Search Results

Search found 62701 results on 2509 pages for 'sql function'.

Page 1830/2509 | < Previous Page | 1826 1827 1828 1829 1830 1831 1832 1833 1834 1835 1836 1837  | Next Page >

  • What is the Action returned by the subscribe parameter of IObservable.Create actually for?

    - by James Hay
    The method definition of IObservable.Create is: public static IObservable<TSource> Create<TSource>( Func<IObserver<TSource>, Action> subscribe ) I get that the function is called once the observable is subscribed to, where by I can then call OnNext, OnError and OnComplete on the observer. But why do I need to return an Action from the subscibe parameter and when will it actually be called?

    Read the article

  • jquery fade element does not show elements styled 'visibility: hidden'

    - by kalpaitch
    I have a bunch of thumbnails which I am loading with a style of visibility: hidden; so that they all maintain their correct layouts. Once the page is fully loaded I have a jquery function that fades them in. This worked when their style was set to display: none; but obviously the layout screwed up then. Any suggestions? Heres the fade line: $('.littleme').fadeIn('slow');

    Read the article

  • Jquery problem with errorPlacement.

    - by Eyla
    Greetings, I have problem with errorPlacement, I'm trying to place the error message next to the field but it appearing on the top of the page. any advice how to fix this problem?? here is my code: <%@ Page Title="" Language="C#" MasterPageFile="~/Master.Master" AutoEventWireup="true" CodeBehind="WebForm1.aspx.cs" Inherits="IMAM_APPLICATION.WebForm1" %> <%@ Register assembly="AjaxControlToolkit" namespace="AjaxControlToolkit" tagprefix="asp" %> <asp:Content ID="Content1" ContentPlaceHolderID="head" runat="server"> <script src="js/jquery-1.4.1.js" type="text/javascript"></script> <script src="js/jquery.validate.js" type="text/javascript"></script> <script type="text/javascript"> $(document).ready(function() { $("#aspnetForm").validate({ groups: { username: "fname lname", address: "address1 phone" }, errorPlacement: function(error, element) { if (element.attr("name") == "fname" || element.attr("name") == "lname") error.insertAfter("#lastname"); else error.insertAfter(element); }, debug: true }) }); </script> </asp:Content> <asp:Content ID="Content2" ContentPlaceHolderID="ContentPlaceHolder1" runat="server"> </asp:Content> <asp:Content ID="Content3" ContentPlaceHolderID="ContentPlaceHolder2" runat="server"> <p style="height: 313px"> <label style="position:absolute; top: 227px; left: 22px;">Your Name</label> &nbsp;<input name="fname" value="Pete" style="position:absolute; top: 226px; left: 102px;"/> <input name="lname" id="lastname" style="position:absolute; top: 264px; left: 95px;"/> <input name="address1" style="position:absolute; top: 347px; left: 102px;"/> <input name="phone" id="lastname" style="position:absolute; top: 315px; left: 102px;"/> <br/> <input type="submit" value="Submit Name" style="position:absolute; top: 407px; left: 73px;"/> <input type="submit" value="Submit Address" style="position:absolute; top: 370px; left: 437px;"/> </p> </asp:Content>

    Read the article

  • I want to set the AutoCompleteMode property in ApplyCellStyleToEditingControl subroutine

    - by Ranjan Gupta
    Hi, I am creating a DataGridView Column. and it is working well. now I want to customise this column with AutoCompleteMode, and AutoCompleteSource properties to show the customised data. I made the properties for this columns, and these are also working well. but these properties are not working in the "ApplyCellStyleToEditingControl" subroutine. Please help me to use these column properties in the "ApplyCellStyleToEditingControl" subroutine. Public Class DataGridViewDataValueColumn Inherits DataGridViewColumn Dim m_AutoCompleteMode As AutoCompleteMode, _ m_AutoCompleteSource As AutoCompleteSource, _ m_AutoCompleteStringCollection As AutoCompleteStringCollection Public Sub New() MyBase.New(New DataValueCell()) End Sub Public Overrides Property CellTemplate() As DataGridViewCell Get Return MyBase.CellTemplate End Get Set(ByVal value As DataGridViewCell) ' Ensure that the cell used for the template is a DataValueCell. If (value IsNot Nothing) AndAlso _ Not value.GetType().IsAssignableFrom(GetType(DataValueCell)) _ Then Throw New InvalidCastException("Must be a DataValueCell") End If MyBase.CellTemplate = value End Set End Property Region "User Defined Properties" '&*--------------------------------------*&' <Description("Indicates the text completion behaviour of the combo box."), DefaultValue(AutoCompleteMode.None)> _ Public Property AutoCompleteMode() As AutoCompleteMode Get Return m_AutoCompleteMode End Get Set(ByVal value As AutoCompleteMode) m_AutoCompleteMode = value End Set End Property <Description("The source of complete strings used to automatic completion."), DefaultValue(AutoCompleteSource.None)> _ Public Property AutoCompleteSource() As AutoCompleteSource Get Return m_AutoCompleteSource End Get Set(ByVal value As AutoCompleteSource) m_AutoCompleteSource = value End Set End Property <Description("The autocomplete custom source.")> _ Public Property AutoCompleteCustomSource() As AutoCompleteStringCollection Get Return m_AutoCompleteStringCollection End Get Set(ByVal value As AutoCompleteStringCollection) m_AutoCompleteStringCollection = value End Set End Property End Region End Class '&*--------------------------------------*&' Class DataValueCell Inherits DataGridViewTextBoxCell Public Sub New() ' End Sub Public Overrides ReadOnly Property EditType As Type Get Return GetType(PCLDataGridViewTextBoxEditingControl) End Get End Property End Class '&*--------------------------------------*&' '&* Edit DataGridView Columns *&' '&*--------------------------------------*&' Class PCLDataGridViewTextBoxEditingControl Inherits DataGridViewTextBoxEditingControl Public Overrides Function EditingControlWantsInputKey(ByVal keyData As Keys, ByVal dataGridViewWantsInputKey As Boolean) As Boolean Select Case ((keyData And Keys.KeyCode)) Case Keys.Prior, Keys.Next, Keys.End, Keys.Home, Keys.Left, Keys.Up, Keys.Right, Keys.Down, Keys.Delete Return True End Select Return MyBase.EditingControlWantsInputKey(keyData, dataGridViewWantsInputKey) End Function Public Overrides Sub ApplyCellStyleToEditingControl(ByVal dataGridViewCellStyle As DataGridViewCellStyle) With DirectCast(Me, TextBox) '.AutoCompleteMode = DataGridViewDataValueColumn.AutoCompleteMode_Value '.AutoCompleteSource = DataGridViewDataValueColumn.AutoCompleteSource_Value '.AutoCompleteCustomSource = MyBase.AutoCompleteCustomSource End With End Sub End Class

    Read the article

  • Drupal how to set session or cookie?

    - by Gobi
    Hi, i jus friend reference function so i pass the user id through url like below www.example.com?fid=22 i need to set this as a session or cookie which access to all modules in drupal 6. if i set session it return for tht particular module . set cookie is not workin at all. $user-new_property works only on particular page where set if i move to another page no new_property in $user variable object list . Thanxs in advance, Gobi

    Read the article

  • prettyphoto and nivoslider

    - by Gabriel Ciprian Magda
    I have added the nivoslider and prettyphoto lightbox to a page. What I am trying to do: when you click one of the nivoslider images, prettyphoto should load a video. Everything works ok, except that whenever the nivo slider is sliding the images, the video in prettyphoto lightbox is reloading. How can I prevent the video from reloading once the sliding images are changing? I am not a javascript nija but I am guessing it can be done with changepicturecallback: function(){} from prettyphoto...

    Read the article

  • Javascript: how to access anonymous object within object?

    - by Caballero
    I have a string generated by php's json_encode() that looks like this: [ { "key1":"value1", "key2":"value2", "key3":"value3" }, { "key1":"value1", "key2":"value2", "key3":"value3" } ] I use Javascript function to convert the string to Javascript object: var jsonObj=JSON.parse(string); How do I access the data inside since the inner objects have no names? I tried something like: alert(jsonObj.firstChild.key1); It gives me "undefined". Why is that so?

    Read the article

  • Python equivalent of C++ getline()

    - by Arnab Sen Gupta
    In C++ we can enter multiple lines by giving our own choice of delimiting character in the getline() function.. however I am not able to do the same in Python!! it has only raw_input() and sys.stdin.readline() methods that read till I press enter. Is there any way to customize this so that I can specify my own delimiter?

    Read the article

  • Just a small problem regarding javscript BOM question

    - by caramel1991
    The question is this: Create a page with a number of links. Then write code that fires on the window onload event, displaying the href of each of the links on the page. And this is my solution <html> <body language="Javascript" onload="displayLink()"> <a href="http://www.google.com/">First link</a> <a href="http://www.yahoo.com/">Second link</a> <a href="http://www.msn.com/">Third link</a> <script type="text/javascript" language="Javascript"> function displayLink() { for(var i = 0;document.links[i];i++) { alert(document.links[i].href); } } </script> </body> </html> This is the answer provided by the book <html> <head> <script language=”JavaScript” type=”text/javascript”> function displayLinks() { var linksCounter; for (linksCounter = 0; linksCounter < document.links.length; linksCounter++) { alert(document.links[linksCounter].href); } } </script> </head> <body onload=”displayLinks()”> <A href=”link0.htm” >Link 0</A> <A href=”link1.htm”>Link 2</A> <A href=”link2.htm”>Link 2</A> </body> </html> Before I get into the javascript tutorial on how to check user browser version or model,I was using the same method as the example,by acessing the length property of the links array for the loop,but after I read through the tutorial,I find out that I can also use this alternative ways,by using the method that the test condition will evalute to true only if the document.links[i] return a valid value,so does my code is written using the valid method??If it's not,any comment regarding how to write a better code??Correct me if I'm wrong,I heard some of the people say "a good code is not evaluate solely on whether it works or not,but in terms of speed,the ability to comprehend the code,and could posssibly let others to understand the code easily".Is is true??

    Read the article

  • ckeditor using ajax

    - by sundowatch
    I am preparing a script. I am using AJAX(load()) with jQuery. I am getting a page which includes textarea with ckeditor by load() jQuery AJAX function. Although I include ckeditor's.js file, loaded page doesn't includes javascript file and shows a normal textarea without ckeditor. How can I load file which includes textarea with ckeditor?

    Read the article

  • Python recursion with list returns None

    - by newman
    def foo(a): a.append(1) if len(a) > 10: print a return a else: foo(a) Why this recursive function returns None (see transcript below)? I can't quite understand what I am doing wrong. In [263]: x = [] In [264]: y = foo(x) [1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1] In [265]: print y None

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Looping through array in PHP to post several multipart form-data

    - by Léon Pelletier
    I'm trying in an asp web application to code a function that would loop through a list of files in a multiple upload form and send them one by one. Is this something that can be done in ASP? Because I've read some posts about how to attach several files together, but saw nothing about looping through the files. I can easily imagine it in C# via HttpWebRequest or with socket, but in php, I guess there are already function designed to handle it? // This is false/pseudo-code :) for (int index = 0; index < number_of_files; index++) { postfile(file[index]); } And in each iteration, it should send a multipart form-data POST. postfile(TheFileInfos) should make a POST like it: POST /afs.aspx?fn=upload HTTP/1.1 [Header stuff] Content-Type: multipart/form-data; boundary=----------Ef1Ef1cH2Ij5GI3ae0gL6KM7GI3GI3 [Header stuff] ------------Ef1Ef1cH2Ij5GI3ae0gL6KM7GI3GI3 Content-Disposition: form-data; name="Filename" myimage1.png ------------Ef1Ef1cH2Ij5GI3ae0gL6KM7GI3GI3 Content-Disposition: form-data; name="fileid" 58e21ede4ead43a5201206101806420000007667212251 ------------Ef1Ef1cH2Ij5GI3ae0gL6KM7GI3GI3 Content-Disposition: form-data; name="Filedata"; filename="myimage1.png" Content-Type: application/octet-stream [Octet Stream] [Edit] I'll try it: <html> <head> <title>Untitled Document</title> <meta http-equiv="Content-Type" content="text/html; charset=iso-8859-1"> </head> <body> <form name="form1" enctype="multipart/form-data" method="post" action="processFiles.php"> <p> <? // start of dynamic form $uploadNeed = $_POST['uploadNeed']; for($x=0;$x<$uploadNeed;$x++){ ?> <input name="uploadFile<? echo $x;?>" type="file" id="uploadFile<? echo $x;?>"> </p> <? // end of for loop } ?> <p><input name="uploadNeed" type="hidden" value="<? echo $uploadNeed;?>"> <input type="submit" name="Submit" value="Submit"> </p> </form> </body> </html>

    Read the article

  • jQuery oembed plugin z-index problem

    - by Ben
    I'm using the jQuery oembed plugin to display videos from a Vimeo feed. The only problem is they display over the top of my navigation menu. I have tried setting the z-index of the menu but this makes no difference. A common suggestion seems to be to set the wmode parameter to transparent or opaque. However, passing this as a parameter to the oembed function makes no difference. Thanks

    Read the article

  • Change array that might contain None to an array that contains "" in python

    - by vy32
    I have a python function that gets an array called row. Typically row contains things like: ["Hello","goodbye","green"] And I print it with: print "\t".join(row) Unfortunately, sometimes it contains: ["Hello",None,"green"] Which generates this error: TypeError: sequence item 2: expected string or Unicode, NoneType found Is there an easy way to replace any None elements with ""?

    Read the article

  • how to unpack the contents of a javascript file?

    - by altvali
    Hi all! You know how those packed js files look like, right? eval(function(p,a,c,k,e,d){ ... } ('obfuscated-string'.split('|'),0,{})) It just so happens to be that i have to tweak some large legacy code that looks like that and i want to find a way to turn this into a more readable version. If that's not possible, can i at least get rid of the eval?

    Read the article

  • C# multiple asynchronous HttpRequest with one callback

    - by aepheus
    I want to make 10 asynchronous http requests at once and only process the results when all have completed and in a single callback function. I also do not want to block any threads using WaitAll (it is my understanding that WaitAll blocks until all are complete). I think I want to make a custom IAsyncResult which will handle multiple calls. Am I on the right track? Are there any good resources or examples out there that describe handling this?

    Read the article

  • how to adjust the default width of taglist window in vim

    - by Haiyuan Zhang
    The default width of taglist window is too narrow for me and sometimes I can't see the whole function name in the window so I'd like to adujct the width of the window. I know use ctr-w > or ctr-w < I can adjust the window manually , but really want to change the default value of the taglisst window. so how I can actually do it ? thansk in advance.

    Read the article

  • javascript problem

    - by Gourav
    I have created a dynamic table whose rows gets appended by click of the "Add" button, i want the user not to be able to submit the page if no value is entered in all the rows of the table. how do i achieve this The code is <html> <head> <script type="text/javascript"> function addRowToTable() { var tbl = document.getElementById('tblSample'); var lastRow = tbl.rows.length; var iteration = lastRow+1; var row = tbl.insertRow(lastRow); var cellLeft = row.insertCell(0); var textNode = document.createTextNode(iteration); cellLeft.appendChild(textNode); var cellRight = row.insertCell(1); var el = document.createElement('input'); el.type = 'text'; el.name = 'txtRow' + iteration; el.id = 'txtRow' + iteration; el.size = 40; cellRight.appendChild(el); } function validation() { var a=document.getElementById('tblSample').rows.length; for(i=0;i<a;i++) { alert(document.getElementById('tblSample').txtRow[i].value);//this doesnt work } return true; } </script> <meta http-equiv="Content-Type" content="text/html; charset=ISO-8859-1"> <title>Insert title here</title> </head> <body> <form name ='qqq' action="sample.html"> <p> <input type="button" value="Add" onclick="addRowToTable();" /> <input type="button" value="Submit" onclick="return validation();" /> </p> <p> <table border="1" id="tblSample"> <tr> <td>1</td> <td>The 1st row</td> </tr> </table> </p> </form> </body> </html> Please suggest

    Read the article

  • jQuery getting just added by ajax element

    - by Qiao
    $.post('includes/script.php', $(this).serialize(), function(data) { $('body').append(data); }); alert ($('#new').length) php script is <php echo "<div id="new">text</div>" ?> it alerts 0, so it can't see new div. How can you make it see new div?

    Read the article

  • how to code client-side call to webservice that calls automatically every few seconds

    - by Bob Jones
    I have a webservice that I want to call from the browser every few seconds to see if there are any notification messages in the database that should be displayed on the screen. We have the JSON code working to display the messages in a JavaScript function after an Async Postback, but this only executes after a page turn. I want it to execute every 10-15 seconds as well. A code sample would be very helpful.

    Read the article

  • LDAP to change user password

    - by neobie
    As I know, in PHP, we need to connect LDAP over SSL in order to change user password. Is there another way, E.G, other language (JAVA / ASP) to change LDAP password without SSL required? Thanks. Updates: I get "Warning: ldap_mod_replace() [function.ldap-mod-replace]: Modify: Insufficient access" when I try to modify self account password. If i try to change other user password, I get no error message, but the password still stick to the old one.

    Read the article

< Previous Page | 1826 1827 1828 1829 1830 1831 1832 1833 1834 1835 1836 1837  | Next Page >