Search Results

Search found 17336 results on 694 pages for 'richard long'.

Page 183/694 | < Previous Page | 179 180 181 182 183 184 185 186 187 188 189 190  | Next Page >

• Setting acquired location to a text view: How to maintain?

  - by Mark

  Hi, I have built an app for the Motorola Droid which should automatically update a server with the phone's location. After the user performs a particular task on the main activity screen, an alarm is set to update the user's location periodically, using a service. The alarm is explicitly stopped when the user completes another task. Thing is, I have set up a location manager within the main activity's onCreate() method which is supposed to place the first acquired lat/long into two textview fields. Even though the manifest is set up for acquiring coarse and fine coords and I'm using requestLocationUpdates (String provider, long minTime, float minDistance, LocationListener listener), with minTime and minDistance set to zero, I'm not seeing the coords coming up on the screen. With that, I'm not recording any locations on the server. When I seed the textviews with sample coords, they are being recorded fine on the server. I am not at a computer that can run the IDE, so don't currently have the code, but am desperate for some help on this. One other thing is that the main activity screen calls a photography app before the user manually clicks "send data". I'm suspicious that I may need to override the main activity's onResume() method to do this location acquisition. Please help, thanks. Mark.

  Read the article

• Thread Safety of C# List<T> for readers

  - by ILIA BROUDNO

  I am planning to create the list once in a static constructor and then have multiple instances of that class read it (and enumerate through it) concurrently without doing any locking. In this article http://msdn.microsoft.com/en-us/library/6sh2ey19.aspx MS describes the issue of thread safety as follows: Public static (Shared in Visual Basic) members of this type are thread safe. Any instance members are not guaranteed to be thread safe. A List can support multiple readers concurrently, as long as the collection is not modified. Enumerating through a collection is intrinsically not a thread-safe procedure. In the rare case where an enumeration contends with one or more write accesses, the only way to ensure thread safety is to lock the collection during the entire enumeration. To allow the collection to be accessed by multiple threads for reading and writing, you must implement your own synchronization. The "Enumerating through a collection is intrinsically not a thread-safe procedure." Statement is what worries me. Does this mean that it is thread safe for readers only scenario, but as long as you do not use enumeration? Or is it safe for my scenario?

  Read the article

• JAVA Procedure Error

  - by Sam....

  java.sql.SQLException: [Microsoft][SQLServer 2000 Driver for JDBC][SQLServer]Procedure 'STP_Insert_tblReceipt' expects parameter '@CPVFlag', which was not supplied. I m getting error at This Point when trying to call procedure... Everything is perfect ,,,Count of Question marks are similar to parameter provided cs = conn.prepareCall("{call STP_Insert_tblReceipt(?,?,?, ?,?,?, ?,?,?, ?,?,?, ?,?,?, ?,?,?, ?,?,?, ?,?,?, ?,?,?)}"); // cs = conn.prepareCall("{call STP_Receipt_Form_Insertion_Trial(?,?,?, ?,?,?, ?,?,?, ?,?,?, ?)}"); cs.setLong(1, Long.parseLong(txtMobileNo.getText())); cs.setString(2, String.valueOf(cboDistributor.getSelectedItem())); cs.setLong(3, Long.parseLong(txtBoxNo.getText())); cs.setInt(4, Integer.parseInt(txtFileNo.getText())); cs.setString(5, pickUp_date); cs.setString(6, rec_date); cs.setString(7, String.valueOf(cmbCtrlNo.getSelectedItem())); cs.setString(8, UserName); cs.setString(9, rec_date); cs.setString(10, RegionLocation); cs.setString(11, txtRemark.getText().trim()); cs.setString(12, txtSimNo.getText().trim()); cs.setInt(13, 2); cs.setString(14, String.valueOf(cmbAryanRegion.getSelectedItem())); cs.setString(15, String.valueOf(cboPickUpType.getSelectedItem())); cs.setString(16, String.valueOf(txtCafNo.getText())); cs.setString(17, distributorId); //cs.setString(18, circleName); cs.setString(18, cboCircle.getSelectedItem().toString()); cs.registerOutParameter(19, java.sql.Types.INTEGER); cs.setString(20, auditorName); cs.setString(21, retailerName); cs.setString(22, retailerCode); cs.setInt(23, mappedFlag); //cs.setString(24, distCode); cs.setString(24, cboDistCode.getSelectedItem().toString()); //cs.setString(25, zoneName); cs.setString(25, cboZone.getSelectedItem().toString()); cs.setString(26, comment); **cs.setInt(27, 1);** **this is for CPV Flag** After this cs.execute();

  Read the article

• Using "wildcards" in a vlist array to delete rows in Excel

  - by KMinner

  Good Morning All, I'm trying to setup a vba macro to delete all user IDs out of a spreadsheet that do not start with designated prefixes (e.g. US, A1, VM, etc). The below block of code was found on the Code Library and looks to be what I need but there is one problem: When I enter in UserID prefixes into the vlist fields, it treats them as absolute rather then a part of the string that I want to keep. Is there a way to incorporate wildcards into a vlist? Sub Example1() Dim vList Dim lLastRow As Long, lCounter As Long Dim rngToCheck As Range, rngFound As Range, rngToDelete As Range Application.ScreenUpdating = False With Sheet1 lLastRow = Get_Last_Row(.Cells) If lLastRow > 1 Then vList = Array("US", "A1", "EG", "VM") 'we don't want to delete our header row With .Range("A2:A" & lLastRow) For lCounter = LBound(vList) To UBound(vList) Set rngFound = .Find( _ what:=vList(lCounter), _ lookat:=xlWhole, _ searchorder:=xlByRows, _ searchdirection:=xlNext, _ MatchCase:=True) 'check if we found a value we want to keep If rngFound Is Nothing Then 'there are no cells to keep with this value If rngToDelete Is Nothing Then Set rngToDelete = .Cells Else 'if there are no cells with a different value then 'we will get an error On Error Resume Next If rngToDelete Is Nothing Then Set rngToDelete = .ColumnDifferences(Comparison:=rngFound) Else Set rngToDelete = Intersect(rngToDelete, .ColumnDifferences(Comparison:=rngFound)) End If On Error GoTo 0 End If Next lCounter End With If Not rngToDelete Is Nothing Then rngToDelete.EntireRow.Delete End If End With Application.ScreenUpdating = True End Sub

  Read the article

• How safe and reliable are C++ String Literals?

  - by DoctorT

  So, I'm wanting to get a better grasp on how string literals in C++ work. I'm mostly concerned with situations where you're assigning the address of a string literal to a pointer, and passing it around. For example: char* advice = "Don't stick your hands in the toaster."; Now lets say I just pass this string around by copying pointers for the duration of the program. Sure, it's probably not a good idea, but I'm curious what would actually be going on behind the scenes. For another example, let's say we make a function that returns a string literal: char* foo() { // function does does stuff return "Yikes!"; // somebody's feeble attempt at an error message } Now lets say this function is called very often, and the string literal is only used about half the time it's called: // situation #1: it's just randomly called without heed to the return value foo(); // situation #2: the returned string is kept and used for who knows how long char* retVal = foo(); In the first situation, what's actually happening? Is the string just created but not used, and never deallocated? In the second situation, is the string going to be maintained as long as the user finds need for it? What happens when it isn't needed anymore... will that memory be freed up then (assuming nothing points to that space anymore)? Don't get me wrong, I'm not planning on using string literals like this. I'm planning on using a container to keep my strings in check (probably std::string). I'm mostly just wanting to know if these situations could cause problems either for memory management or corrupted data.

  Read the article

• Packet fragmentation when sending data via SSLStream

  - by Ive

  When using an SSLStream to send a 'large' chunk of data (1 meg) to a (already authenticated) client, the packet fragmentation / dissasembly I'm seeing is FAR greater than when using a normal NetworkStream. Using an async read on the client (i.e. BeginRead()), the ReadCallback is repeatedly called with exactly the same size chunk of data up until the final packet (the remainder of the data). With the data I'm sending (it's a zip file), the segments happen to be 16363 bytes long. Note: My receive buffer is much bigger than this and changing it's size has no effect I understand that SSL encrypts data in chunks no bigger than 18Kb, but since SSL sits on top of TCP, I wouldn't think that the number of SSL chunks would have any relevance to the TCP packet fragmentation? Essentially, the data is taking about 20 times longer to be fully read by the client than with a standard NetworkStream (both on localhost!) What am I missing? EDIT: I'm beginning to suspect that the receive (or send) buffer size of an SSLStream is limited. Even if I use synchronous reads (i.e. SSLStream.Read()), no more data ever becomes available, regardless of how long I wait before attempting to read. This would be the same behavior as if I were to limit the receive buffer to 16363 bytes. Setting the Underlying NetworkStream's SendBufferSize (on the server), and ReceiveBufferSize (on the client) has no effect.

  Read the article

• How to store unlimited characters in Oracle 11g?

  - by vicky21

  We have a table in Oracle 11g with a varchar2 column. We use a proprietary programming language where this column is defined as string. Maximum we can store 2000 characters (4000 bytes) in this column. Now the requirement is such that the column needs to store more than 2000 characters (in fact unlimited characters). The DBAs don't like BLOB or LONG datatypes for maintenance reasons. The solution that I can think of is to remove this column from the original table and have a separate table for this column and then store each character in a row, in order to get unlimited characters. This tble will be joined with the original table for queries. Is there any better solution to this problem? UPDATE: The proprietary programming language allows to define variables of type string and blob, there is no option of CLOB. I understand the responses given, but I cannot take on the DBAs. I understand that deviating from BLOB or LONG will be developers' nightmare, but still cannot help it.

  Read the article

• array of structures, or structure of arrays?

  - by Jason S

  Hmmm. I have a table which is an array of structures I need to store in Java. The naive don't-worry-about-memory approach says do this: public class Record { final private int field1; final private int field2; final private long field3; /* constructor & accessors here */ } List<Record> records = new ArrayList<Record>(); If I end up using a large number ( 106 ) of records, where individual records are accessed occasionally, one at a time, how would I figure out how the preceding approach (an ArrayList) would compare with an optimized approach for storage costs: public class OptimizedRecordStore { final private int[] field1; final private int[] field2; final private long[] field3; Record getRecord(int i) { return new Record(field1[i],field2[i],field3[i]); } /* constructor and other accessors & methods */ } edit: assume the # of records is something that is changed infrequently or never I'm probably not going to use the OptimizedRecordStore approach, but I want to understand the storage cost issue so I can make that decision with confidence. obviously if I add/change the # of records in the OptimizedRecordStore approach above, I either have to replace the whole object with a new one, or remove the "final" keyword. kd304 brings up a good point that was in the back of my mind. In other situations similar to this, I need column access on the records, e.g. if field1 and field2 are "time" and "position", and it's important for me to get those values as an array for use with MATLAB, so I can graph/analyze them efficiently.

  Read the article

• [hibernate - jpa] @OneToOne annotoation problem (i think...)

  - by blow

  Hi all, im new in hibernate and JPA and i have some problems with annotations. My target is to create this table in db (PERSON_TABLE with personal-details) ID ADDRESS NAME SURNAME MUNICIPALITY_ID First of all, i have a MUNICIPALITY table in db containing all municipality of my country. I mapped this table in this ENTITY: @Entity public class Municipality implements Serializable { @Id @GeneratedValue(strategy=GenerationType.IDENTITY) private Long id; private String country; private String province; private String name; @Column(name="cod_catasto") private String codCatastale; private String cap; public Municipality() { } ... Then i make an EMBEDDABLE class Address containing fields that realize a simple address... @Embeddable public class Address implements Serializable { @OneToOne(cascade=CascadeType.ALL) @JoinColumn(name="id_municipality") private Municipality municipality; @Column(length=45) private String address; public Address() { } ... Finally i embedded this class into Person ENTITY @Entity public class Person implements Serializable { @Id @GeneratedValue(strategy=GenerationType.IDENTITY) private Long id; private String name; private String surname; @Embedded private Address address; public Person() { } ... All works good when i have to save a new Person record, in fact hibernate creates a PERSON_TABLE as i want, but if i try to retrieve a Person record i have an exception. HQL is simply "from Person" The excpetion is (Entities is the package containing all classes above-mentioned): org.hibernate.AnnotationException: @OneToOne or @ManyToOne on Entities.Person.address.municipality references an unknown entity: Entities.Municipality Is the @OneToOne annotation the problem? Thanks.

  Read the article

• Dynamically changing background color of a UIView

  - by EricM

  Hello- Here's my setup. I have a viewcontroller that I'm creating and adding as a subview. The viewcontroller presents some options that a user can chose from. The viewcontroller is being pushed in response to a "long press" gesture. Within the viewcontroller, I added a child UIView to group some other controls together so I can move them around the screen as a unit and, when they are displayed, center them on the location of the long press. Here is the code that instantiates the view controller, changes its location, and adds it as a subview: UserOptions *opts = [[UserOptions alloc] initWithNibName:@"UserOptions" bundle:nil]; [opts recenterOptions:location]; [self.view addSubview:opts.view]; That bit of code does create and push the viewcontroller, but the call to recenterOptions doesn't do anything. Here is that method: - (void) recenterOptions:(CGPoint)location { CGRect oldFrame = self.optionsView.frame; CGFloat newX = location.x; // + oldFrame.size.width / 2.0; CGFloat newY = location.y; // + oldFrame.size.height / 2.0; CGRect newFrame = CGRectMake(newX, newY, oldFrame.size.width, oldFrame.size.height); self.optionsView.frame = newFrame; } Note that self.optionsView is the child UIView that I added to the viewcontroller's nib. Does anyone know why I'm unable to change the location of the UIView? Regards, Eric

  Read the article

• How to use Java on Google App Engine without exceeding minute quotas?

  - by Geo

  A very simple java code inside a doGet() servlet is getting more than a second of cpu time on GAE. I have read some quota related documentation and apparently I am not doing anything wrong. //Request the user Agent info String userAgent = req.getHeader("User-Agent"); I wanted to know what was using the CPU the most, I use a google help recommendation. //The two lines below will get the CPU before requesting User-Agent Information QuotaService qs = QuotaServiceFactory.getQuotaService(); long start = qs.getCpuTimeInMegaCycles(); //Request the user Agent info String userAgent = req.getHeader("User-Agent"); //The three lines below will get the CPU after requesting User-Agent Information // and informed it to the application log. long end = qs.getCpuTimeInMegaCycles(); double cpuSeconds = qs.convertMegacyclesToCpuSeconds(end - start); log.warning("CPU Seconds on geting User Agent: " + cpuSeconds); The only thing that the code above tells me is that inspecting the header will use more than a second (1000ms) of cpu time, which for Google is a warning on the log panel. That seems to be a very simple request and still is using more than a second of cpu. What I am missing?

  Read the article

• Latex - Apply an operation to every character in a string

  - by hroest

  Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

  Read the article

• Android: onListItemClick not opening up the .xml file

  - by Capsud

  Hi, public void onListItemClick(ListView l, View v, int position, long id) { if(position == 0){ setContentView(R.layout.cuisine); } } I have an array of Strings and i'm using the above method to try and open up a new xml file called 'cuisine' when it is clicked. but it keeps failing! Have I done this right, or what am I doing wrong? Thanks. Ok from looking at similar problems on the web, people have said to get the onListItemClick() to start a new activity and using that new activity to then open up the new view? So what i've done is this... protected void onListItemClick(ListView l, View v, int position, long id) { Intent dundrumIntent = new Intent(v.getContext(), DundrumSelector.class); dundrumIntent.putExtra("position", position); startActivityForResult(dundrumIntent, 0); } and then import android.app.Activity; import android.os.Bundle; public class DundrumSelector extends Activity { @Override public void onCreate(Bundle savedInstanceState){ super.onCreate(savedInstanceState); int position = getIntent().getExtras().getInt("position"); if(position == 0){ setContentView(R.layout.cuisine); } } } Yet i'm still getting the same problem. The program crashes when I click on an item in the listView. And yes i've added the activity to the manifest. Does anyone have a resolution to this as alot of people seem to be having the same problem. Thanks alot.

  Read the article

• How can I get the type I want?

  - by Danny Chen

  There are a lot of such classes in my project (very old and stable code, I can't do many changes to them, maybe slight changes are OK) public class MyEntity { public long ID { get; set; } public string Name { get; set; } public decimal Salary { get; set; } public static GetMyEntity ( long ID ) { MyEntity e = new MyEntity(); // load data from DB and bind to this instance return e; } } For some reasons, now I need to do this: Type t = Type.GetType("XXX"); // XXX is one of the above classes' name MethodInfo staticM= t.GetMethods(BindingFlags.Public | BindingFlags.Static).FirstOrDefault();// I'm sure I can get the correct one var o = staticM.Invoke(...); //returns a object, but I want the type above! If I pass "MyEntity" at beginning, I hope I can get o as MyEntity! Please NOTE that I know the "name of the class" only. MyEntity e = staticM.Invoke(...) as MyEntity; can't be used here.

  Read the article

• How Can I Find a List of All Exceptions That a Given Library Function Throws in Python?

  - by b14ck

  Sorry for the long title, but it seems most descriptive for my question. Basically, I'm having a difficult time finding exception information in the official python documentation. For example, in one program I'm currently writing, I'm using the shutil libary's move function: from shutil import move move('somefile.txt', '/tmp/somefile.txt') That works fine, as long as I have write access to /tmp/, there is enough diskspace, and if all other requirements are satisfied. However, when writing generic code, it is often difficult to guarantee those factors, so one usually uses exceptions: from shutil import move try: move('somefile.txt', '/tmp/somefile.txt') except: print 'Move failed for some reason.' I'd like to actually catch the appropriate exceptions thrown instead of just catching everything, but I simply can't find a list of exceptions thrown for most python modules. Is there a way for me to see which exceptions a given function can throw, and why? This way I can make appropriate cases for each exception, eg: from shutil import move try: move('somefile.txt', '/tmp/somefile.txt') except PermissionDenied: print 'No permission.' except DestinationDoesNotExist: print "/tmp/ doesn't exist" except NoDiskSpace: print 'No diskspace available.' Answer points go to whoever can either link me to some relevant documentation that I've somehow overlooked in the official docs, or provide a sure-fire way to figure out exactly which exceptions are thrown by which functions, and why. Thanks!

  Read the article

• When to drop an IT job

  - by Nippysaurus

  In my career I have had two programming jobs. Both these jobs were in a field that I am most familiar with (C# / MSSQL) but I have quit both jobs for the same reason: unmanageable code and bad (loose) company structure. There was something in common with both these jobs: small companies (in one I was the only developer). Currently I am in the following position: being given written instructions which are almost impossible to follow (somewhat of a fools errand). we are given short time constraints, but seldom asked how long work will take, and when we do it is always too long and needs to be shorter (and when it ends up taking longer than they need it to take, it's always our fault). there is no time for proper documenting, but we get blamed for not documenting (see previous point). Management is constantly screwing me around, saying I'm underperforming on a given task (which is not true, and switching me to a task which is much more confusing). So I must ask my fellow developers: how bad does a job need to be before you would consider jumping ship? And what to look out for when considering taking a job. In future I will be asking about documented procedures, release control, bug management and adoption of new technologies. EDIT: Let me add some more fuel to the fire ... I have been in my current job for just over a year, and the work I am doing almost never uses any of the knowledge I have gained from the other work I have been doing here. Everything is a giant learning curve. Because of this about 30% of my time is learning what is going on with this new product (who's owner / original developer has left the company), 30% trying to find the relevant documentation that helps the whole thing make sense, 30% actually finding where to make the change, 10% actually making the change.

  Read the article

• Spring + iBatis + Hessian caching

  - by ILya

  Hi. I have a Hessian service on Spring + iBatis working on Tomcat. I'm wondering how to cache results... I've made the following config in my sqlmap file: <sqlMap namespace="Account"> <cacheModel id="accountCache" type="MEMORY" readOnly="true" serialize="false"> <flushInterval hours="24"/> <flushOnExecute statement="Account.addAccount"/> <flushOnExecute statement="Account.deleteAccount"/> <property name="reference-type" value="STRONG" /> </cacheModel> <typeAlias alias="Account" type="domain.Account" /> <select id="getAccounts" resultClass="Account" cacheModel="accountCache"> fix all; select id, name, pin from accounts; </select> <select id="getAccount" parameterClass="Long" resultClass="Account" cacheModel="accountCache"> fix all; select id, name, pin from accounts where id=#id#; </select> <insert id="addAccount" parameterClass="Account"> fix all; insert into accounts (id, name, pin) values (#id#, #name#, #pin#); </insert> <delete id="deleteAccount" parameterClass="Long"> fix all; delete from accounts where id = #id#; </delete> </sqlMap> Then i've done some tests... I have a hessian client application. I'm calling getAccounts several times and after each call it's a query to DBMS. How to make my service to query DBMS only a first time (after server restart) getAccounts called and for the following calls to use a cache?

  Read the article

• Identity.Name is disposed in a IIS7 Asp.NET MVC application Thread

  - by vIceBerg

  I have made the smallest demo project to illustrate my problem. You can download the sources Here Visual Studio 2008, .NET 3.5, IIS7, Windows 7 Ultimate 32 bits. The IIS Website is configured ONLY for Windows Authentication in an Integreated pipeline app pool (DefaultAppPool). Here's the problem. I have an Asp.NET MVC 2 application. In an action, I start a thread. The View returns. The thread is doing it's job... but it needs to access Thread.CurrentPrincipal.Identity.Name BANG The worker process of IIS7 stops. I have a window that says: "Visual Studio Just-In-Time Debugger An unhandled exception ('System.Object.DisposedException') occured in w3wp.exe [5524]" I checked with the debugger and the Thread.CurrentPrincipal.Identity is valid, but the Name property is disposed. If I put a long wait in the action before it returns the view, then the Thread can do it's job and the Identity.Name is not disposed. So I think the Name gets disposed when the view is returned. For the sake of the discussion, here's the code that the thread runs (but you can also download the demo project. The link is on top of this post): private void Run() { const int SECTOWAIT = 3; //wait SECTOWAIT seconds long end = DateTime.Now.Ticks + (TimeSpan.TicksPerSecond * SECTOWAIT); while (DateTime.Now.Ticks <= end) continue; //Check the currentprincipal. BANG!!!!!!!!!!!!! var userName = Thread.CurrentPrincipal.Identity.Name; } Here's the code that starts the thread public void Start() { Thread thread = new Thread(new ParameterizedThreadStart(ThreadProc)); thread.SetApartmentState(ApartmentState.MTA); thread.Name = "TestThread"; thread.Start(this); } static void ThreadProc(object o) { try { Builder builder = (Builder)o; builder.Run(); } catch (Exception ex) { throw; } } So... what am i doing wrong? Thanks

  Read the article

• Can't get KnownType to work with WCF

  - by Kelly Cline

  I have an interface and a class defined in separate assemblies, like this: namespace DataInterfaces { public interface IPerson { string Name { get; set; } } } namespace DataObjects { [DataContract] [KnownType( typeof( IPerson ) ) ] public class Person : IPerson { [DataMember] public string Name { get; set; } } } This is my Service Interface: public interface ICalculator { [OperationContract] IPerson GetPerson ( ); } When I update my Service Reference for my Client, I get this in the Reference.cs: public object GetPerson() { return base.Channel.GetPerson(); I was hoping that KnownType would give me IPerson instead of "object" here. I have also tried [KnownType( typeof( Person ) ) ] with the same result. I have control of both client and server, so I have my DataObjects (where Person is defined) and DataInterfaces (where IPerson is defined) assemblies in both places. Is there something obvious I am missing? I thought KnownType was the answer to being able to use interfaces with WCF. ----- FURTHER INFORMATION ----- I removed the KnownType from the Person class and added [ServiceKnownType( typeof( Person ) ) ] to my service interface, as suggested by Richard. The client-side proxy still looks the same, public object GetPerson() { return base.Channel.GetPerson(); , but now it doesn't blow up. The client just has an "object", though, so it has to cast it to IPerson before it is useful. var person = client.GetPerson ( ); Console.WriteLine ( ( ( IPerson ) person ).Name );

  Read the article

• Using shared_ptr to implement RCU (read-copy-update)?

  - by yongsun

  I'm very interested in the user-space RCU (read-copy-update), and trying to simulate one via tr1::shared_ptr, here is the code, while I'm really a newbie in concurrent programming, would some experts help me to review? The basic idea is, reader calls get_reading_copy() to gain the pointer of current protected data (let's say it's generation one, or G1). writer calls get_updating_copy() to gain a copy of the G1 (let's say it's G2), and only one writer is allowed to enter the critical section. After the updating is done, writer calls update() to do a swap, and make the m_data_ptr pointing to data G2. The ongoing readers and the writer now hold the shared_ptr of G1, and either a reader or a writer will eventually deallocate the G1 data. Any new readers would get the pointer to G2, and a new writer would get the copy of G2 (let's say G3). It's possible the G1 is not released yet, so multiple generations of data my co-exists. template <typename T> class rcu_protected { public: typedef T type; typedef std::tr1::shared_ptr<type> rcu_pointer; rcu_protected() : m_data_ptr (new type()) {} rcu_pointer get_reading_copy () { spin_until_eq (m_is_swapping, 0); return m_data_ptr; } rcu_pointer get_updating_copy () { spin_until_eq (m_is_swapping, 0); while (!CAS (m_is_writing, 0, 1)) {/* do sleep for back-off when exceeding maximum retry times */} rcu_pointer new_data_ptr(new type(*m_data_ptr)); // as spin_until_eq does not have memory barrier protection, // we need to place a read barrier to protect the loading of // new_data_ptr not to be re-ordered before its construction _ReadBarrier(); return new_data_ptr; } void update (rcu_pointer new_data_ptr) { while (!CAS (m_is_swapping, 0, 1)) {} m_data_ptr.swap (new_data_ptr); // as spin_until_eq does not have memory barrier protection, // we need to place a write barrier to protect the assignments of // m_is_writing/m_is_swapping be re-ordered bofore the swapping _WriteBarrier(); m_is_writing = 0; m_is_swapping = 0; } private: volatile long m_is_writing; volatile long m_is_swapping; rcu_pointer m_data_ptr; };

  Read the article

• How can I keep an event from being delivered to the GUI until my code finished running?

  - by Frerich Raabe

  I installed a global mouse hook function like this: mouseEventHook = ::SetWindowsHookEx( WH_MOUSE_LL, mouseEventHookFn, thisModule, 0 ); The hook function looks like this: RESULT CALLBACK mouseEventHookFn( int code, WPARAM wParam, LPARAM lParam ) { if ( code == HC_ACTION ) { PMSLLHOOKSTRUCT mi = (PMSLLHOOKSTRUCT)lParam; // .. do interesting stuff .. } return ::CallNextHookEx( mouseEventHook, code, wParam, lParam ); } Now, my problem is that I cannot control how long the 'do interesting stuff' part takes exactly. In particular, it might take longer than the LowLevelHooksTimeout defined in the Windows registry. This means that, at least on Windows XP, the system no longer delivers mouse events to my hook function. I'd like to avoid this, but at the same time I need the 'do interesting stuff' part to happen before the target GUI receives the event. I attempted to solve this by doing the 'interesting stuff' work in a separate thread so that the mouseEventHookFn above can post a message to the worker thread and then do a return 1; immediately (which ends the hook function but avoids that the event is handed to the GUI). The idea was that the worker thread, when finished, performs the CallNextHookEx call itself. However, this causes a crash inside of CallNextHookEx (in fact, the crash occurs inside an internal function called PhkNextValid. I assume it's not safe to call CallNextHookEx from outside a hook function, is this true? If so, does anybody else know how I can run code (which needs to interact with the GUI thread of an application) before the GUI receives the event and avoid that my hook function blocks too long?

  Read the article

• How can I share an entity framework model across website users

  - by richardmoss

  Hello, Currently my website is based around MVC and the Entity Framework running against a SQL Server 2005 database. So far, it has all been running very smoothly, and I really enjoy MVC and its slimmer more concise code (and no huge viewstates or soul destroying postbacks ;)) Recently I was working on upgrading the site to use a simple forum system, and this is where I started running into problems. When I was testing the site using two different browsers, if I created or replied to a post in one browser, the other browser couldn't see the post. At the moment, each visitor to the site gets their own copy of the entity model, which I store in their session data. Obviously this is the problem as updates to one model aren't getting carried to the other. As a test, I tried storing a single copy of the model which all visitors would access by assigning the model to a static variable. This worked, and both browsers could see each others modifications. However, it had its side effects. For example, if I fired up both browsers at the same time and the model was initialized, one browser would crash, and the other would work fine, despite me using a locking object so in theory one of them should have been delayed until the model was ready (of course I could have implemented this wrong ;)). Also, originally this site did use one model for all visitors and when it was live, it frequently shut down - killing the IIS application pool while it did. Now I'm not sure if this was related, but I don't really want to reintroduce whatever bug I had that caused this shut down. So, my question is a simple one really - what is the best way of either using the same model for all website users so they all see updates, or if they do have separate copies (which I imagine will have a performance impact in time) how can the models detect changes in the database and update themselves according. Thanks in advance for any advice! Regards; Richard Moss

  Read the article

• Deserialize xml which uses attribute name/value pairs

  - by Bodyloss

  My application receives a constant stream of xml files which are more or less a direct copy of the database record <record type="update"> <field name="id">987654321</field> <field name="user_id">4321</field> <field name="updated">2011-11-24 13:43:23</field> </record> And I need to deserialize this into a class which provides nullable property's for all columns class Record { public long? Id { get; set; } public long? UserId { get; set; } public DateTime? Updated { get; set; } } I just cant seem to work out a method of doing this without having to parse the xml file manually and switch on the field's name attribute to store the values. Is their a way this can be achieved quickly using an XmlSerializer? And if not is their a more efficient way of parsing it manually? Regards and thanks My main problem is that the attribute name needs to have its value set to a property name and its value as the contents of a <field>..</field> element

  Read the article

• Why doesn't java.lang.Number implement Comparable?

  - by Julien Chastang

  Does anyone know why java.lang.Number does not implement Comparable? This means that you cannot sort Numbers with Collections.sort which seems to me a little strange. Post discussion update: Thanks for all the helpful responses. I ended up doing some more research about this topic. The simplest explanation for why java.lang.Number does not implement Comparable is rooted in mutability concerns. For a bit of review, java.lang.Number is the abstract super-type of AtomicInteger, AtomicLong, BigDecimal, BigInteger, Byte, Double, Float, Integer, Long and Short. On that list, AtomicInteger and AtomicLong to do not implement Comparable. Digging around, I discovered that it is not a good practice to implement Comparable on mutable types because the objects can change during or after comparison rendering the result of the comparison useless. Both AtomicLong and AtomicInteger are mutable. The API designers had the forethought to not have Number implement Comparable because it would have constrained implementation of future subtypes. Indeed, AtomicLong and AtomicInteger were added in Java 1.5 long after java.lang.Number was initially implemented. Apart from mutability, there are probably other considerations here too. A compareTo implementation in Number would have to promote all numeric values to BigDecimal because it is capable of accommodating all the Number sub-types. The implication of that promotion in terms of mathematics and performance is a bit unclear to me, but my intuition finds that solution kludgy.

  Read the article

• With C# 3.0, how to write Interface based code with generic collection?

  - by Deecay

  I want to write code that is decouple and clean, and I know that by programming to an interface instead of the implementation, my code will be more flexible and extensible. So, instead of writing methods like: bool IsProductAvailable(ProductTypeA product); I write methods like: bool IsProductAvailable(IProduct product); As long as my products implement IProduct: class ProductTypeA : IProduct I should be OK. All is well until I start using generic collections. Since C# 3.0 doesn't support covariant and contravariant, even though both ProuctTypeA and ProductTypeB implements IProduct, you cannot put List in List. This is pretty troublesome because a lot of times I want to write something like: bool AreProductsAvailable(List<IProduct> products); So that I can check product avaialbility by writing: List<ProductA> productsArrived = GetDataFromDataabase(); bool result = AreProductsAvailable(productsArrived); And I want to write just one AreProductsAvailable() method that works with all IProduct collections. I know that C# 4.0 is going to support covariant and contravariant, but I also realize that there other libraries that seemed to have the problem solved. For instance, I was trying out ILOG Gantt the gantt chart control, and found that they have a lot of collection intefaces that looks like this: IActivityCollection ILinkCollection So it seems like their approach is wrapping the generic collection with an interface. So instead of "bool AreProductsAvailable(List products);", I can do: bool AreProductsAvailable(IProductCollection products); And then write some code so that IProductCollection takes whatever generic collection of IProduct, be it List or List. However, I don't know how to write an IProductCollection interface that does that "magic". :-< (ashame) .... Could someone shed me some light? This has been bugging me for so long, and I so wanted to do the "right thing". Well, thanks!

  Read the article

< Previous Page | 179 180 181 182 183 184 185 186 187 188 189 190  | Next Page >