download the DirectCompute Hands On Lab.5. When you are ready to get your hands even dirtier, download the latest Windows DirectX SDK (at the time of writing the latest is dated Feb 2010).6. Within the SDK you'll find a Compute Shader Overview and samples such as: Basic, Sort, OIT, NBodyGravity, HDR Tone Mapping.7. Talking of DX11/DirectCompute samples, there are also a couple of good ones on this URL.8. The documentation of the various APIs is available online. Here are just some good (but far from complete) taster entry points into that: numthreads, SV_DispatchThreadID, SV_GroupThreadID, SV_GroupID, SV_GroupIndex, D3D11CreateDevice, D3DX11CompileFromFile, CreateComputeShader, Dispatch, D3D11_BIND_FLAG, GSSetShader. Comments about this post welcome at the original blog.

  Read the article

< Previous Page | 178 179 180 181 182 183 184 185 186 187 188 189  | Next Page >